Becoming an Intelligent Woman
My Dears,
There is no greater goal than being a fine woman who is intelligent, kind, and elegant. As much as we all want to be described with these adjectives, it takes a great amount of discipline to get there. It is very doable only if you are ready to put in the work.
Here are steps you can add to your routine in the next 4 weeks that will make you 1% more intelligent than you were before. This is a process that should become a habit not a goal. It is long term, however, I want you to devote just 4 weeks into doing these steps first and recognize the changes that follow.
Watch documentaries: This is the easiest step, we all have access to Youtube. Youtube has a great number of content on art, history, technology, food, science etc that will increase your knowledge and pique your curiosity. I really did not know much about world history especially from the perspective of World war 1 & 2, the roaring 20s, Age of Enlightenment, Jazz era, monarchies etc but with several channels dedicated to breaking down history into easily digestible forms. I have in the last 4 weeks immersed myself into these documentaries. Here are a few I watched:
The fall of monarchies
The Entire History of United Kingdom
The Eight Ages of Greece
World War 1
World War 2
The Roaring '20s
The Cuisine of the Enlightenment
2. Read Classics: I recommend starting with short classics so that you do not get easily discouraged. Try to make reading easy and interesting especially if you struggle with finishing a book. Why classics? You see, if you never went to an exclusive private school in Europe or America with well crafted syllabus that emphasized philosophy, history, art, and literary classics, you might want to know what is felt like and for me this was a strong reason. Asides that, there is so much wisdom and knowledge available in these books. In these books, you gain insights to the authors mind, the historical context of the era, the ingenuity of the author, the hidden messages, and the cultural impact of these books. Most importantly, you develop your personal philosophy from the stories and lessons you have accumulated from the lives of the characters in the books you read. Here are classics to get you started:
Animal Farm by George Orwell
Pride and Prejudice by Jane Austen
Jane Eyre by Charlotte Brontë
The Great Gatsby by F Scott Fitzgerald
Candide by Voltaire
Paradise lost by John Milton
3. Study the lives of people who inspire you: I dedicate one month to each person that fascinates me. I read their biography (date of birth, background, death, influences, work, style, education, personal life) For this month, I decided to study Frank Lloyd Wright because I was fascinated by the Guggenheim Museum in New York. I began to read about his influence in American Architecture (Organic architecture, Prairie School, Usonian style), his tumultuous personal life, his difficult relationship with his mentor (Louis Sullivan), his most iconic works etc. By the end of the year I would have learned the ins and outs of people I am inspired by through books and documentaries. Here are other people I plan to learn more about:
Winston Churchill
Jacqueline Kennedy Onassis
Ada Lovelace
Benjamin Franklin
Helen Keller
John Nash
Isabella Stewart Gardner
Caroline Herrera
Ernest Hemingway
Catherine the Great
Ann Lowe
My dears, I hope you enjoyed this read. I cannot wait to write more on my journey to becoming a fine woman. I urge you to do this for four weeks and see what changes you notice. Make sure to write as well, it is important to document your progress.
Cheers to a very prosperous 2024!
2K notes
·
View notes
My Boobs - LN
Summary: Lando loves his girlfriend's boobs and she's just got used to him in private and public, in fact half of the time others notice before she does
I know the picture on the right is re-used from another fic, but like it works too perfectly for this.
Big yitties!reader
No part 2 requests place
Lando is without a doubt a clingy man, having his girlfriend within sight. He never far from pulling her towards himself and 9 out of 10 times holding her boobs.
People he's close to have learnt to just ignore it. But others who aren't so close, still seems shocked by how unbothered y/n is by it.
At the moment Lando is currently lying with his head on her tummy and his hands very firmly planted on her boobs while they wait for George to arrive for the Sky karting video they want to recreate 5 years later.
"I like his helmet." Alex comments inspect the design of the helmet.
"Yeah it's cool, and it matches his sister's riding helmet." Y/n smiles making Alex smile and nod. "I like it the little touches like his name. Some fans said he should put like Silverstone in the design."
"I like that, or just make all the like blobs be all the tracks on the calendar." Alex hums as George appears and looks at the three.
"Does that never get annoying?" George questions making y/n look down and smile ruffling Lando's hair.
"He's just my clingy boyfriend. But since you're here...Lando...wakey wakey." Y/n smiles drumming her hands lightly on his back earning a grunt. "You gotta go karting."
Lando untucks his face from against her sweater looking up at her with tired eyes while she smiles at him, laughing lightly.
"You know it's only the two of you who can get away with that amount of PDA, if anyone else did it, it'd be like...condemned." Alex comments as Lando sits up moving his hands to neaten his hair up. "Y/n called you clingy."
"I'm not." Lando frowns turning around to look at y/n who raises her eyebrows at him for actually trying to argue.
"Alright...you're not clingy." Y/n states but her tone definitely suggests something else is a play.
Lando ends up changing with the rest of the boys for karting and when he moves before they head out to give her a kiss he finds her turning her head so his lips land on her cheek.
"Hey-"
"Go on, you're on a schedule." Y/n cuts in earning a frown. "I thought you weren't clingy."
"Woooooow." Lando laughs then shaking his head. "Fine, be like that."
"Fine, I will." Y/n smiles since she's enjoying this.
Lando leaves her inside while he gets out to join the rest of the boys and all the team actually setting this up.
A little over an hour later, Lando reappears and when he sees y/n the earlier conversation is the last thing on his mine when he moves over with a pout.
"Alex hit me with some gravel." Lando mumbles showing a pretty nasty red mark on his neck.
"Aww...poor baby." Y/n coos in a slightly mocking manner before laughing when he wraps his arms around her.
"The team is karting with Oscar...will you stay here with me?"
"Ok, but you can't touch my boobs." Y/n sighs making him retract back from where he'd hidden his face.
"What? Why?"
"Because I only let my clingy boyfriend hold my boobs and you aren't clingy."
"Your boobs? They're my boobs. I pay more attention and love to them." Lando scoffs actually looking offended, much to y/n's amusement. "My boobs."
"You're such a weirdo." Y/n laughs before the kisses him. "Let's go watch the team."
Lando grunts in agreement then leading them down to a little podium that looks out on the track before y/n settles on his lap, not even paying attention when Lando's hands go up to holding her boobs, cupping them softly as he kisses the back of her neck, just peaking over her shoulder to watch members of the McLaren team zooming around the track.
-
Y/n is actually too focused on booking and arranging a holiday for the two of them to be paying attention to the conversation happening around her.
They're sitting in the McLaren unit, Lando having managed to sit down with Will and Jose both of whom have become accustom to ignoring y/n, in the most polite way possible.
The physical touch neediness of Lando is now just part of speaking to him if y/n in is the vicinity.
Which by this point is always. Initially she was only at a few race then maybe every other race and then eventually the number of races she doesn't attend dwindled to zero.
Eventually the conversation with his race engineers comes to an end and the two men take off to go do what they need to do after the conversation.
"Baby, you haven't eaten." Lando mumbles actually squeezing her boobs as a means to get her attention as he rests his chin on her shoulder.
"Sorry, I was booking our trip for the winter break-and I know it's literally ages away but I want to book it now before I forget and lose motivation to book it at all-or forget that I even wanted to go on the trip." Y/n rambles before sighing and placing her phone down to the side so she can pull her food closer. Though she pauses before taking a mouthful. "Lando...I can't focus on eating if you're playing with my nipples."
"You have before." Lando mumbles but he stops anyway because her does actually want her to finish eating.
-
Now on a normal day back at home in Monaco, y/n is lucky to find a day that Lando has plans which don't include her. Not that she wants to be away from him, but he seems to have a knack for making sure he can take her everywhere.
On this occasion he's caught some kind of bug and it means all arranged plans are cancelled for rest.
"You're so cute when you're all pouty and sick." Y/n coos while Lando groans and rubs his fevered head between her boobs. "If you'd let me get up then I could try and do something to break your fever."
"No." Lando groans earning a sigh and hum.
"Ok." Y/n whispers running her hands through his curls a couple times before she relaxes against the sofa.
At some point she falls asleep, maybe because she's trapped under Lando and there's not much else to do. Maybe because his body heat radiating off of him is really acting as a means of knocking her out.
She ends up only waking up to Lando's voice because he's taking a phone call and it rises her from the sleep she'd fell into.
"No, mate. I feel like shit, I don't know what I've caught but it's the worst." Lando states before y/n hears Max's voice.
"Mate, you said you were coming back to England for golf." Max laughs as y/n feels Lando rubbing gently over her boob which he's somehow got out from under her t-shirt without waking her up. "Where's y/n?"
"Underneath me pretending to be asleep."
"I'm not pretending, you woke me up so I'm trying to go back to sleep." Y/n murmurs with a grumble before she hisses when he bites her nipple gently. "Ah, I thought you were ill."
"I am-anyway mate, we'll have to reschedule." Lando states as y/n rolls her eyes and slaps her hand onto his forehead with an audible slap on his skin. "Still a fever?"
"Yeah." Y/n mumbles then sighing. "Sorry, Max. I can't force him to keep to his commitments with you."
Max agrees to reschedule it before the call ends and Lando sighs look at y/n with slightly bloodshot eyes making her frown.
"Can I please get up and get you something to drink? You need to keep your fluids up." Y/n yawns while Lando hums kissing her boob before seeming to shove his face into the soft skin making her laugh a little and gently push his head away. "Alright, clingy. Get off, I'm putting my foot down. You need water and honestly so do I."
Lando very begrudgingly allows her to stand up but he doesn't get up without following her, making what should be an easier task of getting them both water a much harder task by following her very close behind so his hands don't leave her boobs.
"Can you please let me do something to get your fever down? We're both drenched in your sweat." Y/n mumbles after managing to turn and get him to drink what turns into the better part of over half a water bottle. "A lukewarm shower?"
"Ok, but I'm not going to force you to endure that."
"How kind."
"But can we cuddle again once we're both clean?"
"So long as I can put like a cold cloth on your neck to try and keep you cool." Y/n smiles earning a nod of agreement. "Alright, drink so more. Then we'll shower and you can get back to treating my boobs like they belong to you."
"Y/n, they literally are my boobs." Lando mumbles sounding like he wants to but more energy into that sentence but he's also just being a clingy boyfriend right now and he doesn't want to push in fear of his privileges being provoked.
"You're so adorable." Y/n laughs then leaning forward and kissing him.
"Yeah, just wait till you're sick now you've kissed me."
"I've been saturated in your sweat all day. I promise you, if I'm going to get sick it's going to be from that. Not a kiss."
Lando hums moves his hands back up to cup her boobs.
"I'm never sure if you love me or my boobs more."
"You but your boobs are definitely strong competition." Lando jokes earning a hum before she hums.
They do manage to finally get showered and y/n decides to pull some more of the water bottles out to be within reaching distances of lying together, she also blowdries her hair before insisting they lie in bed and that way if they fall asleep they have more space.
Not that Lando intends to give her any of that space.
And in true nature as a result of his clinginess. Y/n has to share it with people so she posts a picture which does actually include Lando's hand gently cupping her boob while he seems to hide his face between her ribs and the mattress as he cuddles into her.
And of course, his fans absolutely melt over the sick Lando content. So she posts more of him over the next 24 hours before he's seemingly back to health and then he returns the favour of nursing y/n since she did get sick.
"My poor baby." Lando laughs as she whines and nuzzles into him before he rolls her so her back is to his chest and so he can wrap an arm around her and cup her boob before kissing her neck. "Don't worry, I'll take care of you, beautiful."
"I don't even know if you're talking to me or my boobs."
"Shut up. I'm not that bad." Lando laughs though he gives them a gentle squeeze.
3K notes
·
View notes
Can you do a Tom blyth x reader where in a interview , the interviewer asks him if he wants to marry and have kids in the future and he answers that he already has a daughter with the reader and after few days he posts on Instagram a photo of his daughter playing in the grass when he was filming the movie nad the fans going crazy ( about how cute she is and smth like that )
My Girl || Tom Blyth x Actress!reader
A/n: baby fever right now is astronomically high 😭😭 also this song is my absolute fav and feels like it matches with this so def go listen to it!!!
Warnings: none :)
Wc:
Divider by @pommecita
“Tom, your fans have been asking if you plan on marrying and having children in the future,” Tom nods his head, a smile forming on his lips, “What can you say to them?” The interviewer directs her mic to Tom.
He could feel your eyes burning into the side of his face as his grip on your waist squeezes. “Marrying and having children?” Tom repeats. You watch in anticipation as you give him an encouraging smile. The two of you had been waiting for a moment like this.
It’s been three years since you gave birth to your daughter, Elsie, three years since Tom became a dad. The public had no idea whatsoever and you intended to keep it the way for a few years longer. Well, after a long conversation with Tom, it was time to stop hiding from the public.
“This is the first time I’ve actually spoken about this to the public but I have a daughter already,” His words make the women holding the mic gasp out loud as you both let out a chuckle at her reaction. “I know, shocking right!” Tom smiles.
“You have a daughter Tom? With….” She trails off as her eyes move to you. Tom pulls you to his chest as you give the woman a grin, nodding your head as she puts her hand on her chest and lets out another gasp. “Am I the first to know about this outside your close circles?” She asks.
“Yes! We’ve thought long and hard about releasing such private information but we decided it’s time we tell everyone. We can’t hide this forever,” You say as Tom watches you and nods. “Well there we have it! Tom Blyth and Y/n Y/l/n have a child together!” The interview says to the camera as you wave her goodbye and move along with the other cast members.
“That felt good,” You look up at Tom, happy to get it out. “It sure did, darling” He rubs your arm as the two of you take pictures for the paparazzi. Safe to say, that interview was blowing up.
Fans had mixed reactions to the news. Some were incredibly happy for the two of you, and some were utterly shocked at the news and were surprised at how the two of you kept this information on the low.
As you and Tom were doing the world promo tour with the rest of the cast members, there was always a question that popped up relating to your daughter, Elsie.
“Tom, Y/n! I think the internet is in shock to learn that you are parents to a three year old daughter, am I correct?” The man infront of you says as you both nod. “Yes! Our daughter’s name is Elsie, and we had a feeling this would shock fans quite a bit,” You quietly chuckle to yourself.
“It definitely has! How did you two pull this off? You know, not making fans suspect anything?” He asks as Tom replies, “Uh I think it was just mainly being super private about our personal lives. We both don’t share such information like that which lets us live peacefully without cameras following us around.”
“And you’ve done a wonderful job at that since we never knew about your three year old daughter,” He smiles as Tom thanks him, “Can you tell us more about Elsie? If you can?” He politely asks as you nod. “Of course. Well uh Elsie is very much a daddy’s girl,” You all chuckle as Tom holds your knee affectionately.
“She loves the outdoor so much, that’s where she wants to be most of the time.” Tom adds. “And how was it that you found out that you were going to be a dad, Tom?“
“Yes, so Y/n told me she was pregnant on my birthday in February I think it was?” He looks at you in confirmation as you nod, “It was actually during my auditioning progress for Billy the Kid. So when I got the role and started filming mid to late 2021, Elsie was already born”
“We were both 25 at the time and we felt like we were ready to you know, move onto the next chapter of our lives. I remember for my birthday, Y/n’s present to me was this baby onesie that said ‘daddy’s girl’” The man awes as Tom reminisces the moment.
“I was so shocked and happy that I started crying,” He laughs, “Correction, we started to cry,” You butt in with a small giggle. “I do have to mention, Y/n! You went through your pregnancy without the public even noticing! How in the world did you manage that as a public figure.
“It wasn’t hard, but at the same time it sort of was,” You let out a low chuckle as Tom rubs your thigh, listening to you talk. “I didn’t have any roles booked for that year so I just stayed on the low. I did what any other typical people did when they didn’t want others to notice your pregnancy which was to wear baggy clothes, covering my stomach and stuff like that.”
“I also made sure that people wouldn’t be able to recognise me when I was out in public and it worked very well.” “It did indeed. I think everyone wants to know, how’s life with a three year old daughter while filming. Was Elsie with the two of you went you filmed tbosas?”
“Yes she was actually! Everyone on set knew that we hadn’t said anything to the public about our daughter and they were such wonderful people and respected that. My mom also was with us to take care of Elsie when we weren’t able to.” “I don’t know how we would have lasted all those months without her honestly. She made everyone on set laugh, I actually think the cast members will start posting pictures of bts with Elsie now that we’ve released this information” Tom laughs as his mind goes back to all the time the crew would laugh at Elsie’s cuteness.
~
“You posted a picture on your instagram a couple days ago of you and your daughter, can you tell us a little bit of background information of this picture?” “Is this the one of you and Elsie in the forest?” You turn your head to Tom as he nods. “Yes! So that was the last day we filmed all the scenes in the forest. We’ve already said this I think but our daughter absolutely loves nature.”
“During takes she would just play around and I remember this one time, We were going through a scene and then Elsie just came up to me and clung around my leg while the cameras were rolling, do you remember that?” Tom grins at you as you recall the moment.
“I do, I have a video of it in my camera roll, it made everyone awe at her.” You let out a giggle as the interviewer smiles at the two of you. “It seems to me that the crew was pretty close to Elsie? Am I right in saying that?” You nod in agreement with her.
“We felt incredibly grateful of how everyone was so kind and supportive of the idea of Elsie being with us during the entirety of the filming process. The cast members would always be playing with her during our takes, and Elsie grew very fond of all of them.”
“Especially Viola actually!” Tom interjects as the interviewer gasps, “Really?” “Yes! Viola is such a sweetheart I honestly love her so much. Even when she was in her costume and she kinda looked terrifying, Elsie would always run up to her after the cameras stop rolling.” He chuckles.
The two of you honestly loved talking about Elsie during all your interviews. Your face would always hurt from smiling too much when you reminisce all the moments of your daughter during filming.
2K notes
·
View notes
BROKEN DECISIONS| T.WOLFF
Pairing; Divorced!Toto Wolff x fem!engineer!Schumacher!reader
Summary; The news of Toto Wolff divorcing from Susie has just hit the media and you, Michael Schumacher’s eldest daughter and George Russel’s race engineer, are beyond shocked, even more so as your relationship with your boss begins to evolve.
Warnings; angst, light smut, heartbreak, pregnancy trope.
F1 Master List , Part 2
The paddock was overwhelmed with media reporters and cameras, way more than usual for a race weekend, the Mercedes garage was surrounded by people as well as the entrance to the track, all waiting for one man, Toto Wolff.
You had been more than taken back by the joint statements released this morning which both effectively said the same thing.
mercedesamgf1: Team Principle Toto Wolff announces divorce from wife Susie Wolff, both will continue to co-parent son Jack Wolff and will continue to work together happily, they wish nothing but the best for each other in the future and wish for the privacy and support they need during this time.
SusieStoddart: Toto and I have mutually decided to part ways and divorce after 12 years of marriage, both of us will continue to co-parent our son, Jack and will continue working together in the future. I wish nothing but the best to him for the future, please respect our privacy during this time and I hope you guys will continue to support us both from this point on, even on our separate paths. Thank you.
It all seemed so sudden to you, nothing has seemed out of place whenever they were in the garage together but you suppose that’s how the saying you never know what’s going on behind closed doors goes.
You squeezed your way through the crowd, ignoring all of the questions fired your way and the cameras and microphones that were shoved in your face, it wasn’t your job to be making comments about a relationship that had nothing to do with you and it was entirely unprofessional.
Huffing out a breath as you finally crossed the threshold of the garage, you straightened out your clothes and bag before making your way over to your desk that you sat at whenever George was out on the track.
Bono was already in his chair and looked up when he heard you pull your hair out, taking note of your flustered state. "I take it you’ve seen the news."
"It’s everywhere! It’d be a miracle if I hadn’t seen it," you huffed. Looking around, you noticed how flustered everyone else seemed to be whilst trying to do their jobs, you didn’t blame them because right now no one knew what mood the boss was going to be in when he arrived, if he arrived.
"Is he even coming today? I certainly wouldn’t." You asked.
Bono shrugged, "you know what he’s like, that man would be here even if his leg was falling off, he’ll be here and god help him when he is."
"Yeah, true. Am I blind though or did anyone else not see this coming because they were both at the factory two weeks ago and everything seemed fine to me."
Bono turned away from his monitor and completely turned to you, huddling closer. "I didn’t suspect anything either but they’re really good as keeping work life and private life separated. Have you seen some of the rumours though?"
You snorted and nodded your head, "I’ve seen the ones about Toto having an affair which is ridiculous, that man does not have the time to be hiding an entire relationship."
Bono laughed at your choice of words but abruptly stopped as he stared behind you causing you to look at him in confusion before turning around, pausing at the sight of your boss walking in with a face of stone.
"Ahh shit," you muttered, hearing a small hum of agreement coming from Bono.
Then you saw him heading into your direction.
"Double shit," You heard Bono mumble causing you to bite your lip, trying to prevent yourself from smiling.
"Y/N. Bono. Good Morning," Toto nodded his head in greeting.
You smiled up at him, "Morning, boss, feeling positive about today?"
Bono sighed from behind you which caused you to internally wince at your own words, now realising that might not have been a good question to ask.
"Yeah," Toto looked between the pair of you suspiciously. "Are you?"
"Very," you tried to sound convincing, "I’m sure George is going to drive like it’s his last race and if not then I’ll boot him up the arse."
Toto looked at you amused, "I believe you."
After he walked away you turned to Bono with a pained look on your face meanwhile he was trying not to fall into laughter. "What the fuck is wrong with me?"
He laughed straight in your face as you sighed at yourself. "How an I supposed to talk to him normally when all I want to say to his face is ‘hey, heard about your divorce, that sucks and now everyone thinks you can’t keep a wife’."
"Yeah don’t say that," Bono grimaced at your words.
Everything was real now, it had been real for a while but now the news was out for everyone to gossip about.
Things hadn’t been right for a long time between him and Susie and whilst there hadn’t been any constant arguing or disloyalty between the two of them, there hadn’t been much else either.
You’d have thought working within the same industry would have built an understanding between them about their schedules and commitments and it had in the beginning but as formula one became more popular, their lives had only gotten busier to the point they hardly saw each other and even when they did it was only to ensure Jack was getting enough quality time with both of his parents, it was as though they had been coparenting with each other whilst they weren’t even split.
A year ago they had accepted the inevitable fate of their marriage and had been figuring out the logistics of their divorce but just like they had kept their struggles silenced, they had kept the news of their parting silent too.
But it had been over a year now and quite frankly the fake shows they were putting on were getting exhausting, they were both moving on and pretending to still be a happily married couple wasn’t doing well in helping them in the process.
Toto had found a particular thing that hadn’t allowed him to dwell in the sadness of his private life. Something, or someone, that didn’t even know how much they were helping him.
You.
Everyday you showed up to work with a smile on your face, eternally grateful for everything life had offered you. You had achieved your dreams of working within formula one, it might not have been on the track driving at record breaking speeds like your father but you had one of the most important roles in the team and you enjoyed it.
Even today as he walked through the doors trying to ignore all of the sad, pathetic looks people were giving him and the onslaught of invasive questions people were attacking him with and even if they weren’t verbally shooting words his way, he could see the unasked questions in everyone’s eyes, you greeted him like you did every other day and whilst he knew you were aware of the news, nothing in your face showed the slightest bit of curiosity towards the end of his marriage and he couldn’t express how refreshing that was and how much he needed it.
Slowly, he found himself looking forward to the days ahead where he could bump into you and witness the smile on your face as he tried to ignore the way your energy made his heart feel funny and when Mick signed as the team’s reserve driver he would use the fact that he was ‘mentoring’ your little brother as an excuse to see you, knowing that naturally he would be around you more.
You jumped up from your seat in excitement as you saw both Mercedes cars pass the checkered flag securing second and third place behind Max, obviously.
"George you fucking beautiful human bring!" You shouted through the radio before turning to look for Toto, hoping that these results would have put a smile on his face only to find that he was already looking at you intensely, not even acknowledging the pats he was getting on his back by team members.
He winked at you? And sent you what seemed to be a grateful smile before turning away to celebrate with those around him. You were thankful he did so and didn’t see the pink hue you could feel spreading through your cheeks.
A sudden weight on your back didn’t allow you to dwell on it. Mick had launched himself at you in his exhilaration causing you to quickly latch onto his legs so you both didn’t go tumbling, you laughed and spun the pair of you around before putting him down so you could all go outside and gather in the pits to watch the podium.
You always went out of your way to be a kind person but the moment your team was standing under the podium all manners went out of the way and you barged your way to the front of the barriers to watch, mumbling half-hearted apologies, you knew no one would take your behaviour the wrong way as you’ve known them for so long.
Looking up, you were happy to see the smiles on Lewis and George’s faces, tough seasons can really take a told on the mental health of the drivers and it can be easy to lose motivation, especially when you were part of a team that was so used to winning but they looked as happy as ever now and it made all of the hard work that everyone had put in worth it.
Two hands clamped down on your shoulders startling you, followed by the feeling of a firm chest being pressed up against your back. You looked up and saw Toto but he wasn’t looking at you, he kept his gaze up on the podium and the happiness on his face hadn’t subsided so you didn’t question it and turned back to the celebrations.
His behaviour was really confusing you and you wanted to talk to him about it but decided to push it away for another day.
His behaviour hasn’t been limited to that day alone.
The entire season has been filled with soft touches from him, from a small brush of his hand against your back as he walked past or light touches of your hips to guide you to the side when you were in his walk way.
Let’s not forget about the way he started to look at you. Toto’s stare was always intense but now you couldn’t ignore the soft shine his eyes held as he looked at you.
You hoped you weren’t reading too much into things otherwise that would be embarrassing but you couldn’t stop noticing the little things he would do and what was even worse was the way these things were effecting you.
These touches would leave your skin feeling tingly and your head fuzzy to the point your mind just turned blank and now whenever he was so much as in the same room as you, your mind became hyper-fixated on his presence to the point it felt like you were compelled to constantly glance in his direction.
You had worked for him for nearly eight years and not once had you even considered looking at him in any other way other than as your boss and a friend.
You acknowledged that he was handsome and had the charisma to match but you had never been attracted to him up until now, how was this year any different to the last seven?
Hands slamming down into your desk startled you from your thoughts, you looked up wide eyed at the grinning face of your younger brother causing you to grumble in annoyance and throw the pen that was sitting on your desk at him.
"What’s wrong with your face?" Mick easily dodged your attack and asked.
"What do you mean?" You asked.
"My big sister always has a smile on her face and for the last twenty minutes you’ve been sat there staring at nothing with a frown on your face."
"Nothing," you muttered, turning back to your laptop screen that had long since shut off.
"Right," Mick replied sarcastically, "Come on, tell me what’s wrong."
You pursed your lips as you debated telling him or not. "You promise not to tell anyone?"
Mick’s face lost its teasing look as he realised you were actually troubled. "Of course." He replied sincerely.
You hesitated for a moment longer before asking "have you noticed that Toto has been acting strange lately?"
Mick looked at you surprised for a moment before smirking and nodded, "you mean the fact that the entire season he’s been staring at you like you’re the finest piece of meat he’s ever seen?" He asked teasingly.
"I wouldn’t have worded it that way but yeah," you responded.
"Then yes, I’m surprised it took you this long to acknowledge it."
You shook your head, "I noticed it at the beginning of the season but I thought I was imagining it and now I can’t stop noticing the fact that he-"
"Fancies the hell out of you?" Mick finished, a shit eating grin on his face.
You groaned and placed your head against your desk. "This is wrong, he’s my boss!"
"Tell me about it, he’s mine too and he fancies my sister!"
"Stop saying he fancies me!" You told him resulting in him just laughing at you. "Seriously Mick, what am I supposed to do?"
Mick sighed and looked at you seriously, "Do you like him?"
"I dont know," you replied honestly, "before this season I wouldn’t have even looked at him as anything but my boss and a friend but now he keeps looking at me and taking any opportunity to touch me and it’s confusing me."
Mick pulled an uncomfortable face at your words but gave you some advice. "Then do nothing until you know for sure."
You nodded and he smiled before walking around your desk and wrapping you in a tight hug which was more like a headlock but it was a hug nonetheless.
"Smile! We’re in Abu Dhabi and we’re partying tonight," he fake cheered as he walked away causing you to laugh at his behaviour.
And that’s exactly what you did. It had been a tough season for Mercedes, the team hadn’t nearly performed as well as they were used to but through a lot of hard work the season had ended on a high note and and no one was going to dwell on this years difficulties tonight.
You were definitely allowing yourself some freedom tonight to drink away and forget about the confusing thoughts that had been swimming around in your head all season.
The club was dark except for the colourful flashing lights that were roaming the entirety of the room that the FIA had rented out for all of the f1 teams celebrating tonight. You were already feeling more relaxed from the three drinks you hadn’t wasted time on consuming and had dragged poor Bono, who had zero rhythm, to the dance floor.
The man looked traumatised as he simply stood there awkwardly with you holding onto his hands, swaying his arms to try and encourage him to dance and have a bit of fun.
You kept him there for an hour before eventually taking pity on him and letting him go, you walked over to the bar to get another drink, not seeing the person approaching you until he was right beside you.
"You look lovely."
You turned to your right in surprise, Toto was mimicking your stance, leaning his side against the bar as he looked into yours eyes. "Thank you," you replied, a little shocked at his words.
"I see you were having fun with Bono," he commented absentmindedly.
You laughed, "Me? Yes. I don’t think he was having as much fun as I was."
"He’s not much of a dancer," Toto smirked.
"Oh, I know. He can’t move to save his life but it doesn’t mean he shouldn’t try."
The bartender placed your drink in front of you and you took a sip after giving him a thanks. "Have you been having fun?" You asked.
Toto tapped his fingers against the bar top and signed. "As much as I can after the shit season we’ve had."
"We’ll be better next year," you replied confidently.
He simply nodded in response, dragging his gaze down your body and back up again.
The feeling of his eyes trailing you left a burning heat on your skin and an unfamiliar fluttering in your stomach.
"I like this dress," he told you, nodding at the tight fabric that clung to your figure.
"I got it yesterday," you knew he didn’t care but for some reason you felt inclined to share that information with him, fighting the urge to look away and hide a smile.
"You picked wisely," he immediately responded and this time you didn’t fight the smile, his smooth responses settling within you exactly how he wanted.
"I’m glad you like it," your voice was quiet in the midst of the loud music and voices but it didn’t prevent him from hearing you words.
The way he smirked down at you made you feel much smaller than you were, the idea of how his stature and strength would help with the power he held over you made you burn with need and the want to find out for yourself.
You huffed out a breath.
You needed another drink.
You threw your head back into the pillows and gasped as Toto thrusted into you, pulsating pleasure rushing through your body with every movement.
You didn’t know how you got to this point, the night was a haze of drinking, close dancing and longing looks but the one memory that stood out was the warmth of Toto’s hands against your hips, after that everything blurred up until this moment.
Your arm wrapped around the back of his neck, your hand burying itself into his hair as you tried to ground yourself but you were hopeless within the haze of his kisses against your throat and hands holding your thighs spread for him.
"Toto!"
His breath was heavy against your skin. "You feel so good, schatz." The guttural groan he released sent you feral, you tightened your grip on him and pulled him closer so your chests pressed against each other.
Your vision went white as Toto just grazed that sweet spot inside you with one particularly hard thrust before he angled his hips in a way that with each bruising snap of his hips he made, the tip of his cock would brush against you just right.
As you felt yourself approaching your release, your back arched and the air remained trapped in your lungs, your grip tightened on Toto’s hair causing him to groan into your neck while your other hand shot up behind you and grabbed onto the headboard.
Just as you were at the precipice of your release, Toto reached down and circled your clit with his fingers providing the last bit of stimulation needed for you to let go and dive into a river of overwhelming pleasure.
The sight of your face completely blissed out made Toto’s cock harden more inside of you, he continued to thrust and work you through your orgasm whilst chasing his own, chasing his release as he felt his body fill with an indescribable need to continue rutting into you.
The groan of relief he let out followed by a warmth in your core brought you back to reality, Toto allowed his body to collapse onto your own and simply lay there as he caught his breath and recovered from his own orgasm.
Your hand continued to run through his hair, grounding his mind to reality and encouraging him back from his high.
Moments later, Toto removed himself from you and curled up behind you, wrapped an arm across your stomach and pulled you into his chest.
Both still feeling the haze of the alcohol in your systems, no words needed to be spoken between the pair of you as you both succumbed to much needed sleep.
You woke up feeling as though your brain was swelling beyond the capacity of your skull and dehydrated to the point you felt like you could drink about forty litres of water.
Every part of your body ached as you moved beneath the covers, flashes of last night flickered through your mind causing you to groan at the reminder of your drink choices.
You were definitely regretting it now.
A particular memory caused you to pause and look beneath the sheets, grimacing as you realised you were naked.
Then you froze, Toto.
Your head shot to the side and instead of laying your eyes upon your boss’ 6ft5 frame you were greeted by an empty half of the bed with only crumpled white sheets.
Your heart dropped as you looked around the room, there was no indication that anyone else had been here but the ache between your legs made it very clear that last night did in fact happen.
He had left.
After an entire season of fighting with your feelings and the way he made you feel, you had given in to him only for him to leave.
You felt sick and dirty and disgusting and used.
You pulled yourself into the shower and tried to to push down the need to cry but you were filled with an overwhelming sense of betrayal and couldn’t stop the rogue fear that fell down your cheek.
Waiting to board the plane back to England, you looked down at your phone, you had a feeling Toto was already there by now and you had messaged him ages ago but no response.
Had you been crazy believing that he could have feelings for you?
You were so mad at yourself for being as affected as you were by his actions, it felt like someone had your heart in their fist and found amusement in squeezing it, filling you with the need to just let go and allow your emotions to flow freely.
You didn’t need to be back at the factory until after Christmas so you went straight home and unpacked your bag before repacking to go and spend your time off in Switzerland with your family, Toto still hadn’t responded and you were positive he was just ignoring you now and you didn’t try to get a response.
You’d deal with that after Christmas.
Normally you’d wait a week or two after the season ended to go back home but you really had no reason to stay, you’d changed your mind on attending the FIA awards which had confused Mick when you told him but he could tell something was wrong and chose not to pry.
You seriously didn’t think the year could get worse, you were so wrong.
The last three weeks in Switzerland had been hell to put it lightly, Christmas was just around the corner but it was hard to be excited when you had caught the sickness bug, the amount of time you spent in bed throwing up was disgusting at this point and the coddling of your family wasn’t helping.
You knew they loved you but you wish they’d just leave you alone to wallow in misery.
Toto was still a lingering thought in the back of your mind and it was only adding to how rubbish you felt but you hadn’t made any other attempt to get in touch, he hadn’t tried either so you knew where you stood with him and that was enough.
New years had passed and you were now back in England to go back to work, you had never dreaded going to work in all the years you’d worked for Mercedes so the unsettling feeling in your stomach was new.
But that could also just be nausea.
You still hadn’t completely recovered from your sickness over the holidays, you were no longer bed bound but the urge to throw up and the loss of appetite was still there, the loss of weight was visible in the sickly paleness of your face so you had booked a doctors appointment for the upcoming Friday.
Your stomach churned as you walked through the doors of the Mercedes headquarters, as the daughter of Michael Schumacher you got a lot more attention in the building as you would’ve if you were just a race engineer so the nods from almost everyone as you walked in weren’t strange to you but the sympathetic looks were.
You hoped it was just because you looked as if you hadn’t seen sun for the past ten years.
Deciding to stop by hospitality on the way to your office for a bottle of water, you paused in the doorway at the sight of Toto and didn’t hesitate to turn right back around before your mind even processed his presence.
You got a few funny looks by the people in there but you truly didn’t care.
It stayed like that for the rest of the week, whenever you found yourself in the same room as your boss there was no time wasted before you left even if there were still things needed to be done in that room, you didn’t even try to be subtle about it either.
As soon as he entered the room you immediately took your leave, it was rude but you couldn’t find it within yourself to care and you doubted he cared either.
You had taken the day off work today to attend your doctor’s appointment so thankfully you didn’t need to waste your efforts avoiding him.
"Symptoms are nausea, sickness and weight loss," The doctor listed and you nodded in clarification.
She looked at you knowingly, "When did your last cycle finish?" She asked.
You pulled a face and leaned your head back in thought, it was probably before Vegas, but that was….. your face grew even paler than it already was.
"November," you whispered, your body filling with complete and utter horror.
The doctor’s face grew sympathetic at your reaction, "and you’ve had unprotected sexual intercourse since then?" She asked though your face gave her the answer.
You were at a loss for words so you resulted in nodding; the idea of you being pregnant only made you feel more sick.
"Okay," she replied softly, "We’ll have you take a test to confirm."
You didn’t even register the next ten minutes, lost in your own mind as an emptiness settled within you, your chest ached with pain at the idea that your whole life could be changed in just a few short minutes.
"Miss Schumacher, are you okay?" The doctor asked worriedly.
You snapped back to reality and nodded numbly.
"The test came back positive, Y/N, so I’ll refer you to a midwife and during this time you should think about what you want to do, okay?"
How you didn’t crash on the way home was a miracle because you definitely weren’t concentrating, you carried your body straight to the bathroom and looked in the mirror, you looked like hell.
Just the sight caused your eyes to well up and this time you didn’t fight the emotions, you welcomed the tears and allowed the pain to consume you, the pain of realising just how alone you were in this moment.
You slid down against the bathroom door and curled yourself into a ball, buried your face into your knees and sobbed until you no longer could.
The weight in your chest was still present as you walked into work the following Monday but you no longer had any tears to spare, you had made up your mind about what your future would consist of and today would mark the beginning of it.
Knocking on the door to Toto’s office, you waited for confirmation to enter and he clearly hadn’t anticipated you on the other side from the look of surprise on his face but you didn’t mention it and closed the door behind you.
"We need to talk," you wasted no time in pleasantries and sat down in the seat opposite him.
"Is there a problem with the car?" He asked, his formal tone cut through you like a knife but you refused to show the effect it had.
You wouldn’t have thought the pair of you were friends just two months ago.
"There’s nothing wrong with the car," you told him.
"What do we need to talk about then?" He asked.
He was royally pissing you off with the way he was pretending to be ignorant. "We need to talk about what happened between us-"
"This is unprofessional," he interrupted and you scoffed in disbelief.
"Unprofessional?" You laughed in his face. "Do you know what else in unprofessional? Sleeping with your employee."
His face dropped at the bluntness of your words, "look, you shouldn’t be bringing private matters into the workplace."
"How else am I supposed to bring them up? Over text message where I never get a response?" You looked at him incredulously. "This is important-"
"I don’t want to hear it, Y/N," he cut you off harshly. "What happened between us shouldn’t have happened, it was a moment of weakness and it will never happen again."
You looked at him stone faced before nodding, "fine." You got up from your seat and left without another word, not bothering closing his door.
You didn’t go to your office, instead you went to HR.
Walking past the different offices you went straight for the head of HR. "Chloe?" You knocked on the door quietly, opening it once you received a response.
She smiled at you in greeting, "Y/N, can I help you with something?"
You nodded softly and sat down on the sofa she had against the wall. "How many holidays do I have?"
She looked at you suspiciously, "All of them, you didn’t put one in for Friday so that went unpaid."
"Okay," you muttered under your breath, "I want to cash them all in, starting from tomorrow."
"What?" She looked at you shocked. "Are you sure? If there’s something going on we can figure out a better solution for you."
You smiled and shook your head, "Uhm no I’m sure, I want to use them all and then after that I’ll be taking early maternity leave."
Chloe’s eyes widened in shock. "Wow, okay, congratulations."
"Thanks, I want to spend my pregnancy in Switzerland so you won’t see me around."
You could see that she had questions but didn’t ask them and you appreciated it, "I understand, I’m happy for you Y/N, I’ll get it all sorted for you."
"Great," you stood up and headed towards the door.
"Y/N?" You turned around, Chloe looked at you sincerely, "Give me a call if you need someone to talk to, yeah?"
You probably wouldn’t but you nodded and left.
To say Toto was surprised when he found out they were down their usual race engineer for the season was an understatement.
It was completely unexpected and he wasn’t the only one who wasn’t happy about it, George was not at all in agreement to having a new voice in his ear.
It wasn’t even for a couple races either, it was for the entire season.
No one in the team had any information on what had happened except two people, Mick and Chloe.
No one could ask Mick because he had left to do the world endurance championship and when Toto had went to ask Chloe all he got was a shrug and words that sounded as though they’d been read from the companies handbook.
"It’s against an employee’s confidentiality rights to discuss the matters with you, even if you are the boss, all I can tell you is she’ll be back at work next year."
Meanwhile, in Switzerland you were slowly but surely feeling much better.
You were putting the situation between you and Toto behind you, you were recovering and as you did, your bump grew and the sight made you smile.
The horror and fear you felt when you found out about your pregnancy had dissipated weeks ago, leaving you filled with excitement and love for the journey you had ahead of you.
With your mother and sister around you, the loneliness you felt had evaporated as well.
You were doing good and felt amazing and that’s all that mattered right now.
2K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Let him cook
Charles Leclerc x Masterchef contestant!reader
Series Part: 1, 2, 3, 4, 5, 6
A/N: Got this idea because the masterchef trophy is similar to the Australian GP trophy. This is going to be a series
Charles_Leclerc posted a new photo
liked by CarlosSainz55, PierreGasly, and 365,000 others.
Charles_Leclerc Add professional chef to the list
User1 aint no way you cooked this
User2 nice try Charles but we all saw that pasta video
CarlosSainz55 mate drop the # of the private chef you hired, these look delicious
Charles_Leclerc I told you that I made this myself
CarlosSainz55 Lies!!!!
PierreGasly since when did you learn how to make coq au vin???
Charles_Leclerc not you too
PierreGasly you should invite me sometimes so I can judge your cooking
Y/NCooks posted a photo
YNCooks last date night before i enter masterchef australia. credits to the boyfriend for the lovely photos
Friend1 Y/N i know this is your dream for a while now. I hope you win. We will cheer for you our next masterchef australia!
YNCooks awww stop! ur making me cry
User1 OMG she is finally competing, goodluck Y/N!
User2 Y/N always talk about how its her dream to enter masterchef, I'm gonna watch it everyday and hope she wins it!
User3 Goodluck Y/N! I hope you become the next masterchef australia!!!
Mystery Box challenge episode
There was a building reputation in the kitchen that you are one of the strong homecooks of the season. After winning the past 2 mystery challenges, you were extremely determined to do well and seek for a third streak. The mystery box today was all about italian cooking, a cuisine that you have been comfortable due to the close ties of your boyfriend being signed to an Italian team.
"And what do we have here with you today Miss Y/N" Matt Preston asked as he approached the work table together with George Colambris "You seem rather comfortable and in your own zone. Its like an ordinary Tuesday date night"
You gave a small chuckle with that mention "That's actually pretty on point of you to say as Tuesday is my date night with the boyfriend"
"Ah so maybe that's why you are so inspired because you are in love"George teased.
"Well I have to admit that there is a little pressure to do well in this challenge or my boyfriend's family will get mad at me"you quipped back a reply.
The judges suddenly leaned a little interested to learn more about your personal life, "So your boyfriend is italian?"
"He is not but he might as well be. He spends a lot of time there"
"It must be hard to not see him a lot since you are here competing" Matt says
"It's a price we are willing to pay. He has been supportive of my dream as I am with him" you gave an encouraging smile as you continue to chop the sweet potatoes.
"We hope to meet that boyfriend of yours because he is one lucky man because that dish looks delicious!" George says before they left the station.
Somewhere in Bahrain, Charles Leclerc is grinning upon watching the replay of the episode. He was beyond proud of what you have achieved as a contestant in MasterChef. He wished that he could do more to express his support towards you but you have an agreement with him to keep things lowkey for the meantime. It was a reasonable decision as he didn't want to overshadow your career but it was nice to know that you two are a private thing but never a secret.
He was so engrossed to repeating the boyfriend clip that he didn't notice that Carlos snuck up beside him.
"What are you watching there?" Carlos asked his teammate
"Oh its nothing" Charles says as he immediately exited the Youtube app "I didn't notice you there, you scared me"
"If you weren't too into your phone then you would have noticed me calling you" Carlos explained "What are you watching on your phone that got you smiling like that?"
"Nothing, I just saw an ad"
"Hmm sure an ad" Carlos was pretty sure that Charles was watching MasterChef but he couldn't care anymore to ask which country because there was too many so he decided to just let it go "Cmon Fred is asking for us, were late for a meeting"
"Carlos! Why didn't you start with that?"
Cake challenge
You were exhausted because you spent the early hours of the morning watching the Jeddah GP. It was a thrilling race to see Charles bag his first podium of the season so you can say that its worth it. Besides, you were able to talk to him after the race so it sweetens the deal even more.
Filming begun for MasterChef and the judges brought out balloons for the mystery box challenge.
"Your challenge today is to make the most imaginative and creative birthday cake that you ever had" Gary explained "The pantry is filled with all the cake flavors you can ever imagine so be creative and show us what you've got"
Baking has never been your strongest suit. It was all about precision and measurements as small increments can make a huge difference. Today, you were determined to do well and you wanted to use the podium finish of Charles for the cake.
It was a struggle to bake the cake, cool it, and pipe it in under 60 minutes. You felt the pressure getting under your nerves as your hands started shaking when you were piping the cake details with 10 minutes left. There was a sigh of relief when you finished just 5 seconds away from the judges calling the time.
There were plenty of beautiful cakes in the room so it was a shocker for you that the judges called you in front to present your cake.
"Judges what I have for you today is a three layer cake with the raspberry,almond, and pistachio with chocolate to seperate the layers and a lemon buttercream frosting."
"You told us you can't bake, that seems like a lie" George says as he cuts through the cake "Look at that layers"
"The layers are actually inspired by the italian flag, its an homage to the boyfriend. Its actually a cake that I made thinking about him" you explained.
"That is simply gorgeous. The cake is very moist and the balance with the flavors is that its not too sweet or nothing overpowering. Your boyfriend is a lucky lucky lucky man to be baked a cake like this" George complimented.
"Does your boyfriend cook?"Matt asked as he took a bite
"Oh God no. I have to cook or else the kitchen will be on fire"you laughed "But I can't drive so maybe that's his payback"
"You seem to show the beautiful dynamics of your relationship when you cook something inspired by him. I wish you two the best" Matt's genuine comment was a heartwarming moment.
Its unfortunate that you didn't win this challenge but you were able to showcase your support for your boyfriend.
Melbourne GP meets MasterChef
This was another challenge as you were elected as a team captain for the second team challenge. You were extremely nervous when you were transported with your team mates from the blue kitchen to an unknown location. It was even more nerve-wracking after you've realized where you are.
"Welcome to the Albert Park where the Australian Grand Prix is underway for this weekend" Matt introduced "Your challenge is to prepare two dishes: a pasta and a fish dish to be served to the talented drivers in Formula 2"
There was a little sigh of relief as you were dealing with the Formula 2 drivers. It was a lot of weight on the shoulder if you will be serving food to your boyfriend.
"The practice sessions will be starting in a few minutes. You have 90 minutes to prepare your dish and an hour to serve them"
All you know was that you started organizing the team to put them in charge of the dishes that you will be making today. You cross your fingers that the color red brings luck to your team today.
Meanwhile, the paddock was buzzing with cameras and Charles immediately noticed that there were some new film crews around the Formula 2 drivers. His eyes did a double take after he recognized the face of three familiar judges he often sees on MasterChef Australia.
"What's going on? Isn't that MasterChef Australia judges?" Charles quizzed
"That's MasterChef Australia, they have this team challenges and they will be feeding the Formula 2 drivers" Silvia answered as she was informed earlier that morning about the extra exposure in the paddock today.
"Why Formula 2? Why not us?" Charles whined
"If you want then you could go ask Ollie for food" Silvia suggested
That sets a lightbulb moment for Charles as he excused himself to talk to the young driver. He will not miss the opportunity to taste the cooking of his secret girlfriend and support her in doing her craft.
It puzzled Ollie Bearman to see that Charles has been looking for him once the practice session was over. He was even more confused by his request.
"So you want me to get you food?" Ollie asked "Doesn't Ferrari have a catering?"
"Its not just food, its the MasterChef Australia food" Charles explained without giving out too much information "I just love the show okay?"
"You can come along, I'm sure they don't mind" Even better.
So here is why you were genuinely surprised to see that Charles Leclerc is walking inside the MasterChef tent with a red and blue plate in his hand. He was grinning wildly as if he was a kid on a sugar rush.
"Ohmygod we are serving food to Charles Leclerc!" one of your teammates whispered.
"Hi goodafternoon! What's the dish for today?" he asked politely.
"Well we have a pan fried cod with a pea puree and then some green grapes some fennel over there and then for the pasta lemon ricotta and beet tortellini" you answered as the team captain "We hope that its up your liking"
Charles gave you that smile that seems to light up the whole room, "I look forward to it, thanks!"
Its moments like this that you wish that you could reach out for him but you understand that its not yet the time. Its nice to see the support that you have for each other even though its all in private and away from the eyes of the media.
"Goodluck on your race Charles!"
There was a smile on both of your faces as you both continued to go chase your dreams.
883 notes
·
View notes
can you do a social media au where a woman gets a new job as a sky f1 reporter and everytime she interviews toto on air he flirts with her
Toto Wolff x reporter!Reader - Social Media AU
f1wagupdates
Liked by wolffupdates, beyondthegrid, and 137,964 others
f1wagupdates can they please kiss already?
View all 528 comments
wolffupdates y/n is stronger than me because my panties would immediately be on the floor
f1wagupdates i can feel the tension between them through the screen
beyondthegrid they got me blushing, giggling, kicking my feet, and twirling my hair
f1wagupdates it’s like watching a slow burn romcom play out in front of our eyes
formulanone you do know that y/n is not actually a wag, right?
f1wagupdates she’s a wag in my heart
wolffupdates
Liked by f1wagupdates, leclercupdates, and 209,185 others
wolffupdates just fell to my knees
View all 1,263 comments
f1wagupdates you���re telling me they’ve been together this entire time 😭
wolffupdates i’m both surprised yet somehow not surprised
leclercupdates this is the most charles leclerc thing to ever happen 💀
lordperceval charles leclerc’d a bit too close to the sun
leclercupdates the monaco curse is extra potent this season
bananaleclerc at least maybe this means he got it out of the way before the race?
yourusername
Liked by skysportsf1, mercedesamgf1, and 625,387 others
yourusername remember when most of the paddock was “coincidentally” vacationing in tuscany at the same time last december? that��s because we got married … surprise!
View all 3,249 comments
mickschumacher lewis owes me 50 euros
lewishamilton i really thought that george would spill it first
georgerussell63 i am deeply offended
f1wagupdates why did you decide to keep it secret?
yourusername we weren’t planning to keep it hidden forever but so much of our lives are shared with the public that it was nice to have this special part that was private just for us and our loved ones
sebastianvettel why am i not surprised it was charles?
charles_leclerc hey what is that supposed to mean?
sebastianvettel that you gossip more than a nosy grandma over tea
mercedesamgf1 the bossman told us to tell you that you should finally change your username to include your new last name
yourusername i’m telling you to tell the bossman that he should actually make his own account first and then we can talk about my username
totowolff you drive a hard bargain, schatz
y/nwolff happy now?
totowolff very happy. but then again, i’m always happy with you
3K notes
·
View notes
head in the clouds | lando norris social media au
pairing: lando norris x fem flight attendant!reader
there's no one more attractive than the stranger at the same gate as you at the airport and sometimes that stranger works on your best friend's private jet.
yourusername
liked by maxverstappen1, danielricciardo and 3,105 others
yourusername: violently hungover, don't tell my boss x
view all comments
user1: i need to be her
maxverstappen1: your boss follows you on instagram genius
yourusername: oh yeah lol but i'm still alive and i was still on time
maxverstappen1: you took a nap on the flight?
yourusername: it was about ten billion hours long so spare me the lecture
maxverstappen1: you're so lucky we're friends otherwise i'd fire your ass
yourusername: you love me too much to do that maxy (and i know way too much about you) x
user2: how did you get this job?
yourusername: nepotism babes x
danielricciardo: i think you masked it pretty well for the first three hours
yourusername: THANK YOU
danielricciardo: but i did hear you throw up around hour four
yourusername: nothing like a tactical chunder on your childhood friend's private jet
landonorris: i for one couldn't tell you were hungover
yourusername: well look who's my new favourite, you should fly with max more often
danielricciardo: he's only saying that cause he has a crush, I'M STILL YOUR FAVOURITE
yourusername: whatever helps you sleep at night x
landonorris
liked by danielricciardo, yourusername and 1,034,566 others
tagged: danielricciardo
landonorris: reunited and it feels so good 😊
view all comments
user3: always obsessed with this pairing
user4: they're cute but i know they're so annoying to fly with
danielricciardo: i knew you missed me :)
landonorris: of course i did you big sap
danielricciardo: so you didn't replace me with a younger and sexier version of me?
landonorris: not technically no
oscarpiastri: i'm just gonna take the compliment, thanks dan :)
danielricciardo: massive compliment, i'm extremely sexy
user5: thank the lord daniel is back who was going to make lando blush all the time?
danielricciardo: believe me he doesn't need me to do that when he flies on air max that's all y/n
landonorris: DANIEL?
danielricciardo: she took these photos - look at the blush. LOOK AT THE MATERIAL
yourusername: i think i'm just a better photographer than you two combined so i just capture my subjects well
danielricciardo: nope. i think lando just has a BIG FAT CRUSH
maxverstappen1: LMAO
yourusername: who wouldn't? (i'm shaking)
user6: wtf is going on here?
user7: i think we're witnessing bullying
maxverstappen1
liked by landonorris, yourusername and 892,330 others
tagged: georgerussell63, alexalbon, landonorris & yourusername
maxverstappen1: getting some padel in on the weekend off
view all comments
user9: max really puts his hyperfixations above his beef because who thought we'd see him playing with george after baku
danielricciardo: how did lando get through a whole session with y/n there he can barely get through a sentence around her
landonorris: why are you so obsessed with exposing me in public
danielricciardo: funny.
yourusername: he did very well, he took a few balls to the face but he took them like a champ.
maxverstappen1: i'm sure he'd rather be the one putting balls in your face. get it? his balls? sex?
yourusername: i got it, you're not funny pal
maxverstappen1: well i think i'm hilarious so
user10: poor lando is going through the ringer rn
yourusername: whipped all of your asses call yourself professional athletes?
alexalbon: you were freakishly good what is your trick?
yourusername: only time i'm not playing padel is when i'm asleep or on a charter with max it's the only thing i can be better than him in
landonorris: you're definitely better looking than him and like 10 million times nicer than him
yourusername: you're not too bad yourself norris, you've just bagged yourself an extra bag of peanuts next flight x
alexalbon: romance is dead
f1wagsupdates
liked by user11, user12 and 4,109 others
tagged: yourusername
f1wagsupdates: this is y/n y/ln potential new girlfriend of lando norris. she is a close friend of max verstappen, to the point that after she finished university and was without a job, he financed her education to be a air hostess, the job she now has on max's private jet. as far as we know she's never been in a public relationship but she also lives in monaco, is a padel enthusiast and has exchanged flirty comments with lando. also, she's a real one because she refuses to charter if jos wants to fly on air max - she slays for that one
view all comments
user13: if she's a longtime, potential childhood friend of max, the jos thing probably makes sense
user14: gosh she's so pretty
user15: giving your bestie a job and a life where you get to have her travel with you everywhere is really what nepotism should be
user16: for real where's my friend who will pay for me to learn to be a air hostess so we can hang out all the time
user17: i think her and lando would be cute
user18: and they would also make sense, they'd have a schedule that completely lines up and y/n would understand the sport and the lifestyle
user19: she also knows all of his friends already and they seem to get on with her
user20: "never been in a public relationship" she's just like us
user21: except she's gonna pull lando freaking norris and we're all still lonely
yourusername
liked by landonorris, danielricciardo and 17,098 others
tagged: maxverstappen1
yourusername: THE way to spend your saturday, perks of the job x
view all comments
user22: hey siri play that should be me by justin bieber
maxverstappen1: glad you could take a break from being a tourist to actually come watch me
yourusername: lies i'm always there you just don't know because i sit in hospitality so i can drink ;)
maxverstappen1: is that why my mum looked so happy to see me after sitting with you in hospitality?
yourusername: NO! sophie just loves me
user23: omg y/n and sophie just chill in hospitality? i love them
landonorris: i heard mclaren have great hospitality and actually has a cup of tea with your name written all over it
yourusername: hmmm we'll see if it beats the team who broke the cost cap on catering but i'm willing to take that risk
landonorris: i promise it's worth your time
danielricciardo: @maxverstappen1 look he's finally making a move 👀
maxverstappen1: ugh finally !!!
yourusername: yall mind? ACTUALLY i'm not coming back to red bull you're annoying
user24: has the bullying worked ?
mclarenf1
liked by yourusername, oscarpiastri and 1,093,455 others
tagged: landonorris
mclarenf1: lando is back on the podium with a p2 finish with oscar just behind in p4 congrats papaya boys!!
view all comments
user25: LET'S GOOOOOO THE WIN IS COMING I CAN FEEL IT
oscarpiastri: congrats lando :)
landonorris: your podium will come oscar you're killing it right now
user26: omg faves i can't wait until the double podium
user27: y/n in the likes ..... 🤔 makes you think
yourusername: idk what you conspiracy theorists want to hear but you don't need to know everything that happens in the drivers' personal lives and i can like posts of my friends doing well
user28: so you're not together
yourusername: you people have the reading comprehension skills of a rock
maxverstappen1: congrats mate, try not to get too drunk tonight, air max is scheduled early in the morning 👍
landonorris: i'll be there no worries
danielricciardo: of course he will, his favourite will be there
landonorris: laugh all you will but i have a pack of peanuts promised to me
yourusername: i'll put salt in their drinks don't worry lando
maxverstappen1: i have done nothing wrong?
yourusername: i am in solidarity with lando
maxverstappen1: i'm ur best friend?
yourusername: he's cute :)
user29: you can't tell she doesn't like him back
danielricciardo
liked by charles_leclerc, yourusername and 1,209,778 others
tagged: yourusername, landonorris
danielricciardo: podiums give you balls. balls get you girlfriends.
view all comments
user32: HOLYYYYYYYYYY SHIT
maxverstappen1: they are not awake yet lol they're going to kill you
danielricciardo: i'd like to see lando try. y/n i am afraid of though.
maxverstappen1: you should be, a girl once threw a drink over me in the club for walking into her and y/n went feral. i was afraid and impressed
yourusername: had to protect your virtue max
maxverstappen1: much appreciated, probably the only time i've been attracted to you
landonorris: AND THE LAST TIME
user33: considering their new relationship just got exposed, they're doing pretty well
yourusername: oh we're waiting until daniel is in an enclosed space where if he tries to escape we all die :)
landonorris: he's going to regret this before such a long flight, esp with a hungover y/n
danielricciardo: is it too late to say i love you guys?
yourusername: free enchante merch and i'll drop it
danielricciardo: done.
landonorris: Y/N???
yourusername: what were we really going to do? plus i've had a crush on you for so long people would definitely know by now if i wasn't dead in bed
landonorris: you had a crush? why was i the only one getting bullied?
maxverstappen1: please refer to my comment about the feral club night
landonorris
liked by danielricciardo, yourusername and 1,237,903 others
tagged: yourusername
landonorris: on a scale of 1 - 10 how annoyed would you be if someone joined a particular club on your private jet?
view all comments
user35: THE MILE HIGHER CLUB?
maxverstappen1: you're banned from the bathroom now, get a UTI i don't care do NOT shag on my plane
landonorris: so is that a 10 definietly not?
maxverstappen1: i will make sure you will never be able to use it again if you have sex on my plane with my best friend
landonorris: understood 😅
yourusername: i don't know how you did it but you made your first post about me even less romantic than dan's and his mentioned balls TWICE
landonorris: but i love you so that's all that counts right?
yourusername: i love you too but i also clean that plane so no one will shag on it or i'll scrap them
landonorris: i get the message no mile higher 😭
yourusername: but at least you get extra peanuts and the best pillow for life
landonorris: you spoil me too much
oscarpiastri: happy for you mate, it was painful watching you mope around the garage
yourusername: awww you moped ???? that's so cute
landonorris: i moped because i really liked you and daniel made it his mission to embarrass me constantly in front of you
yourusername: babe i've cleaned dan's sick off the floor of the jet nothing he could say could make me not like you
landonorris: thank the lord cause if i didn't ask you out i think i may have combusted
yourusername
liked by landonorris, maxverstappen1 and 30,987 others
tagged: landonorris
yourusername: the 4am call times and mad max tantrums have all been worth it to meet you <3
view all comments
user36: god i have seen what you have done for others
maxverstappen1: now you're together i can say this, 1) i love you guys and i'm glad you're happy. 2) lando saw you once at a karting competition and had a crush ever since this was not new
landonorris: THAT WAS BETWEEN ME AND YOU
maxverstappen1: and he confessed that seeing you in your uniform is what finally pushed him over the edge
landonorris: STOP WHAT ARE YOU DOING
maxverstappen1: bro don't worry you guys are together, you're set for life
landonorris: thanks for having faith i guess?
maxverstappen1: BRO SHE IS SUPER DUPER IN LOVE WITH YOU
yourusername: he's not wrong
landonorris: hehehehehehehehe
oscarpiastri: he's literally sat in hospitality giggling and kicking his legs btw
landonorris: proudly so, my gf LOVES me
user37: lando got a gf before a win and i respect that
landonorris: i love you, can't wait for the rest of my life with you
yourusername: i can't wait, i'll even play golf with you x
danielricciardo: mate at least wait until the six month mark before you propose
landonorris: no promises x
note: hope you enjoyed, had this thought and i just had to do it. i'm working on requests and mamma mia p4!!
3K notes
·
View notes
Since 2013┃SV5
The year was 2013 and the young and charismatic Sebastian Vettel was dominating the racing scene with Red Bull Racing. Across the paddock, the talented and determined Y/N L/N was making waves as Ferrari's first female driver.
The connections between them was undeniable, both on and off the track. Amidst races with champagne-soaked podiums, Sebastian and Y/N found moments to exchange glances, winks, and playful smirks. Their chemistry was evident and the F1 fans couldn't help but speculate about the nature of their relationship.
As the 2013 season progressed, Sebastian claimed his fourth consecutive World Championship title, leaving fans in awe of his racing talent. Meanwhile, Y/N demonstrated her skills behind the wheel of the scarlet red Ferrari with the number 22, earning the respect and admiration of fans around the world, and especially of young girls dreaming of becoming like her. The two drivers continued their subtle flirtation.
A year later, in 2014, Y/N made history by taking the World Championship title, becoming the first female driver to achieve such a feat in Formula 1. The whispers among the fans grew louder and the media speculated about the connection between the two racing stars after the celebration shared between both drivers. Still, Sebastian and Y/N remained silent about their relationship, and continued to share glances and secret smiles just for themselves, telling the world they were ''just best friends''.
Fast forward to 2015 and the rumors remained the same or with more intensity. F1 fans began to suspect that there was more to the relationship between Sebastian Vettel and Y/N L/N than met the eye. The duo, however, chose to keep their personal lives private, maintaining an air of mystery around their connection. Although their physical behaviors gave them away.
Time passed, races were won and lost and the duo continued to shine in their respective teams, but always together on the track. By 2022, with four World Championships under his belt, Sebastian had joined Aston Martin, while three-time world champion Y/N had become a force to be reckoned with at Mercedes two years earlier.
Then came the unexpected announcement that shocked the F1 world. Seb and Y/N stated that they were expecting their first child and would retire from racing at the end of that season. The news was greeted with a mix of joy and sadness from their fellow drivers – the younger generation on the grid who had come to see them as their racing parents. Who were their greatest support on the track, giving them advices, raising their spirits and taking care of them as if they were their own blood childrens.
Charles, Max, Lando, George, Alex, Lance, Mick and other drivers expressed their excitement for their growing family, but couldn't hide a hint of sadness that their grid parents were leaving the racing world. The F1 community, which had witnessed the love story between Seb and Y/N over the years, sent them their sincere wishes for their new journey beyond the track.
''You two promise to come back sometime?'' Mick asked with watery eyes
''Of course Mick, we will never forget about our grid childrens'' Y/N responded with a warm smile
783 notes
·
View notes
Please excuse my initial reaction, I was quite distraught after reading his statement. Now that i’ve slept on the situation and have a more clear head i can say that i whole heartedly do not accept his apology for a few reasons:
1. One of us clearly remembers that night in excruciating detail. I will forever wonder what actually happened that night and that is something that weighs heavily on me. Although the next day i “accepted” that he would never hurt me, I no longer feel that way. It was a very fresh wound and I wanted to believe him because I still loved him. However, after two years of sitting on this and reflecting I take that back. And I felt like he was excusing his behavior by saying he didn’t realize how drunk I was. Also the fact that he shared it in such detail made me extremely uncomfortable. I respected him enough to not share such intimate details and he did not have the same respect for me. I think he could’ve just said “she initiated intimacy in the way she normally did” and it would’ve gotten his point across just as well. Regardless, he still had sex with me when i was blacked out while he was in a conscious enough state to assess and remember the encounter in such vivid detail. That fact has not changed.
2. All the stuff about his friends is frankly of no consequence to me. Everything that happened with Friend A happened while we were broken up. And him bringing up Friend B felt unnecessary given the fact that we all discussed the matter with each other at the time it happened. I never cheated on him and i would like to stop that theory in its tracks. Him and I have spoken about this matter privately on numerous occasions so that is all I will say.
3. About the shower thing, I was coming out of the shower/bathroom. He had the discord call on speaker on his phone. So yes, I heard very clearly what George said and Luke simply ended the call, he did not call him out. I believe he is recalling a different instance where another one of his friends said that he wanted to have sex with me once i moved to Florida. I was not witness to it and he did tell me he stood up for me that time which is why I didn’t bring it up. I did not go into more detail about it because I was just using that one quote as an example of how some of his friends would speak about me in his presence. However this is already more than one instance of his friends speaking about me in that way, which leads me to believe it happened quite often when I was not around.
4. Intentionally or not, I felt he demonized BPD and used that as a way to invalidate a lot of what I said
5. He still called me a slur when he knew it was wrong because I was getting cancelled for it at the time. I do not believe he was actually confused as to the gravity of what he said to me
I would like to remind you that i know him personally. I lived through that. When I say we remember things differently I mean it. I think that he believes he is being truthful. However because I know him and I know what I experienced, I do not trust him. I do not believe that we were “equally” toxic. While I admit I made a lot of mistakes in the relationship, to me they do not justify all I endured. I repeat, you can believe what you want. This is a very nuanced situation but if you were looking to me to accept his apology, I do not.
468 notes
·
View notes
Beauty is Pain
|| Regina George x female reader
|| Warnings: gossip talk, hookup mention, Regina's got an attitude, light swearing, y/n use
|| Sumary: Regina's high heels have been hurting her all day. Reader notices and offers that they switch shoes.
Requests open!
~~~~
Regina would never admit it out loud, but she was exhausted. Walking around school all day in heels was never easy. Sometimes she might sneak a break in the bathroom and take them off for a few minutes. But she hasn't had the chance to do that yet. Well, beauty is pain. Isn't that what they say?
At the sound of last period bell, Regina headed for the cafeteria. Her and the rest of the plastics (including you) had planned on skipping and going shopping. Karen, Gretchen and Y/N were already seated at their usual table. Talking about any and all things gossip related as they waited for Regina.
"Oh my God! Did you hear that a jock hooked up with an art freak?" Gretchen asks, grinning as she talks about the latest gossip.
"Ew, seriously?" Regina makes her presence known as she joins them at the table, taking a seat next to Y/N who smiles and gives the blonde's cheek a kiss.
"Yes! Oh my God! It's been like all over snapchat private stories." Gretchen nods, taking out her phone to show Regina the stories," seriously not fetch."
"Gretchen! Stop trying to make fetch happen." Regina rolled her eyes, Y/N would raise an eyebrow at the blonde. Noticing how she seemed to be in a mood. Not wanting to ask out right with the girls there, she takes out her phone to text Regina.
Y/N: 'Are you okay?'
Regina glanced down at her phone in her hands when she felt it buzz. Looking back at Y/N who was watching her with a concerned gaze. The blonde scoffed and texted back.
Regina: 'Fine. Obviously 🙄 shut up'
Y/N read the text and sighed. She knew Regina well enough to know she wasn't actually fine and that her attitude was the result of something. She just didn't know what; Regina's attitude was not going to scare her away from finding out.
After chatting a little more, the girls all got up and started heading towards the front doors of the school to go shopping. That's when Y/N noticed Regina was walking slightly different. Almost like she had a slight limp? Everything fell into place and made sense.
Without warning, Y/N grabbed Regina by her arm and pulled her off to the side as Gretchen and Karen went to Regina's jeep. Too busy chatting with each other to notice Y/N and Regina stopped following.
"The hell are you doing?" Regina snapped, looking at her with a look mixed with frustration and confusion.
"Switch shoes." Y/N replied, in a tone that wasn't quite asking or demanding. It was somewhere between the two.
"Excuse me? No, I'm not wearing your sneakers." Regina folded her arms as she stared down Y/N. Y/N, however, wasn't intimidated. Something Regina found awfully annoying." Plus, you can't even fucking walk in heels. You'll just embarrass both of us."
"I wasn't asking, Gina." Y/N replied, standing her ground on this. She wasn't going to let the blonde torture herself just to make a fashion statement.
Regina was taken aback. She wasn't used to being talked back to. Who in their right mind would dare talk back to Regina George? Clearly, Y/N would. Whether it was stupid or brave, Regina didn't know. Part of her couldn't help but feel impressed by her girlfriend's stubbornness with this. Usually she would argue with her, but the blonde wasn't in the mood. So (very reluctantly) she agreed. Not without groaning and rolling her eyes first, though. Obviously.
Regina reached down, one hand on Y/N's shoulder as she took off her heels. Y/N smirked, feeling pretty proud of herself for getting Regina to agree. She places her heels in Y/N's hands.
"Thank you." Y/N takes off her own shoes and hands them to Regina, the two then put on the shoes. Y/N struggling more than Regina as she nearly falls over once both feet were on the ground. Instinctively, Regina caught her before she could and scoffs. Though she makes no effort to let go of her. Even going out of her way to link their arms together so she could support her girlfriend. Y/N raises an eyebrow at Regina when she does this.
"Don't even. I'm just making sure you don't embarrass us both." Regina mutters, glaring at Y/N. Though her tone didn't come out as harsh as she wanted it to. She wasn't exactly truthful in her statement. She refuses to admit the real reason, but Y/N can tell.
With Regina's help, the two get to the jeep where Karen and Gretchen are waiting for them.
~~~
feedback and requests are welcomed :)
476 notes
·
View notes
୨୧┊ 𝐈. 𝐉𝐔𝐒𝐓 𝐅𝐑𝐈𝐄𝐍𝐃𝐒. ( charles leclerc )
ꖛ ─ you’re reading part one ∿ part two ∿ part three ( coming soon )
✧.* pairings ─ charles leclerc x fem! singer! reader
✧.* genre ─ social media au ⨾ fluff & chaotic
✧.* summary ─ in which your best friend George gets fed up with watching you and Charles secretly yearn for each other while claiming to be just friends. so, when you lose a bet to George, he takes control of your social media accounts for 24 hours, using the opportunity to help you make a move on your crush.
✧.* face claim ─ suki waterhouse
✧.* warnings ─ none, this is just really chaotic lol
✧.* mily’s thoughts ─ this is my first time writing a social media au so pls give me feedback! also, this is not proofread! btw feel free to leave requests <33
˗ˏ ➶ IMESSAGE ➜ w/ princess george . ✧ ˚
princess george: You know what, y/n?
y/n: no
princess george: I have the feeling that i’m gonna get a podium today!
y/n: what made you think that💀 not to crush your dreams princess, but i heavily doubt that
princess george: Wow, you’re so supportive. Why should I not be able to get a podium??
y/n: keyword: shitty car
princess george: Oh, yeah, I forgot about that… But i don’t care, i will manifest it (that’s what you always do, isn’t it?)
y/n: yeah sure..
princess george: You don’t believe me? Fine! Let’s make a bet then.
y/n: it’s way too early for this shit
princess george: Blahblahblah🙄
y/n: 💀 george i’m busy
princess george: Busy writing sad love songs about Charles or what??
y/n: …
princess george: Exactly. Now let’s do this!
y/n: why are you so eager to make this bet
princess george: Oh I just want to rub in your face that I was right afterwards
y/n: lovely.. but fine, start talking ig
princess george: Finally!
princess george: I predict that i’m gonna finish P3. Your prediction?
y/n: p11❤️
princess george: And now realistically…
y/n: p6
princess george: Thanks.
y/n: and what are the drawbacks?
princess george: I don’t know, maybe the loser has to hand over their main social media accounts to the winner for 24 hours. The loser isn’t allowed to use their main accounts in that time, only their private ones.
y/n: absolutely not
princess george: Aww you’re a scaredy cat?
y/n: no i just don’t trust you with my social media accounts💀
princess george: Okay fair enough
princess george: But c’mon, it’s gonna be fun! Only for 24h
y/n: fine but the winner can’t post anything too bad
princess george: Sure, sure. So, deal?
y/n: deal! and good luck (i hope you dnf)
princess george: Lovely as always
[ seen 12:03pm ]
georgerussell63
liked by yourusername, charles_leclerc and 1,056,386 others
georgerussell63 P3!!!! We keep on moving🔥🔥
view all 649 comments…
user471 was a close call but congratulations!
user172 carlos deserved it more, you literally pushed him off
user93 he didn’t push carlos off but okay💀
user425 so happy for you!
user65 it should’ve been carlos
charles_leclerc congrats on p3 mate!!🔥
georgerussell63 Congratulations on P2! I nearly got you, watch your back next time😉
charles_leclerc let’s highlight the word “nearly”😉
user976 so happy to see you on the podium again🫶
yourusername still convinced you bewitched half of the grid to let you pass them
georgerussell63 Creative but no, I just had a great motivation😊😊
˗ˏ ➶ IMESSAGE ➜ w/ princess george . ✧ ˚
princess george: Well well well, look who lost our bet…
y/n: 😐
princess george: C’mon give me the password to all your main accounts so i can log in😁
y/n: what if i were suicidal.
princess george: Honestly sounds like a you problem.
y/n: fuck you.
princess george: Still waiting for the passwords😊
y/n: fine, but remember, only for 24 hours!
princess george: Yeah, yeah. Now give them to me.
y/n: … insta is “503_UedusEiotSrk03” & twitter is “eZiyjDbbvwKi_zu_14806”
princess george: Damn, those are some ugly passwords!
y/n: are you seriously judging my PASSWORDS rn💀💀
[ seen 4:20pm ]
scuderiaferrari
liked by charles_leclerc, yourusername and 1,385,052 others
scuderiaferrari That’s ice cold🧊🥶 #F1 #P2 #Charles16
tagged: charles_leclerc
view all 6,175 comments…
user47 dayuumm🤭
user21 no one could ever get me into one of those things😭
yourusername That’s a sight I could get used to🥵🔥
landonorris don’t ever say or write that again.
urusername_alt🔒 @yourusername you really make me want to kms
yourusername @urusername_alt🔒 Aw, appreciate it❤️😉
landonorris y/n have you officially lost it?? why are you talking to yourself💀
user275 did we all see that or am i crazy💀
user164 yep we all saw that💀💀
yourusername
liked by zendaya, bellahadid, charles_leclerc and 18,364,187 others
yourusername "eyes that confess, while lips whisper 'just friends.'" my new single “just friends” is out now!!🤍 (yes, another single about my crush😘)
view all 369,270 comments…
user937 THIS IS SO GOOD AND HEARTBREAKING WTF
lewishamilton already on repeat🔥
user25 i cried my eyes out to this.
landonorris this is a BANGER
user12 how is this so cute yet so sad💀
˗ˏ ➶ IMESSAGE ➜ w/ princess george . ✧ ˚
y/n: HPW COULD YOU
y/n: I GO TO BED AND THIS IS WHAT YOU DO??
princess george: i have no idea what you’re talking about.
y/n: OH PLEASE YOU KNOW DAMN WELL WHAT YOU DID
princess george: Uhmmm nope.
y/n: YOU POSTED ONE OF MY DRAFTS
y/n: AND NOT JUST ANY DRAFT
y/n: NO, YOU POSTED THE ONE ABT MY SINGLE💀
y/n: IM GETTING EMAILS FROM MY PR TEAM BC I WAS SUPPOSED TO POST THAT ON TUESDAY
princess george: Oh, yeah, my finger slipped🫢🫢
y/n: your finger must’ve slipped multiple times then bc the caption is somehow a different one💀 not to forget the twitter thing
princess george: Oops?
princess george: Besides, I only added one sentence.
y/n: are you fucking serious
princess george: It was an accident.
y/n: ACCIDENT MY ASS YOU EMBARRASSED ME IN FRONT OF EVERYONE!!! AND TOLD PEOPLE ITS ABOUT CHARLES WTF
princess george: To be fair that was predictable when we set the rules to this bet. And I didn’t directly say the single is about charles.
y/n: you did directly say that💀
y/n: istg i’m gonna beat you up the next time i see you
princess george: Should I be worried..?
y/n: definitely.
y/n: you give me so many seasons to kill you. this is literally the 19th one
princess george: Make it 20…
y/n: george. what do you mean.
princess george: I might’ve given you another season. On accident!!
princess george: https://www.instagram.com/p/Cu-IkZstViy/?img_index=1
y/n: oh no
f1wags
163,948 likes
f1wags Love is in the air, and our radar has picked up some juicy rumors! It seems like the friendship between the singer Y/N L/N and Charles Leclerc is turning into something more than just a casual relationship. Get ready for the scoop as we take a closer look at the blossoming relationship between these two stars!
Y/N and Charles first crossed paths through their mutual friend George Russell, but it seems their connection has deepened over time. On late Sunday, Y/N dropped a bombshell by announcing her upcoming single to her social media followers, accompanied by a captivating caption. The last sentence read, "another single about my crush😘," which made fans curious and hopeful for more.
The plot thickened when Y/N responded to a tweet and saying that the song was indeed inspired by her "bae," none other than talented Formula 1 driver Charles Leclerc. The revelation left followers shaking with excitement, and it's clear that the connection between the two goes deeper than mere friendship.
But that's not all! Observant watchers have noticed the undeniable chemistry between Y/N and Charles, catching glimpses of their interactions when they thought no one was watching. Ah, the power of love! Charles might have forgotten that the public has eyes everywhere, but we certainly haven't missed a beat.
The burning question on everyone's mind is: what's behind their friendship? Is it just a playful crush or something much more intense? Could Y/N L/N be a new f1 wag? Time will tell, but for now we can't help but root for this potential power couple.
So stay tuned, gossip lovers, because there's more to come from Y/N L/N and Charles Leclerc. Whether it's a steamy romance or just a close friendship, we'll be here keeping our eyes peeled for any hint of what's going on behind the scenes. Love may be a game of mystery, but they've forgotten that we're experts at unraveling the truth. Keep your eyes open, folks!
view all 33,647 comments…
user79 y’all really don’t know how to mind your own business
user943 why are people making such a big deal out of this like they’re just friends and y/n was probably just drunk or smth when she said those things🙄🙄 ITS NOT THAT SERIOUS!!
user27 you guys really don’t have a life huh💀
user375 who tf is this blondie
user50 girl stfu that’s literally my wife
user697 AAAA i really hope this is real bc they’re so cute💖
˗ˏ ➶ IMESSAGE ➜ w/ princess george . ✧ ˚
y/n: 💀💀💀
princess george: I’m starting to feel bad now..
y/n: good, you should💀
y/n: i’m gonna apologize to charles now
princess george: Why, It’s not your fault.
y/n: you’re right, it’s yours. but you said all those things with my account so it looks like it’s my fault lol
princess george: I’m really sorry, I took it a little far!
y/n: a little is good💀 but dw it’s okay, i know you only meant it jokingly, i’ll tell everyone it was you and not me once the 24 hours are over
princess george: 👍 Good luck talking to Charles. And don’t forget to confess to him before I do it for you😉😉
[ seen 1:24pm ]
∿ people who might want to get tagged ─ @81astri @cs55version @lorarri ( my taglist if you want to get tagged in my works )
don’t forget to like, comment & reblog (it’s very much appreciated <3).
© milaeth | 2023
1K notes
·
View notes
"You Can Call Her Phone" series (Lando's Version)
author's note : so I'm thinking if you guys like this I can do it with other drivers (only Oscar, Logan, Alex, Yuki, Liam, Pierre, and Carlos), but you'll have to give me the idea of why they're answering in the first place. I've got a George one lined up next so stay tuned for that.
pairing : Lando Norris x fem!reader
warnings : once again a lot of cursing and shitty men, not proof read
word count : 627
The walk home had been quick, because you refused to have this argument in the middle of the Monaco streets where anybody could hear or see. The crowd at the club had been embarrassing enough. So as soon as you got inside, Lando was ready to defend himself.
“He called you his bitch, babe! I wasn’t going to sit there and let him call you those things!” He was fuming, mostly at the aforementioned man, but there was no one else there to listen to him.
“And then you basically called me your personal stripper, Lando!” He opened his mouth to talk, but you kept going. “That was so inappropriate and uncalled for. I just can’t even believe you would say something like that.”
He understood where you were coming from, honestly. But Jack had been making eyes at you the whole night without you being aware, and when you went to dance with some friends, he started making lewd that got under his skin. It wasn’t a surprise that Lando had snapped. “He started way before the bitch comment, babe. Okay, and i just couldn’t sit there anymore and take it. He needed to know-“
The phone ringing cut him off and he looked at the screen in your hand.
Jack.
“Is he really fucking calling you after all that?” Lando’s eyes had darkened. “Give me the phone.” You listened, handing him the phone with a resigned look on your face. “What the fuck do you want?” Lando asked him, voice steady with an anger you hadn’t head in a while. “No I’m not gonna give her the fucking phone, you ripe shithead. After the way you spoke about her and to her face, you’re lucky you’re even in the city right now. Because if I had my way, I’d have your ass sent to a fucking tundra where you can’t ever be warm again.” You heard yelling from the other line, but none of it was clear enough for you to make out what he was saying. “I will get a fucking restraining order on you and your goddamn dog if I ever hear that you come near us again, got it?” More yelling came from the other line, but Lando didn’t wait for him to finish, hitting the red end call button.
“You done?” You ask, holding out your hand for him to return your phone.
“One second, I’m blocking him on everything so he can’t talk to you again.”
“And if he makes a second account?”
“I’ll fucking call up Mark Zuckerberg and get him banned from making any social media again.”
“Now you’re being ridiculous.” He rose an eyebrow at you, but you made no move to grab your phone from him. With a sigh, you dropped your hand and stepped closer to him, pushing your phone away so he would look at you. “Seriously Lan, I want you to know that I’m not okay with what you said tonight at the club. It was one, out of line; and two, none of their business.” That got him to smirk, moving his hands to your waist to pull you flush against him.
“I know baby, I was out of line when I said that to him. I’m sorry I made you uncomfortable with my words.” He kissed your forehead and you leaned into him, content with the apology for now. “But just so we’re on the same page, you’re my private dancer?”
You moved to hit his chest, but he caught it first, bringing your hand up to his mouth for a light peck. When you didn’t answer, he licked your hand and you shrieked. “That’s gross, Lando!” But the smile on your face told him that everything was okay for now.
565 notes
·
View notes
lover - Oscar Piastri
Words: 2,958
Summary: Press and fans find out during the Australian GP that Oscar isn’t single, in fact he is married. The more troubling part is the rest of the grid finding that out as well.
Note(s)/Warning(s): Some drivers aren’t portrayed greatly in this, not because I don’t love them, but because they're a bit dumb and stupid. Some interesting thoughts about Lando and Max and Mclaren and Red Bull. Some angst. Logan is protective of Oscar and Oscar’s wife (his self proclaimed little sister). Slight NSFW at the end. Once again stating that I love all the drivers mentioned and written in this fic. (If anyone is interested in knowing more about my thoughts on the whole Lando, Mclaren, Max, Red Bull thing, send me an ask.)
Taglist | Masterlist | Patreon | lover verse
“Hey, Apples.” Oscar greets when he picks up the phone.
“Os,”
He frowns, stopping in his steps, ignoring how Lando is trying to wave him over for something. “What’s wrong?”
She sighs, “You know how I said I wouldn’t get lost?”
He breathes a sigh of relief that it's nothing serious, smiling again. “Lando’s trying to get my attention for something, but I’ll text Logan to get you. That okay?”
“Yeah. I’ve missed our American boy.”
Oscar scoffs, “you’ve missed him. I’ve had to deal with him.”
She laughs, “Uh huh. I’ll let you go, but have fun talking to Lando. I’ll see you later, Os.”
“Later, Apples.”
Ending the call, he quickly messages Logan. The message brief and he’s not surprised when the American driver sends back quickly a simple thumbs up.
“What’s up, Lando?” He asks, when he finally gets close enough to his teammate.
“You’re married?”
Oscar blinks at the British driver. This is what Lando had been waving him over for? Something he already knew. “Yeah. Have been.” His eyebrows press together. “Are you alright? Hit your head or something?”
“No!” Lando shrieks, making him jump back. “You’re married. When did that happen?”
His shriek and loud words catch a few other drivers' attention and before Oscar can process it, he has Charles, George, Checo, Mick, and Lance also surrounding him, asking him if he’s really married.
The repeated question has him blinking widely, wondering if there’s something in the air that’s making them all have memory loss.
“Yes, I’m married. Why are you guys acting like this is new news?”
“Non.” Charles says, eyes wide. “You can’t be married. You are a baby. Younger than Arthur.”
He rolls his eyes at the words. “Fuck off, mate. I’m not a baby.”
Charles pouts. “But you are so young to be married.”
Oscar’s nose wrinkles at the words, lips pressing together. “Right.” He nods, holding back what he wants to say. “I don't know what to tell you guys. I’m married and I thought you guys knew.”
George scoffs, “none of us had any idea. And twitter is going crazy, mate.”
“What do you mean twitter? I’ve been married since I was eighteen. This isn’t a new thing.”
“Eighteen!”
Oscar nearly throws his hands in the air. “How did not one of you know? It’s public knowledge. Like all marriages.” He doesn’t mention the fact that he has definitely mentioned his wife in infront of all the drivers, they all obviously had trouble listening.
Lando flushes, “I mean, you don’t really talk about yourself. So, I guess it just never got brought up?” He offers, though it feels a little weak and Lando can’t help but wonder if Oscar had mentioned it but he had just thought that it was a joke or had been tuning him out because it wasn’t team or race related.
“Late congratulations then Oscar. She is here, no?” Checo says.
Oscar smiles at the older driver. It had felt odd that he had joined the rest of them, but it was clear he had joined because of the mention of another driver having a wife. They were few and far between. “Yeah, first race weekend this season.”
“Give her my congratulations as well.”
“I will.” He tells the older driver, watching as he leaves before turning his attention back to the other five.
“I’m private, but I’m not that private, you guys.” He says, and before one of them can say anything an American voice is speaking up from behind him.
“Private about what?”
Logan eyes the five drivers surrounding Oscar, nearly cornering him. The girl next to him breath catches a little at the sight and he squeezes her a bit closer before dropping his arm from around her shoulder.
“Everything alright?” He asks, no one having answered his previous question.
Oscar turns his head to throw him a grateful look before completely turning around seeing the girl beside him, a smile blooming across his face. “Logan find you okay?”
He can see from the corner of his eye, her nod shyly, fidgeting under the stares of five complete strangers and Logan gives the girl he considers a little sister a light push to Oscar. Knowing that they’ll both feel better with some contact.
Logan turns his head to face her when she gives a light tug to his shirt and he easily tilts his head a little downwards to receive the kiss on the cheek she gives as silent thanks, trying not to smirk at the wide eyed looks the other drivers are giving him. He turns his head back to face them, when she joins Oscar, the youngest driver on the grid, easily wrapping an arm around her and pulling her close, though keeping her slightly tucked behind him.
“No one knew I was married.” Oscar tells him, answering his question from before.
Logan’s eyebrows furrow. “What? It’s public knowledge.”
He shrugs, “twitter is apparently going nuts. No one knew.” He then nods his head towards the five drivers in front of them. “Including other drivers.”
He scoffs, “that’s a joke right?” None of them say anything and Logan can feel a simmer of anger starting in his gut. “Seriously. I’ve heard him mention her when all the drivers were around. Mark made a joke at the first race about him being married.”
No one of them say anything to that and Logan can feel his eyes narrow seeing Lando and George exchange a quick look.
It wasn’t necessarily surprising to hear that people on twitter were freaking out about it. It wasn’t something that first came up when you searched Oscar Piastri. But for not one of the drivers to know? Especially after hearing Oscar mention her? Mark make a joke about it? It rubbed him the wrong way.
He wondered if it was because when they all did a quick google on Oscar nothing about him being married came up. A combination of money buying a little privacy, though not enough to bury or hide a public marriage, and how private Oscar was as a person. He didn’t like talking about himself, was a little hard to make friends with unless effort was really put in or you were around him often enough. He also doubted that any of the drivers had really tried to get to know him due to the whole McLaren thing and the Alpine drama of last year. They only knew so much about Logan because everything was online about him, a problem with too much money, and he was willing to play into the whole about himself American persona.
It also makes him wonder if Oscar had been lying when he said that Lando and him were getting along. It was still early days, but for Lando not to know that Oscar was married? It spelled something that Logan didn’t like and the thought of Max not being the only teammate killer crosses his mind before he can stop it and he shakes his head. It was far too early for that and unfair to both Max and Lando. They weren’t the true issues or at least at the moment in Logan’s eyes Max wasn’t, their teams were.
Logan shakes his head at the silence from the other drivers still. He didn’t know what to say. Other than he wanted to tell them all to get their ears fucking checked. But he holds his tongue.
“Well now you guys know.” He tells them after another moment of silence. “This is Y/N, Oscar’s wife. And you already know all these guys.”
She nods, giving them a small wave that Lance and Mick return before quickly walking away with quiet apologies.
“You are a baby as well.” Charles says, eyes widening right after, clearly not having meant to say that.
She looks at Oscar and then Logan. “I thought you guys said that Arthur was worse than him.”
Logan laughs at the way Charles looks offended, mouth open in shock. “Charles has his moments.”
Feeling a slight tug to his hoodie, Oscar gives a nod to his teammate and the other two drivers. “We have to get going. Talk to you tomorrow.” He tells them, before stepping away, knowing that Logan is following just barely not on their heels.
Logan and her both hang outside of the McLaren headquarters for the weekend, waiting for Oscar to come back from a quick talk with his race engineer.
“Lando.” She begins and she can feel Logan’s full attention on her. “Do I need to worry?”
“Everyone likes him. He’s likable.” He tells her, trying to ignore what she’s getting at. Doesn’t want to think about the thought that popped into his head barely fifteen minutes ago.
“Logan,” Her voice is a little harsh. “Do I need to worry about Oscar being teammates with him? We all saw what happened with Daniel at least with what the media said. And I’m grateful that McLaren gave Oscar one of his dreams. But do I need to worry that they will ruin him for Lando?”
He can’t make his eyes meet hers, can’t when he can’t give her a sure answer. “I don’t know. Lando to McLaren is like Charles to Ferrari nearly, just not as predestined, I guess.” The words are sour sounding. “He still has good relationships with Daniel and Carlos.”
“Max is called a teammate killer and he’s got a great relationship with Daniel. A fair one with Alex according to your texts. And we all know that it’s not him, but Red Bull that’s the killer.”
He can’t help but glance around despite their whispers, wincing as she repeats his thought from earlier of Lando being perceived as a teammate killer. This really wasn’t the place to have this conversation, but he understood her need for some sort of answer. “I don’t know.” He repeats. “It’s still early. I want to say that McLaren will be fair to Oscar and treat him well, won’t treat him like a second class driver, but after them breaking a contract with Daniel.” He swallows harshly. “I don’t know.” And he hates that.
Getting into Formula 1, getting the chance that nearly all drivers dreamed of but only some got was supposed to be fun. Sure there was always going to be pressure and stress, but no one had warned him about the politics of it all.
“Okay,” she tells him, wrapping her arms around him in a hug and he can’t help but rest his head on her shoulder. Letting her bear his weight for a moment. “It’ll be okay Logan. And thank you.”
“Of course.” He mumbles. And suddenly there’s another set of arms wrapping around him and her. He only doesn’t move or lift his head because he knows those arms and there’s an Australian accent in his ears.
“You alright, Logan?”
He lifts his head to nod, not wanting to hurt her. “Yeah, just stress.”
He squeezes them both a little tighter. “Can say that again.”
Logan smirks, beginning to open his mouth but then a finger is poking between his ribs and he’s jumping out of the hug, rubbing at the spot with a pout. “Hey!”
She shakes her head at him, pressing closer to Oscar as he presses a kiss to the top of her head.
“Don’t get cheeky. You still coming to dinner with us?”
Logan scoffs, “Of course. I’m not missing out on seeing Nicole and Chris.”
“My parents will be there as well.”
Logan throws his hands in the air, starting to walk backwards. “Why are we still here then?”
“Still missed him?” Oscar asks her as they start to follow him.
She laughs at the dry but teasing tone. “Of course. He’s a great older brother.”
“He is, isn’t he?” He has a put on suffering face, but there’s a fondness in his eyes as he looks ahead to where Logan is.
“He is.”
“Is everything alright?” He asks, slowing their pace a bit more.
She hesitates. “We’ll talk about it after dinner, but it should be.”
His brows furrow at the response and he can’t help but squeeze her closer. “Are you okay?”
“I’m all good, Os. Just worrying.”
“Promise?”
“Promise.”
—
“You’re worried.” He brings up nearly five hours later as they soak in the bath together, her back to his chest, his fingers interlaced, hands resting on her stomach and her hands resting on top of his.
He can feel her breathing stutter and his heart clenches inside of his chest at the reaction. She had always been a bit of a worrier. He wasn’t exactly sure where she got it from, no siblings to inherit the trait from and her parents were fairly laid back. But this seemed different, more serious. “I had some thoughts about McLaren. I needed to talk to Logan about them. He had some of the same ones.”
“Like?”
She pauses, lips pressing together for a moment. “McLaren gave you your dream.”
“One of my dreams.” He corrects her, picking up her left hand and pressing a kiss to her ring finger. Her wedding band and ring sitting on the bathroom counter instead of being where they belong.
“One of your dreams.” She corrects. “They clearly favor Lando.” His hand and hers settling back where they were.
“Lando’s an experienced driver, Apples.” he lets out a small laugh. “It’s only my first season. I’m a rookie.”
“Oscar,” she turns slightly to look at him. “Daniel was a more experienced driver. He even got them their first win in how many years and look what they did to him?”
He winces at the reminder. It would always slightly haunt him that the only reason he had a seat at McLaren is because they tossed Daniel like trash practically. Didn’t sit right with him and suddenly the solemness on her and Logan’s faces earlier made sense. “You two think they’ll do the same to me?”
“I think that as long as Lando gives them some sort of positive result he’ll always be their number one. Even if you perform better.”
He swallows at the words, because fuck it was looking like that wasn’t it?
Lando was a great driver, amazing, Oscar was thrilled to get to be his teammate and learn from him. But Daniel had pulled results from the McLaren, even if he hadn’t gotten as much as Lando did from it last season. It made no sense to get rid of an experienced driver or push him aside for a younger driver that would have years more left on the grid. And as he sits thinking about it, he’s reminded of how much last season McLaren put Lando first over Daniel, despite Daniel having a better chance or opportunity. Remembers some of the races he attended seeing Daniel’s frustrated, tired face as he got out of the car.
“You think Lando’s going to get called a teammate killer?” He knew her mind, knew it wasn’t a far stretch considering how Carlos was perceived at Ferrari and how Daniel wasn’t even racing this season.
“I think that if people are willing to call Max one when Red Bull is clearly the problem, it’s a miracle that he hasn’t been called it already.”
“Fuck.” He whispers, dropping his head to rest it on her shoulder.
“I’m sorry.” She whispers and he lifts his head back up.
“Don’t. We’re a team. This would have driven you mad keeping it to yourself.” It was a lot, but he was thankful it was being brought up now. Gave him more time. And god he’d have to bring it up with Mark. He could only imagine that the man would want to talk to her. Mark had always appreciated her thoughts and knew that they were a team. He didn’t just bring things to him, but to her as well.
“Charles doesn’t like me, I think.”
Oscar can’t help but laugh. The tension that had filled the bathroom, leaving. “You did say that he was worse than Arthur.”
“In that moment he was.” She defends and he presses a kiss to her cheek, still laughing.
“Once he gets over being told he’s worse than Arthur, he’ll like you just fine.”
“Think so?”
“Know so.” He corrects. “Not many people dislike you, Apples.”
“But you like me best.” She says, smiling.
“Like you best and love you best. Love you so much.” He murmurs before pressing a series of kisses to her cheek making her giggle and then squealing when he manhandles her until she’s facing him, straddling him.
“Hi, Apples.”
She beams at him and he can’t help but swallow at the brightness of her eyes. “Hi, Os.”
“You ready for bed?”
She lets out a little hum, wiggling her hips and his hands grasp at her waist, the lust that had started to simmer inside of him when he had turned her around growing at the pressure against his dick. “You have a race tomorrow.”
“Is that a no?”
“We haven’t had sex during a race weekend in over a year now. Don’t want you to be tired tomorrow.”
“I’ll be alright.” He tells her, pressing her down a bit and can see the way her eyes dilate at the feeling of him growing hard underneath her. “Might even make me place higher.”
“Well, only if you think it’ll make you place higher.” She teases and he can’t help but lean forward and kiss her.
She sighs into it, pressing closer to him, chests touching as he bites gently at her lip. “I’ve missed you.” She breathes when they separate, her eyes on the slight flushed face of her husband.
“I’ve missed you too.”
---
Tagging: @ireadthensuetheauthors @copper-boom @lpab @gemofthenight @peachiicherries
1K notes
·
View notes
HEARTBREAK ON TOUR!
charles leclerc x famous!reader
summary: in which the lavender haze has been lifted. or in which america’s it couple splits.
part 4: emo ponytail girl part 3: DUPEE, part 2: wtf does ET know?, part 1: don’t start
faceclaim: madison beer
ally’s radio 📻: PART 3! thank u guys so much for the love on part 1 & 2. IM SORRY FOR LEAVING YOU ALL IN SUSPENSE BUT IM BACK AND buckle up for some more drama (YASS) and a lot of tswift references 🫶
INSTAGRAM, (july 3)
liked by honeybagerdr, karmaleclerc, and 244,523 others
c16daily Charles seen entering and leaving a restaurant with mysterious girl last night in monaco via @legrandprixclub
View all 33 comments
gaslyleclerc WHO THE FUCK
judeslvr i’m so confused it hasn’t even been a full week??
sharlleclerc i can’t keep defending u man if you keep doing bs like this😭😭
ctrly/n oh wow
s1ut4formula1 copy of y/n
bejeweled.y/n @s1ut4formula1 don’t do y/n like that.
veerstappenmaxemilian someone give me her @ right NEOWW
bbynoriss @veerstappenmaxemilian ON IT
TWITTER,
INSTAGRAM, (stories)
yourinstagram 37m
viewed by chrisevans, sabrinacarpenter, and 567,431 others
yourinstagram (story) 25m
viewed by lewishamilton, landonoriss, and 534,133 others
INSTAGRAM,
liked by latenovembery/n, bloodlinegrande, and 102,345 others
y/nflorals MORE OF Y/N AND FATHER NANDO EATING DINNER AT A RESTAURANT LAST NIGHT IN LONDON.
View all 33 comments
444mercedes Y/N’S FERNANDO ALONSO’S DAUGHTER???? WHAT SINCE WHEN??
jpgmacvesstap @444mercedes babe ur so late 😭
lance.strollll no wonder why y/n is so pretty 💀
eversincey/n @444mercedes their relationship is v private. y/n took in her mothers maiden name so that the media wouldn’t connect the two. it’s rare when we see them together bc of their busy lives but yeah i was shocked when i found out too
voguey/n IN FATHER NANDO WE TRUST 🛐
alonsof1 judging by his face ik she dropped some really good tea
missamericanay/n id honestly be shitting my pants if i was charles knowing my ex’s father is essentially my coworker 😭
INSTAGRAM, (stories)
yourinstagram 10m
viewed by zayn, louispartridge_, and 69,123 others
INSTAGRAM,
liked by y/nsonlyangels_, sweetdispositionleclerc, and 567 others
f1paddlockupdates carlos, lando, and daniel have unfollowed charles on instagram.
View all 22 comments
ferraribabe i just checked and lance stroll, george russell, and fernando unfollowed him as well 🧍🏽♀️
suffering_ferrarifan damn what did homeboy do 😭😭
y/nsredscarf @suffering_ferrarifan cheat obviously
suffering_ferrarifan @y/nsredscarf we literally don’t know that. not believing anything until it comes from y/n or charles themselves 🤷♀️
INSTAGRAM,
ally’s radio 📻: SO YEAH. this was a little filler but might be dropping part 4 later on today to make up for the time i’ve been gone! thanks so much for the love! so fascinating n cool to hear ur ideas and feedback, v much appreciated. what r our thoughts??
taglist🦢🪩: @incoherenciass @dakotali @405rry @topaz125 @sassyheroneckgiant @hevburn @itsmytimetoodream @ivegotparticulartaste @crowdedimagines @asterianax @haydee5010 @scenesofobx @christinabae @magical-spit @dessxoxsworld @myareadsbooks @honethatty12 @hopefulinlove @diasnohibng @gentlemonsterjennie1 @hummusxx @eugene-emt-roe @taestrwbrry @pejarma @cxcewg @chimchimjiminie16 @glow-ish
2K notes
·
View notes
Could you do something with Lewis, maybe reader and Lewis have been dating for a while but she’s famous too so they kept things really private, but they got married over the winter break and now the other drivers are finding out
Hello 🫶 lately I've been doing more smaus so I decided to make this one a smau also, hoping you'll like it 🩷
yourusername I still haven't gotten used to seeing myself on those huge ads
view all comments
georgerussell63 A supermodel and an actress not being used to seeing herself in ads? 🤨
↳yourusername When was the last time you were walking down the street and saw a picture of you casually hanging on a building? 🤨 Let me tell you it always takes you by surprise, George
carmenmmundt How are you so beautiful? 😭
↳yourusername I love you Carmen 😭
oscarpiastri Good job, Y/n👏
danielricciardo What an abundance of beauty you are
landonorris an amazing day to have eyes
charles_leclerc Can't take my eyes off you
zhouguanyu24 You haven't posted in months and that's what you decided to post?🙄
↳username1 AND SHE ATE
carlossainz55 See you in Vegas soon 👋
tchalamet You busy lately? We haven't been in a movie together for a while
↳username2 Co-star rizz lmao
username3 It's so weird to me how Y/n is the most gorgeous woman I've ever seen and she's SINGLE
↳username4 It's her choice
username3 And she made it while having f1 drivers and timothee casually flirting with her in the comment section
username4 Doesn't seem that much like flirting to me 🤷♀️ she's friends with Carmen and George so she's gonna have the drivers in her comments. And Tim is like her bestie
username3 Are you blind 😭 okay maybe Oscar's comment is friendly, but the rest is definitely flirting!!
username4 Whatever feeds your delusions I guess. I don't think she's single, she might just be keeping her relationship super private. Exactly because of fans like you
yourusername Nothing beats a date in Las Vegas
view all comments
username1 A DATE. IN VEGAS.
username2 Okay guys, which driver do we think took her on the date?
↳username3 I'm saying Lando, it's a very Lando thing to do
username4 imo he was too busy healing from this terrible crash he had lmao
username5 Plus Lando is too young for her, I'd say Danny Ric
username4 yooo y/n and danny would be a great couple, I hope you're right
username6 Do you guys remember what Carlos commented under her previous post?? "See you in Vegas" or smth
↳username4 yeah but it could be just because she was invited to the paddock
username6 Like usually. But did you ever see any driver say anything like see you there and there before other races?
carmenmmundt YOU WENT ON A DATE?
↳georgerussell63 @/yourusername reply immediately and say who took you
yourusername Mom, dad, I'm terribly sorry I didn't tell you 😭
carmenmmundt This doesn't answer our questions...
↳username1 Help even they didn't know lol
username7 It could be anybody, guys. Y/n has most of the drivers in her likes
↳username2 Then maybe it's someone who isn't in the likes? 🤭
username7 Well, then we have Alonso, Bottas, Hamilton and a few others, it doesn't make it easier
username3 She'll say who it is when they're both ready but I wish it would happen as soon as possible
username9 LMAO none of the guys from the previous post commented now
↳username5 She just subtly told them too f off cuz she's taken 😭
username8 I can't wait until the winter break, I know something is gonna happen...
yourusername He made me get my first tattoo lol
view all comments
username1 WHAT?? IS?? HAPPENING??
↳username2 idk looks like miss girl moved, got a tattoo and then decided to travel around 😐
carmenmmundt When are we going to talk about who is "he"?
↳yourusername When the timing is right ✨
georgerussell63 Whoever he is, he's a bad influence on you 🙄
↳yourusername Mom can you tell dad to quit my comment section @/carmenmmundt
username3 Y/n moved to Monaco 😭
↳username4 And how do you know that?
username3 Haven't you heard she was seen there?
username4 And? Celebs love Monaco
username3 Exactly. So she moved there. Possibly with her secret boyfriend
username5 Okay so what we know about Y/n's secret man is they live together in Monaco, he could be an F1 driver and he must have tattoos (because why would he make her get one otherwise?)
↳username6 IT'S DANNY RIC I'M TELLING Y'ALL
username7 Well there's also Hamilton who has quite a lot of tattoos
username8 And Alonso and Stroll, she didn't say how many tattoos her bf has, could be as well one or two
username5 Don't forget some drivers might have them hidden and never spoke about them
username9 To be fair she didn't say if he has any in general lol
danielricciardo What about a party in the new apartment?
↳username6 Yeah, keep telling me it's not him
↳yourusername Most likely when I'm back from my lil vacation
lewishamilton Winter break
view all comments
username1 EXCUSE ME
username2 SIR LEWIS HAMILTON, EXPLAIN THE LAST PHOTO
username3 Don't panic, guys, it is me in the 4th pic
username4 I know he's an almost 40 years old man but I'm still shocked
username5 ngl that woman's hand looks familiar...
username6 Not even a tag on the last pic? 😕
username7 Silly season starting early this year 😭
↳username4 Yeah, firstly he dropped the bomb about moving to Ferrari and now THIS
username7 Man said lemme dominate this winter break 🤠
landonorris congrats i guess?
carlossainz55 Unexpected but happy for you!
georgerussell63 I'm calling Toto, you're lucky he doesn't have social media
username8 I can't believe he kept it a secret from all the drivers lol
↳username7 And for so long too!! I mean, you don't marry someone you started dating a month ago, it could've been going on for YEARS
charles_leclerc When will we meet this mysterious lady?
↳lewishamilton I'm sure you all know her well
↳username7 Leclerc better stay away 🤺
username9 You guys don't ever know how sure I am that it's Y/n
↳username10 I won't believe it until they confirm it
username9 Yeah because it's a total coincidence Y/n recently moved to Monaco, got a tattoo because "her bf made her" and also went on a trip
yourusername Shik shak shok
view all comments
username1 I KNEW IT I KNEW IT
username2 The couple I never knew I needed
username3 Two fashion icons
username4 Honestly is anyone surprised? Like, okay, unexpected, but I'm not surprised Lewis is dating one of the most famous models/actresses in the world
↳username5 I am surprised tbh 😭 I think a lot of people expected DR3, not LH44
username6 rip to all the drivers who used to hit on Y/n in her comment section 💀
username7 So Y/n is dating LH44 and is best friends with the girlfriend of GR63?
↳username8 She copied her lol
username7 Except Carmen's bf hasn't ever won the world champion title lmao
↳username9 That's a real friendship. Going for drivers from the same team
username10 I need to know how did they mange to keep it a secret for so long 😭
↳username11 Yeah cuz I can't believe even Toto himself had no idea
username12 Something about them being married makes so much sense, I love them
username13 Imagine when we start seeing them doing ads together omg
↳username14 ads? 💀 now that they're out and married I expect lots of content together on both their accounts AND on Drive to survive and just anywhere
username11 tbh who cares about the races, they can just display Y/n on the screen for 2h and I'd watch
y/nhamilton btw we used to date but now we're just married (and thanks @/zhouguanyu24 for keeping our secret)
view all comments
carmenmmundt I was just as shocked as the fans
landonorris somehow I'm not surprised Zhou knew
↳username1 And he knew about both THIS and Lewis moving to Ferrari!! And kept quiet both times!
↳charles_leclerc I wonder what else Zhou knows that we don't
username2 Zhou Guanyu is officially the most trustworthy guy on the grid
↳username3 And I thought it'd be Oscar...
username4 Does it mean more iconic Y/n outfits on the paddock? 😍
↳y/nhamilton And matching outfits! 🤭
username2 Oh they're gonna kill it!!
username5 I need a friend like Zhou
zhouguanyu24 You're welcome 😌
↳y/nhamilton 🫶
↳lewishamilton 💜
username6 I never thought about Lewis and Zhou being friends, but...?
username7 in moments like this I go look at the old posts where other drivers would flirt with Y/n lmao
username8 This winter break belongs to Lewis
oscarpiastri Lewis' last name suits you
↳landonorris it would've been funny to see Lew change his last name to hers tho lol
carlossainz55 How long have you been together?
↳y/nhamilton Something like 5 years now
carlossainz55 And none of us knew all this time 😳
y/nhamilton Zhou knew... I've just said that
username9 All the other drivers immediately regretting everything they said under other Y/n's posts hahahah
820 notes
·
View notes