#faq | Explore Tumblr Posts and Blogs

strawhattery · 2 days

Text

utilities included: the faq

ahead of the utilities included finale, i shared my retrospring on here & twitter, and i invited anyone to ask questions about the story. you can find the answers to those questions below the cut, and i'll be updating this post as any additional questions come in!

why did you choose an alpha/alpha pairing?

i think i was drawn to that dynamic specifically because it felt the most accurate to how i interpret their canon dynamic. it also gave me a vehicle to explore sanji's identity (and queerness), which was a lot of fun.

why did you choose sanji's limited POV?

limited POV in a romance story creates an interesting layer of narrative tension ("how does the other character feel?") that i love. i also knew early on that i wanted sanji to be a chronic overthinker in contrast to zoro's more simple, straightforward approach to life, and i knew that i wanted that contrast in their personalities to be the root of the story's "conflict." so it was easy to decide that i needed to plant myself in sanji's headspace for the story—that's where all the conflict is!

why did i decide to remove sanji's ability to sense pheromones?

when i was first outlining the story, sanji was actually going to move into the apartment as a favor to his friend luffy, who was begging him to take over his lease. but when i sat down to write this, it didn't really feel like luffy to me, so i pivoted to story so luffy has already run off and nami's trying to find a total stranger to take over his lease. this is what you see at the very beginning of chapter one. however, i quickly realized a plot hole in this: if sanji could sense pheromones, he'd immediately know the place wasn't nami's, and he might not even step foot in the apartment to begin with (because i was always going to write him not liking or trusting other alphas). so. uh. i nixed his ability to smell pheromones. and that spur of the moment decision ended up becoming the cornerstone of sanji's characterization and a major part of his internal conflict. i actually forgot until i sat down to answer this question why this became part of the story because it was a decision made so early in the process that it's funny to think there was ever a version of utilities included in my mind that didn't have it!

which part of utilities included did i enjoy creating the most?

chapter 10 is my favorite chapter overall, but the pool scene at the end of chapter 3 is really special to me. it's the first time sanji realizes these people are thinking of him as a friend, and it's also the strawhats (and friends) being petty criminals in a modern AU. honestly, any of the group scenes (with 4+ characters) i had a blast writing. i love the chaos and the silliness and also being able to push myself to make every character sound distinct from one another on the page. but the pool scene is just extra special for me.

while writing sanji POV, did i think of what zoro's POV would be each scene?

generally speaking: no. when i first started writing fanfiction, i had this compulsion to cram every detail i had thought about into my exposition instead of letting the details come up naturally through conversation or character observation. there are different ways you can get out of this trap as a writer (or lean into it, if you want to), but for me the most effective method was the most simple: if you don't need it, just don't think about it! so unless zoro's state of mind was directly contributing to the plot (because of what he was saying or how he was acting), i simply did not think about it. i like to think that gives sanji's spiraling thoughts some degree of authenticity because while sanji was thinking "how does zoro feel about this?" i was also thinking "hm. i wonder how zoro feels about all this." well. to an extent. i knew that zoro was going to be into sanji from the first moment they met (he likes blades. sanji threw a blade. simple.) and i knew that their first kiss was going to be zoro's "little garden" moment where he'd suddenly go from neutrally annoying sanji to actively stoking the fires of sanji's competitive spirit (and sexuality). and i knew that when the "define the relationship" conversation inevitably came to pass, zoro was going to be just as Not Bothered about it as sanji was Bothered. that's it, that's all i planned for zoro's perspective (with the obvious exception of the epilogue). i'm a big fan of working smarter, not harder with this stuff ☺️

what did sanji first smell like to zoro?

i kind of touch on this in the epilogue, but i'll expand a bit here. for sanji's pheromones, i wanted them to reflect the duality of his canon personality: both harsh and kind. so i wrote his pheromones as being both sweet and a little burnt. when i was thinking of how pheromones "work" i was loosely using the formula of "imagine you smelled a subtle scent ONCE, then ten years later your brain had to recreate that scent from memory." so zoro's brain does something like sweet + burned = caramel / sake, another character's brain might do something like sweet + burned = tobacco. it's less about a 1:1 scent and more about what their brain associates with that scent, if that makes sense? and if it doesn't make sense, you can see why i enjoyed writing a 100k story from the POV of the one character who can't understand this crap ☺️ as for their first impressions: when zoro first walked into the apartment, sanji had been contently cooking, so the room was probably very sweet at first. then there was a sudden, sharp burst of that burnt smell when sanji's anxiety kicked in.

was zoro into sanji from their first meeting? did he have an "oh" moment?

i wouldn't call it love at first death threat, but zoro was definitely interested in sanji from their first meeting. nothing like a little adrenaline to jumpstart zoro's attraction. i don't think zoro had an "oh" moment in the traditional sense, just because i think he goes with the flow so well that he's less likely to get bowled over by a sudden surge of feeling? if that makes sense? i think he'd be much more like "damn, i was right all along" than "oh" but that's just my take on him 🙃 as for when he fell in love, i personally like to think it was watching sanji's ddr match against koby. but i'm open to all other interpretations too ☺️

how did zoro feel seeing sanji cuddling with his friends for the first time in chapter three?

this is an interesting question. i didn't really think about it much while writing the scene, but i think zoro would probably not have lingered on the moment very much. i think, to him, it's obvious that sanji would be integrated into (and loved by) the people closest to zoro. if sanji was the sort of person zoro's friends wouldn't love, zoro would never have pursued anything more with him to begin with, and they would have just stayed contentious roommates forever. but zoro knew from early on how much his friends liked sanji, so seeing them all cuddled up together like that was probably just confirming what he already assumed.

we know what happened to sanji, but what happened this siblings?

i haven't thought too much about this because, again, i don't think sanji thinks too much about what happened to them. he was isolated from his siblings as a child—at first for judge's fear that whatever was wrong with him might be communicable, then later as a sort of carrot-and-stick measure (if sanji got better, he could play with his siblings; as long as he didn't get better, they were allowed to bully him). if i had dug into the vinsmoke siblings more, i'd probably have characterized them as people still adhering to the same reductive beliefs judge tried to instill in sanji early in life. they wouldn't have been exposed to the same medical trauma, but they would have been fed a lot of misinformation about alpha dominance and what it means to be the "right kind" of alpha in this society.

are there any canon side ships in utilities included's universe? are luffy and law an item?

i think the only confirmed ships besides sanji & zoro are robin/franky, nami/vivi, and usopp/kaya. luffy and law definitely have something going on, but what that something is is never confirmed. i'm happy to leave everything about them open to interpretation!

#utilities included #faq #by me #strawhattery #i'll continue to update this with more questions as i get them!

31 notes · View notes

larkingame · 1 day

Note

How old is Mc and the Ro's?

Preacher Abrams (MC): 27

Cyrus: 41

Celina: 46

Dominic: 25

Nash: 28

Rose: 25

Ethel: 26

Ace: 27

Hollis: 31

Reyes: 29

Cassidy: 38

Adam: 5800 (<- roughly)

Montero: 49 (biologically they’re only about 30 though)

Bonus! Wyatt: 59

#thank you!#doctor cyrus sokolov #celina sokolova #dominic sokolov #miss ethel jackson #cassidy alan ward #lieutenant hollis #ace zhang #jacob nash #rose holloway #larkin reyes #larkin adam #montero moreau #wyatt abrams #preacher abrams #faq

46 notes · View notes

genericpuff · 2 days

Text

FAQ updated!

For those who aren't aware, I actually do have an FAQ page on my Tumblr blog, but it's only visible from the actual desktop version of the site which will obviously go unnoticed by anyone on mobile. I recently updated it to include some extra frequently asked questions, including the question regarding Persephone's age in Rekindled, questions about creating comics, and the question of why I'm making a fanfic rewrite version of LO instead of just writing my own Greek myth comic. Find the updated FAQ here! I'll also be editing it into the masterpost so that it'll be more accessible going forward :)

#ask me anything #ama #anon ama #anon ask me anything #faq #frequently asked questions

25 notes · View notes

bonus-links · 9 months

Text

WOO, finally got this ref chart together! the art's actually kinda old by now (I started this back in february) but I didn't feel like redrawing everything outside outfit changes sooooo,,,,,my apologies 😅 here's the main cast! you can find individual refs in this masterpost

#height differences may be slightly inaccurate i forgot to take heel height into account sometimes #faq #bonus links #bonuslinksdotjpg #bonus content #bonus war #bonus wake #bonus wolf #bonus mage #bonus loft #bonus mask #bonus mirror #bonus slate #bonus spirit #bonus mini #all links #if ur familiar w bonus lore there are some slight changes here. again. sorry <3 #bonuslinks #spoiler link

8K notes · View notes

mcytblrsexymen · 1 year

Text

MCYT SEXYMAN WINNER JOE HILLS

[ID: the sexyman bracket, showing that the final winner is Joe Hills]

#mcytblr sexyman #Joe Hills #faq #actual polls #mcytblr sexyman infographic

13K notes · View notes

havnenndiaco · 5 days

Text

#mickey mouse #dazstudio #sav #little kitten #sickies #faq #mixtape #blog #beutiful #thememagic

1K notes · View notes

akanemnon · 9 months

Text

TWIN RUNES MASTERPOST

1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 -15 - 16 - 17 - 18 - 19 - 20 - 21 - 21-1 - 21-2 - 21-3 - 22 - 23 -24 - 25 - 26 - 27 - 28 - 29 - 30 - 31 - 32 - 33 - 34 - 35 - 36 - 36-1 - 37 - 38 - 39 - 40 - 41 - 42 - 43 - 44 - 45 - 46 - 47 - 48 - 49 - 50 - 51 - 52 - 53 - 54

To be continued...

TWIN RUNES MINI COMICS

Glasses - Fallen down - First steps - Press [C] - Frisk Dance - But nobody came - Whatstheirface - An acquired taste - Eye opening

______________________________________________________________

TWIN RUNES - FAQ

What exactly is this AU about? Twin Runes is essentially a comedic crossover AU between the universes of Deltarune and Undertale. No fancy nicnacs. Just the characters being their chaotic selves. But there might be some darkness lurking up ahead...

When is the next comic? The comic updates most Sundays at 6:30 PM Central European Time.

Why is this AU called Twin Runes? The name is more or less a play on the typical naming format of most AU's by featuring the "Runes" part. There are no literal Twin Runes. The whole name is more of a stand in for Undertale and Deltarune as parallel worlds. Hence the "Twin" part.

When does Twin Runes take place? This AU takes place between a hypothetical Chapter 3 and Chapter 4 of Deltarune. On the Undertale side of things, it takes place post neutral route just as Frisk was about to deliver Undyne's letter to Alphys.

Is the player a thing in this AU? The player lost control over both human children as soon as Frisk entered the world of Deltarune.

When Chapter 3 and 4 are released, will it affect the story? Any chapters after Chapter 3 won't affect the story in the grand scheme of things. If possible, I might make a reference to Chapter 3, but all in all Twin Runes created a new timeline so to speak.

What's up with Kris' and Frisk's hair? The red bits of their hair is more or less a representation of their souls. That in turn is also why Chara doesn't have that feature. They are soulless. It's a stylistic choice.

What's that thing on Kris' chest? It's a scar they got from tearing out their soul.

And why do they have weird lines all over their body? Both Kris and Frisk's anatomy resemble that of ball-jointed dolls. They appear just as markings across their bodies. Think of them as elaborate birthmarks. Kris and Frisk are still made of flesh and blood, but are in fact hypermobile. The reason as to why they do is still a little secret :) People here like to refer to these markings as "puppet limbs". You can get a better look at them and the scar in this artwork

Why does Kris have braces? This is why:

Why is Dark World Frisk green? Frisk changes their main sweater colors with Kris when they enter the Dark World.

Can other ghosts see Chara? (pre Darkner transformation) No, only Frisk and Kris are able to see Chara.

IS KRIS NOW FRISK'S COUNTERPART OR CHARA'S???? :)

So, was Chara in the locket all along? No, Chara possessed the locket to become a Darkner.

Where are Jevil and Spamton? Are they in Castle Town? The Fun Gang have already fought these two in the previous chapters and added them into their inventory. Outside of that little dream sequence, neither will be making an appearance.

Is anyone from Undertale Yellow gonna make an apperance? Outside of a tiny cameo from Clover (that has no greater bearing on the story) no one from Undertale Yellow is going to make an appearance.

Is (insert character here) gonna go to the Dark World/underground? With the way the story is going to play out, only the main group will be heading to this new Dark World. The rest of the story will be taking place there.

Is the Group Project miniseries canon to Twin Runes? It was made before Twin Runes was conceived and before I had any idea I would make a series. It is it's own self-contained story. So it is NOT canon to Twin Runes, but You can read it here: 1 - 2 - 3 - 4 - 5 - 6

How did you come up with the idea of Twin Runes? Twin Runes is an offshoot of a separate script I wrote. It's a similar concept but turned on its head. The funny moments in that script made me just continue what now is the start of Twin Runes. I pretty much just wanted to see if I am actually capable of drawing a comic to begin with. So... in a way Twin Runes is my first attempt at a comic ever. If I ever finish Twin Runes, then I know I can tackle turning that mammoth project of a script into a comic too. In the grand scheme of things these two projects are sister series. They have A LOT in common and even share similar plot elements. When Twin Runes is over you will automatically also know certain mysteries of The Other Script.

What is The Other Script? As of this moment I call The Other Script: "Lost in the In-Between". At its core it's an inverse of Twin Runes. I.e. Kris falling into the underground and being aided by Frisk on their quest to return home. The story and jokes are a considerably more grounded than in Twin Runes and so are the characters. Though they do have their moments from time to time. The overall mood of that script is a lot darker in nature and it's a 200+ page passion project of mine.

Am I allowed to make fanart? ABSOLUTELY! You are very welcome to make fanart if you feel like it. Please let me know if you do by tagging me, so I can share it with everyone to see so that you get the appreciation you deserve :)

Can I use the funny faces you draw for memes or for private stuff with friends? That's what they're here for :)

Is there x ship in this comic? The focus of the story is not on shipping. If it's in the game it will very likely be mentioned or brought up, but that's about it.

What pronouns do you go with for the human children? I try to stick as close as possible to the games so I use THEY/THEM FOR ALL OF THEM WITHOUT ANY EXCEPTIONS.

______________________________________________________________

ABOUT ASKS

Asks will open for 24 hours after a new comic has been released. Your questions will then be answered over the course of the week.

Try not to submit multiple asks. If necessary, just keep everything in one post.

Keep in mind that I receive AL LOT of asks, so not every question can be answered...

Questions containing spoilers will not be answered on principle. Wouldn't be as fun if the surprise was ruined, right?

Before leaving an ask (mostly for everyone who's new), please make sure to read the FAQ section above. A lot of times your question might have been answered already :>

I love memes and dumb jokes as much as the next guy, but try not to spam

It probably goes without saying, but please stay civil. I want to give everyone the respect they deserve, and naturally like to be treated the same way.

Please be mindful about drawing requests. It is understandable if you're eager to see a certain character drawn in my style, but I do not like to be bombarded by requests. The more it happens, the less likely I am to do it. Be kind and ask nicely.

Don't use other people's posts that I reblogged to ask me questions! It has happened before and I do not wish to see this!

______________________________________________________________

REFERENCE SHEETS

The following are ref sheets of characters that don't have established Dark World forms yet (as of writing this comic). The list will be updated as soon as a new character enters the Dark World. Here you will also find references of characters that might appear as surprise cameos, or maybe even completely new faces...

______________________________________________________________

FULL ART

#twin runes #twin runes masterpost #masterpost #deltarune comic #comic #deltarune au #crossover #undertale #my art #FAQ #frequently asked questions #important #please read #deltarune

4K notes · View notes

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

writingwithcolor · 6 months

Text

WritingWithColor FAQ: How do I start writing a character of color?

First, be mindful that no race, culture, or ethnicity makes one inherently predisposed to certain emotions or personalities, despite what stereotypes or TTRPGs may suggest. We are all humans who share the same range of emotions and ways of thinking, even if we have different values.

Understand that there is no single template for a good [race, ethnicity] character. A person’s social, economic, and geographical background influences their life and values just as much as their race, culture, or religion. Consider: a Black American boy who grew up in a California mansion versus a Black American boy who grew up on an Illinois cornfield versus a Black boy who grew up in an apartment one city over. All three will have very different privileges, disadvantages, and outlooks on life.

Further reading (WWC x NaNoWriMo):

The Do’s of Writing PoC

Properly Coded: Creating Characters of Color

3 Ways to Show a Character's Culture

---

This Q&A is an excerpt from our General FAQ for Newcomers, which can be found in our new Masterpost of rules and FAQs. For more general resources on POC representation, check it out!

-Writing With Color

#writing with color #writeblr #representation #poc representation #writers on tumblr #writing advice #writing tips #faq

2K notes · View notes

disteal · 2 months

Text

head up if you don’t want tumblrs partnered ai companies automatically scraping your blog for image datasets, you need to manually opt out.

You can’t do this in the app rn (apparently you can but I couldn’t find it so you might have to update), only the desktop version or web browser on your phone. It will also need to be done for every sideblog you have.

You find it by opening up your blog settings > scroll down to visibility > prevent third party sharing

As an aside, I’d thoroughly recommend opting out of having your blog scraped, even if you’re not an artist. Afaik Tumblr hasn’t explicitly stated which companies they’ll be partnering with, but the vagueness of that wording is really alarming.

These datasets use a lot of selfies for photorealistic results, moderation of who has access to these datasets is notoriously ass, and a lot of AI engines are being used to generate pornography and racist imagery (you can see this rn with the rise of ai generated propaganda). While ‘your likeness is used in an awful generated image without your consent’ IS a worst case scenario, it’s a really upsetting one. Protect yourselves.

#dis.txt #ai discourse #ik this is all on tumblr faq but i can’t stomach reblogging their ridiculous staff post #it’s not staffs fault bc matt has been salivating at the chance for this for months now apparently #but the language rly cushions from how shit this is #faq

1K notes · View notes

dailyanarchistposts · 2 days

Text

A.2.3 Are anarchists in favour of organisation?

Yes. Without association, a truly human life is impossible. Liberty cannot exist without society and organisation. As George Barrett pointed out:

“To get the full meaning out of life we must co-operate, and to co-operate we must make agreements with our fellow-men. But to suppose that such agreements mean a limitation of freedom is surely an absurdity; on the contrary, they are the exercise of our freedom. “If we are going to invent a dogma that to make agreements is to damage freedom, then at once freedom becomes tyrannical, for it forbids men to take the most ordinary everyday pleasures. For example, I cannot go for a walk with my friend because it is against the principle of Liberty that I should agree to be at a certain place at a certain time to meet him. I cannot in the least extend my own power beyond myself, because to do so I must co-operate with someone else, and co-operation implies an agreement, and that is against Liberty. It will be seen at once that this argument is absurd. I do not limit my liberty, but simply exercise it, when I agree with my friend to go for a walk. “If, on the other hand, I decide from my superior knowledge that it is good for my friend to take exercise, and therefore I attempt to compel him to go for a walk, then I begin to limit freedom. This is the difference between free agreement and government.” [Objections to Anarchism, pp. 348–9]

As far as organisation goes, anarchists think that “far from creating authority, [it] is the only cure for it and the only means whereby each of us will get used to taking an active and conscious part in collective work, and cease being passive instruments in the hands of leaders.” [Errico Malatesta, Errico Malatesta: His Life and Ideas, p. 86] Thus anarchists are well aware of the need to organise in a structured and open manner. As Carole Ehrlich points out, while anarchists “aren’t opposed to structure” and simply “want to abolish hierarchical structure” they are “almost always stereotyped as wanting no structure at all.” This is not the case, for “organisations that would build in accountability, diffusion of power among the maximum number of persons, task rotation, skill-sharing, and the spread of information and resources” are based on “good social anarchist principles of organisation!” [“Socialism, Anarchism and Feminism”, Quiet Rumours: An Anarcha-Feminist Reader, p. 47 and p. 46]

The fact that anarchists are in favour of organisation may seem strange at first, but it is understandable. “For those with experience only of authoritarian organisation,” argue two British anarchists, “it appears that organisation can only be totalitarian or democratic, and that those who disbelieve in government must by that token disbelieve in organisation at all. That is not so.” [Stuart Christie and Albert Meltzer, The Floodgates of Anarchy, p. 122] In other words, because we live in a society in which virtually all forms of organisation are authoritarian, this makes them appear to be the only kind possible. What is usually not recognised is that this mode of organisation is historically conditioned, arising within a specific kind of society — one whose motive principles are domination and exploitation. According to archaeologists and anthropologists, this kind of society has only existed for about 5,000 years, having appeared with the first primitive states based on conquest and slavery, in which the labour of slaves created a surplus which supported a ruling class.

Prior to that time, for hundreds of thousands of years, human and proto-human societies were what Murray Bookchin calls “organic,” that is, based on co-operative forms of economic activity involving mutual aid, free access to productive resources, and a sharing of the products of communal labour according to need. Although such societies probably had status rankings based on age, there were no hierarchies in the sense of institutionalised dominance-subordination relations enforced by coercive sanctions and resulting in class-stratification involving the economic exploitation of one class by another (see Murray Bookchin, The Ecology of Freedom).

It must be emphasised, however, that anarchists do not advocate going “back to the Stone Age.” We merely note that since the hierarchical-authoritarian mode of organisation is a relatively recent development in the course of human social evolution, there is no reason to suppose that it is somehow “fated” to be permanent. We do not think that human beings are genetically “programmed” for authoritarian, competitive, and aggressive behaviour, as there is no credible evidence to support this claim. On the contrary, such behaviour is socially conditioned, or learned, and as such, can be unlearned (see Ashley Montagu, The Nature of Human Aggression). We are not fatalists or genetic determinists, but believe in free will, which means that people can change the way they do things, including the way they organise society.

And there is no doubt that society needs to be better organised, because presently most of its wealth — which is produced by the majority — and power gets distributed to a small, elite minority at the top of the social pyramid, causing deprivation and suffering for the rest, particularly for those at the bottom. Yet because this elite controls the means of coercion through its control of the state (see section B.2.3), it is able to suppress the majority and ignore its suffering — a phenomenon that occurs on a smaller scale within all hierarchies. Little wonder, then, that people within authoritarian and centralised structures come to hate them as a denial of their freedom. As Alexander Berkman puts it:

“Any one who tells you that Anarchists don’t believe in organisation is talking nonsense. Organisation is everything, and everything is organisation. The whole of life is organisation, conscious or unconscious … But there is organisation and organisation. Capitalist society is so badly organised that its various members suffer: just as when you have a pain in some part of you, your whole body aches and you are ill… , not a single member of the organisation or union may with impunity be discriminated against, suppressed or ignored. To do so would be the same as to ignore an aching tooth: you would be sick all over.” [Op. Cit., p. 198]

Yet this is precisely what happens in capitalist society, with the result that it is, indeed, “sick all over.”

For these reasons, anarchists reject authoritarian forms of organisation and instead support associations based on free agreement. Free agreement is important because, in Berkman’s words, ”[o]nly when each is a free and independent unit, co-operating with others from his own choice because of mutual interests, can the world work successfully and become powerful.” [Op. Cit., p. 199] As we discuss in section A.2.14, anarchists stress that free agreement has to be complemented by direct democracy (or, as it is usually called by anarchists, self-management) within the association itself otherwise “freedom” become little more than picking masters.

Anarchist organisation is based on a massive decentralisation of power back into the hands of the people, i.e. those who are directly affected by the decisions being made. To quote Proudhon:

“Unless democracy is a fraud and the sovereignty of the People a joke, it must be admitted that each citizen in the sphere of his [or her] industry, each municipal, district or provincial council within its own territory … should act directly and by itself in administering the interests which it includes, and should exercise full sovereignty in relation to them.” [The General Idea of the Revolution, p. 276]

It also implies a need for federalism to co-ordinate joint interests. For anarchism, federalism is the natural complement to self-management. With the abolition of the State, society “can, and must, organise itself in a different fashion, but not from top to bottom … The future social organisation must be made solely from the bottom upwards, by the free association or federation of workers, firstly in their unions, then in the communes, regions, nations and finally in a great federation, international and universal. Then alone will be realised the true and life-giving order of freedom and the common good, that order which, far from denying, on the contrary affirms and brings into harmony the interests of individuals and of society.” [Bakunin, Michael Bakunin: Selected Writings, pp. 205–6] Because a “truly popular organisation begins … from below” and so “federalism becomes a political institution of Socialism, the free and spontaneous organisation of popular life.” Thus libertarian socialism “is federalistic in character.” [Bakunin, The Political Philosophy of Bakunin, pp. 273–4 and p. 272]

Therefore, anarchist organisation is based on direct democracy (or self-management) and federalism (or confederation). These are the expression and environment of liberty. Direct (or participatory) democracy is essential because liberty and equality imply the need for forums within which people can discuss and debate as equals and which allow for the free exercise of what Murray Bookchin calls “the creative role of dissent.” Federalism is necessary to ensure that common interests are discussed and joint activity organised in a way which reflects the wishes of all those affected by them. To ensure that decisions flow from the bottom up rather than being imposed from the top down by a few rulers.

Anarchist ideas on libertarian organisation and the need for direct democracy and confederation will be discussed further in sections A.2.9 and A.2.11.

24 notes · View notes

butchfairyzine · 4 months

Text

Butch Fairy Zine: Answering questions

What art style are we looking for? What is the estimated timeline? Will you get paid? we answer them here!

We will be answering more questions and posting them in the days leading up to the artist application form opening. So if you have questions, use our inbox, or you can fill in our interest form and leave them at the bottom. And if you have queries for the frog, you can leave them there too. He is very busy, so keep that in mind.

Find the interest form here.

Our Artist Application form will open on the 12th of January 2024.

text version under the cut

What type of artists are you looking for? And are you after a specific style or a range of styles?

We are looking for artists who can create pieces with fully rendered fairies and a background within the specified schedule. These can be digital artworks that are flat colour artworks, paintings, a mixture, or another style entirely.

We will also accept mixed media and traditional artworks, but they will need to be scanned at a minimum of 300dpi.

When you sign up for an artist position, are there any requirements to be a part of the team?

E-mail communication is required (discord is optional).

You must have a PayPal account to receive payment.

You must be able to communicate comfortably in English.

You must be 18 or older at the time of signing the contract by the 16th of February.

For artists accepted into the zine what would be the timeline for completing and submitting artwork?

Our current schedule for the artists requires concept ideas to be submitted by Feb 16th, and the final version by May 16th! Progress check-ins will be on Feb 29th, March 21st, and April 11th.

(In the image there is also a table including this information as well as the final submissions date being May 16th)

When the zine is for sale, where would the profits go to (charity, zine admin, etc.)?

We are aiming to hold pre-orders in June/July of 2024, with a flat fee paid to all contributors and additional proceeds split between contributors and mods.

Our priority is to make sure each contributor is paid fairly for their work. If sales do well enough, 20% will be used for future books and projects, and 80% split between taxes and fees, production costs, contributors and shipping costs.

Is this physical or digital and will there be prints of the art available? Got any merch ideas planned to go along with the zine?

Both physical and digital! Our goal is to make a 210 x 148 mm (A5) perfect-bound soft cover book.

We also plan to add some paper merch, including prints of some of the art from the book. Additional merch ideas include stickers, sticker sheets and bookmarks.

#art zine #butch fairy zine #fairy zine #art jobs #faq #answering questions with the frog

1K notes · View notes