Tumgik
#I'm getting smoked like a ham here
hellsitegenetics · 2 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes
atinylittlepain · 1 year
Note
Hiya! I love your writing so much it's amazing. Can I request Joel and Reader! smut? Maybe angry s3x? I loveeeee grumpy Joel. They would def be primal and rough and fast about it too...oof. I'm not too good at coming up with plotlines haha
Anyways thank you so much if you do! :3
oof, this was fun to write
Tumblr media
gif by @tightjeansjavi
Menace
Joel Miller x f!reader
Joel Miller masterlist
When Joel refuses to join her at the bar, she has a good time by herself. But he just can't stay away.
warnings | 18+ SMUT, rough sex, little angst, little fluff, mostly just smut tho
...........................
If Joel were here right now, she knows he wouldn’t like the looks of things one bit. Not because she’s in any sort of danger, the only real danger at the Tipsy Bison is whatever that cheap grog is that they keep stewing in the back. No, what Joel wouldn’t like to see is her having a good time, for once, without him. And that’s exactly what she’s doing. 
It’s a Friday night in Jackson, a town in which she can actually enjoy the luxury of having a real Friday night after a long week of patrol shifts. Joel, in all his brooding glory, had rejected her invitation to go out to the bar, telling her that all he wanted was some “fucking peace and quiet.” She hadn’t let that get her down, though, scoffing at his petulant grumbles and heading out by herself. And she was having a damn good time too.
“Goddamn, girl. Giving me a run for my money.” She grins at the man, idly spinning her cue stick in her hands as she walks along the pool table. 
“You better shape up then, or you’re gonna owe me another drink.” The man throws his head back in a laugh at that, his eyes crinkling up as he looks at her. His name is Teddy, one of the younger men around town who also works patrol shifts. She had a shift with him earlier in the week, and he had been warm and welcoming to her, still pretty new to the swing of things. It doesn’t take a genius to see that he’s flirting with her, and she’s happy to play along for now, knowing she’s got her grump of a man waiting for her back home, probably snoring in bed already. Love is strange, but she is Joel’s and he is most certainly hers, and she wouldn’t have it any other way. But for now, a little banter with this sweet boy isn’t going to hurt anyone.
“Watch and learn, Teddy. I’m gonna show you how it’s done.” The man whistles low as she bends over the table, lining her cue stick up with her target. So what if she’s hamming it up a bit? Shimmying her hips and flicking her hair out of her face. A small crowd has gathered around the table to watch her smoke this kid, and she’s enjoying the feeling of letting loose after being tensed up for so long.
She moves cool and slick around the table, driving home her last three balls before setting her sights on the eightball. It looks like a tough shot, and she revels in her confidence that she can sink it, feeling Teddy’s eyes sweeping down the slope of her back as she arches over the table. There’s a hushed swell of laughter and a few whoops when she hits the eightball clean into a pocket, and she turns and shoots Teddy a crooked smile.
“Pay up, boy. I want the good stuff this time, top shelf only.” Teddy barks out another laugh, but it quickly dissolves as his eyes flit just behind her. She feels him before she sees him, the solid warmth of him pressing up behind her and a broad palm splaying over her shoulder. He’s certainly not snoring in bed.
“You’ll have to take a rain check, son. She’s needed at home right now.” The low rasp of his voice tells her all she needs to know. He saw her, and the little moves she was making, and now, Joel Miller is pissed.
She can see the bob of Teddy’s throat as he swallows, nodding jerkily. She winces at the crack in his voice when he says that’s alright, he’ll see her around. Joel may be a grump, but he’s also a scary grump when he wants to be, like right about now as he’s steering her out of the bar with his hand still on her shoulder.
“Putting on a little show for all them townsfolk, darlin?” His southern drawl always gets headier, slower, when he’s angry. It’s never a good sign when she starts having a hard time pulling his honey-thick words apart. But she refuses to let him intimidate her, huffing as they trudge through town toward their house.
“It was just a little fun, Joel. I know you’re not too familiar with the concept, but—”
“Oh, you’re wrong about that, darlin. Me and you? We’re about to have a whole lot of fun.” So it’s like that. She can’t help the excited shiver that runs up her spine at his words, heat already starting to lick at her core. She’s known him long enough to know that when Joel is pissed at her, it can only go one of two ways. Sometimes, he’ll shut down and sulk off, keeping his distance until he’s gotten some sense back in his body to come talk to her. But other times, his anger flirts over into a jagged lust, only simmering to cool when they’re both too sore to bitch at each other anymore, a heaving tangle of sweat and pleasure. And judging by the hard flush she can see peeking out of his shirt collar as they get home, she’d put money on this being one of those other times.
The instant the front door closes behind her, he’s pressing her back up against it, swallowing her gasp as he licks into her mouth. She presses her palms into his chest to try to get some space, but he’s immovable, dragging his lips down her neck and nudging the collar of her shirt out of the way to suck searing bruises into her collarbone. She tugs harshly at his hair to get him to finally take a breath.
“Hey, hey. What about Ellie?” 
“At Dina’s.” And with those few gruff, syllables, he’s back on her, shoving his jean-clad thigh between her legs and pressing up hard into her core, her hips immediately grinding down to seek any kind of relief to the quick-building heat blooming up her spine. 
“You’re something else, you know that? Saw you acting so tough, so cool down at the bar.” His words are a smear across her chest as he works the buttons of her shirt open, dipping down to mouth at the fabric of her bra the moment he gets access, her back arching up into his mouth as she lets out a long sigh of his name. He chuckles into her skin.
“None of them know how sweet you get like this, though. S’just for me, right?” She chokes on a breath as his hand wrenches down the front of her jeans, rough fingers swiping through the slick pooling between her folds. He drags his nose up her cheek as he works one, then two of his fingers into her, her knees buckling when he crooks his digits just so, her cunt clenching hard.
“Asked you a question, darlin. Who’s all this for, huh?” His fingers are pumping into her relentlessly, the squelching noise of each thrust embarrassingly lewd and loud. It’s all she can do to give him a response.
“You– it’s all for you– fuck– only for you– it’s– just you– please–” He laughs, the smug bastard, smearing a kiss to her temple as he continues to fuck her with his fingers, the heel of his palm digging just right into her clit.
“That’s right, baby. S’all for me. Think you can give me one just like this? C’mon, know you can. Be good for me. Just for me.” He doesn’t have to tell her twice, her cunt already spasming around his fingers as she lets out a broken cry, pleasure crashing over her in ebbs and flows as he fucks her through it. He finally relents when her preening whines turn into whimpers, pulling his hand away and sucking his fingers into his mouth as she slumps back against the door.
She’s a complete mess, her shirt hanging loosely off her arms, the cups of her bra shoved down to let her tits spill out, while Joel stands before her still fully clothed, a contrast that sets heat simmering in her belly all over again. She closes the gap between them this time, pressing in for a demanding kiss as she shrugs her shirt off the rest of the way, fumbling behind her back to snap the clasp of her bra open as well. Joel��s hands are on her right away, palming the swell of her tits before squeezing just harshly enough to make her gasp into his mouth, her fingers stuttering where she was working on the buttons of his shirt. He seems to get the hint, swatting her hands away from his half undone shirt and tugging it the rest of the way off by the collar. 
“I need you right now, darlin. Got me fucking aching here.” 
They’re a stumbling swirl of limbs as they fumble upstairs to their bedroom, banging into walls and slamming doors along the way. 
He gets her exactly where he wants her, on all fours at the end of the bed, and she yelps as he wrenches her jeans and panties down her thighs. She cranes her neck over her shoulder, catching a glimpse of him, his jeans rucked down just enough for him to free his cock as he fists himself over her, his other palm kneading the swell of her ass. He nudges his swollen tip through her folds and she shivers at the sensation, trying to press her hips back into him to get more of anything. Joel doesn’t seem to like that though, laying a harsh smack to her ass that makes her nearly jump out of his hold.
“Mind your manners, darlin. Don’t get greedy on me.” She huffs, trying to look back over her shoulder at him but he presses a rough palm between her shoulder blades, forcing her back to bow until she’s collapsing onto her arms, cheek smushed into the sheets. 
He presses into her with one hard thrust, his hips grinding into the plush of her ass as she lets out a broken cry.
“Fuck– always so tight for me– fucking made for me, huh?” She can’t respond to his breathless words, not with the brutal pace he’s setting, the sound of skin slapping echoing through the room as he pumps into her, his leaking tip hitting a spot inside her that has her mouth opening in a silent scream. Suddenly, he’s snaking his palm up her chest, pressing between her tits to pull her up until her back is snug against the warmth of his chest, his lips pressed hotly to the shell of her ear.
“Tell me you’re mine, darlin. Wanna hear you say it.” She lets out a low moan as his hand dips down, the rough pads of his fingers dragging across her clit. Meanwhile, he’s skirted his other palm up to her throat, curling his fingers lightly, a faint but firm pressure making her mind go hazy. 
“I’m yours– I’m all yours– please, I’m so close–” His thrusts are getting shorter, more of a deep grind up inside her that has her clenching hard around him.
“Want you to say my name when you come, darlin. Make a fucking mess– c’mon, that’s it.” It becomes too much all at once, and she finds herself letting out a panting sigh of his name as pleasure finally snaps inside her. His hands slacken where they had been holding her up and she collapses forward, resting her teary face in her arms as he fucks her through her high.
“So perfect for me, darlin– shit– just a little more, huh? Fucking close.” His hips start to stutter against hers, and she does her best to press back against him.
“Please, Joel– want it so bad– c’mon, baby, give it to me.” He lets out a low curse, pulling out and fisting himself once, twice, before he’s painting her ass with his spend. He lets out a hard breath before flopping down next to her on the bed, dragging a hand down his flushed face. She winces as she lets her legs splay out, slinking down onto her stomach. There will be bruises tomorrow, without a doubt. She crooks her face to the side to look at him, still panting, eyes scrunched closed.
“Feel better now?” He cracks one eye open, glancing at her before fully turning on his side to steal a kiss from her lips.
“Fucking menace. Yes, I feel better now.” With that, he flops onto his back again, crossing his arms behind his head. She shimmies over to rest her head on his chest, her chin propped up on his sternum so she can look at him. 
“You better get me cleaned up, Miller. Made a damn mess.” He huffs, bringing one hand down and smacking the curve of her ass, making her yelp in surprise. She tries to kiss away the all too smug grin on his face, but it’s still there when she pulls back.
“I will. But first, I gotta know. Where the hell did you learn to play pool like that?” She lets out an exasperated laugh at that.
“Come with me to the bar next Friday night and I’ll tell you.” A low grumble resounds through his chest, but he’s still smiling as he shakes his head at her.
“You’re on, darlin. I should warn you though. I’m gonna whoop your ass.”
“Looking forward to it, Miller.”
3K notes · View notes
pinkanonwrites · 2 months
Note
Leona getting locked out of his dorm on a rainy day or Ultra Magnus reprimanding Rodimus for his seventh missing report that was due orns ago
I went with Leona getting locked out of his room on a rainy day because, well, it was really funny to me!
Tumblr media
"I'm home!.....? Hi, 'boyfriend who doesn't live here.'"
Leona lifted his head up from the living room sofa, blinking sleepily at you. You forced the front door shut with your foot, shifting your weight to heft the grocery bags further up your hips and keep everything from crashing to the floor.
"Put those on the kitchen table, Ruggie'll take care of them."
"And why, pray tell, is Ruggie also in my house?"
"Who do you think picked the lock?"
"Touché." Making your way to the kitchen, you found Ruggie standing in front of your stove, wearing your apron, frying your fancy ham that you bought only for your favorite sandwiches. He perked up as you entered, nearly pouncing upon your groceries the moment you set them down.
"Finally! Yer out of eggs, y'know."
"Hey 'boyfriend's gofer who also doesn't live here.' What the hell are you two doing in Ramshackle? And why are you eating my food?"
"Relaaaaax! Just ask Leona about it, he'll pay you back." He seamlessly cracked two eggs in one hand, dropping them into a second pan on the stovetop and chucking the shells in the trash. "One of the first-years went home for winter break, and his little sister had..." Ruggie paused, a visible shudder crawling up his spine. "Fleas. Brought 'em back on accident, so now we gotta evac while the profs' smoke 'em out. Just be thankful we didn't bring half of the dorm with us. Leona wanted his 'beauty rest.'"
You made a sympathetic, yet disgusted noise in the back of your throat. "Bummer. Where's Jack?"
"Bunking with Epel for a bit. Apparently Vil already went over him with a fine-toothed comb."
You snorted at the mental image of Vil manhandling the first-year into a medicated bath. "Alright, you better make enough for four though. Maybe five, considering Grim and Leona's appetites. I'm gonna start on my homework."
"Save it." You startled as Leona appeared silently behind you, draping his weight across your shoulders. "I've had a long day. Too long. Need my stress ball for a bit." He gave you a warning squeeze.
"Am I your stress ball or your body pillow?"
"Gross."
"Zip it, Ruggie." Leona muttered, already dragging you away back to the sofa.
'Wait! Let me at least get my textbook first! Leona!"
"Well shit, looks like gravity is increasing on me. We may not even make it back. Guess we just gotta lay here."
"LEONA!"
442 notes · View notes
mamieishere · 19 days
Text
How to row a hook-up
MDNI
disclaimer : unprotected sex, quickie, doggy style, creampie, semi public, teasing, breeding kink, no name mentioned
You met him on a dating app. You liked his profile because of his blue hair. It's not common and you love someone with their own personality. He was a traveler, coming we-don't-know-where and indicated that he was around for several days.
There was no expectation, you liked some other profiles. You got some matches and started to talk with them but they weren't interesting or too weird. You gave up for the night and went to bed. Tomorrow evening your friend will arrive and the both of you will head to the most anticipated festival of the year. How exciting is it to finally being able to enjoy music lives.
When you woke up the next morning, you were anything but a portable battery, too much energy, too much happiness... too much eve everything.
You headed to the shower and had a full body wash, hair included. Summer nights were hot and humid, so much so that you needed to wash your hair daily. After getting dressed, you picked up your phone and oh! missing notifications. It was the blue haired cutie. He liked you back! FUCK!
"Hi! I'm here for a few days. I'm going to be honest, I need someone who speaks the local language... Are you in?" 4 hours ago
"Ha ~ Finally, I wasn't that honest. I have a big event this weekend and I am very stressed. It's impromptu but could you help you to reduce this tension?" 4 hours ago
"I mean in a sexual way?" 3 hours ago
"Wait... It's impossible to erase a message on this app??? Fuck it." 5 minutes ago
"You know what? Forget it, nvw. It was unsolicited." now
You laughed. He was cute and kinda strange in a way.
"Hey :) sure I'm in, even for a tension revealed thing if you want." now
You texted back without proofreading, probably because you'd cringe at your message. You tossed your phone on your bed. after all, What are the chances that he will respond now? Obviously none.
You planned to go on a self date, one of your fave thing. You put a little make, mascara and lip gloss, grab your bag stuffed with keys, wallet, a book and your flying phone. Headphones on your ears, you headed out to a cozy restaurant nearby to the hotel.
The atmosphere was hushed, the lights were subdued and the ceiling had mouldings. A perfect place to order a fancy dish and a glass of white wine in the back corner out of sight. After the waiter has taken your order and came back with your drink, you took your book and started peacefully your me-time.
A group of about ten people took the table on the right. They were loud, chaotic dressed in expensive clothing. You sighted and turn on the headphones again. You looked for your phone to play some music. While the tracks scrolled across the screen, he popped up. You jumped on your seat, hurting the table.
- "HOLLY... ", you restrained yourself from screaming and rubbing your knees. The neighbours at the table turned around with surprised looks. "My apologies", you nodded, pressed play to the first track coming and hid behind your book.
"Hello again! Thank God, I'm glad you did answer. I'm not used to dating apps, probably because I'm not allowed to. Had I say I was relieved? Haha I'm rumbling... Anyways, I'm going to dinner in a restaurant, would you like to recommend me a dish? I'm so lost... " 3 minutes ago
You laughed softly.
"Okay, it's funny because I'm in a restaurant too currently. I order a croque madame, it's a hot sandwich studded with béchamel sauce, cheese and ham plus there's a sunny side up on the top of it. It comes with a salad. So, I guess you may order this too!" now
"THANK YOU!" now
Oh the answer came very quickly this time. You left your phone on the table with the book, as the waiter came back with your dish.
Oh it was delicious... The bread was crispy outside but still soft and buttery. The egg was perfect, the ham and cheese tasty and smoked. It was heaven,all of this combined with the jazz music playing... It was orgasmic.
"I guess you gave me a good choice. It looks yummy. *one picture attached *" now
Your eyes widen once again. The picture of his dish was exactly the same than yours, the dishes, the tablecloth, everything. You raised your head and started to search around you. He was here.
*Wait... We are in the same restaurant. Oh lol, where are you?" now
You kept looking for some blue hair but failed. Was it a joke? Where was he? After 5 minutes, your message was still unread. You decided to go to the bathroom, leaving your things under the waiter supervision.
Until someone grabbed your hand and guided you to the first nearby room. You were about to scream when your kidnapper switch on the light. Blue hair. Oh.
- "Hey... hey hey hey", he whispered "I'm so sorry, I caught you by surprise. I recognized you when I entered the restaurant earlier. I wanted to give you a hand sign but as I was with my band and the staff, it was impossible. Please accept my apologies. But jeez you're beautiful. Ah sorry I'm rambling again... Hey? Hello, Earth?"
Of course you heard him but you were shut. He was stunning, his delicate face, his bobba eyes contrasted so well with his blue hair. You were subjugated.
- "Yeah? Hi...", the words fell from your mouth.
- "Are you okay? Are you shocked?" he panicked "Oh my gosh, I'm so sorry.".
You put your hand on his chest. "Are you real...?" you asked randomly. He burnt out of laughter,took your hand and swapped your fingers with his own.
- "Hello sweetheart, yes I'm real", he cooed with a chuckle. He took your chin and replaced a strand of hair out of your face. "May i kiss you?"
Wow, that was bold but not as bold as you, putting your hands on his shoulders for leverage, you reached to his mouth and put a lingering kiss on his lips. He caught you and deeper the kiss, glued his body to yours.
- "Ah princess... I want you now, can I have you now?", You looked at him and nodded. "Use your words baby. ".
- "Ha.... yes, please. Are you not afraid that someone caught us?".
He cadged you between his body and the door.
- "No, I'm not. You'll have to stay quiet if you don't want to be discovered.", He leaned to kiss you again. Both of you had a little time. His hands made their path under your shirt going for the claps of your bra. You weren't wearing a bra, oops. He broke the kiss and gave you a stern look.
- "Oh my. What do we have here?", he raised your hands with one hand while his others reached up your top, exposing your chest to the cold air, making your nipples harder than they already were. He started to leave little pecks on your neck, down to your collarbone, decorating it with purple and finally reaching to your left boob.
- "Let's start with your heart side would you?", he rolled the sensitive tip between his digits, cutting off a moan of you. He urgently put his hand on your mouth. "Stay quiet baby if you don't want to get caught".
He freed your hands which ended up on his shoulders again and licked your nipple. Your chest arched, giving him more flesh. You moaned again, silently. His other hand found a place on your hips, rubbing slow circles.
- "Touch me, please...", Your voice was almost a whisper. "May I have your fingers in me?"
It was all it took for him to snap. He got back on his feet, turned you around and lifted your skirt.
- " Oh baby wants my fingers?", he teased. "Baby wants me to finger your needy hole?"
He didn't give enough time to answer before he ripped soaking panties, stuffed you with two fingers at an incredible rough pace. You felt the first sprinkles of pleasure and he added a third one. Soft moans weren't enough, louder ones erupted from your throat as he stopped them by placing a hand on your filfy mouth.
- "I told you to stop being noisy", his action hadn't the expected effect, your creamed his hand. "Fuck that's hot. May I give you my cock sweetie, uh? Want me to fill you up? Breeding you with my seeds?".
Unable to form a coherent sentence, you gave him a "Ha... y... es fuck, gimme y-your see-seeds".
While licking his digits, he undid his pants, freeing his erected dick from the confines of his underwear. One hand came to press on your back to put your pussy on display. You felt him, rubbing his cock along your folds, teasing your entrance. You tried to push your hips back on him to finally get your dream fulifilled.
- "tsk... baby no... that's not how we ask to be fucked"
- "please, I can't... oh shit!", he penetrated you in one full stroke. He snapped his hips on yours, making the head of his penis kissed your cervix, forcefully. The pace he chose left no space for mercy. You thought you were going to cum only by being penetrated until he reached your clit only to play with it. As his pace maintained a high drive, he doodled circles on your bundle of nerves.
- "Fuck baby girl, cum... cum for me. Cum on my cock, I want to feel it", he bite your ear. Then everything became colorful. You came hard around him, squeezing your insides like never you did before. He helped by guiding you through it. The only sound remained was the lewd, squishing sound of his cock entering you again and again. He took him a few pumps before he filled you full of him.
- "hhhhaaa fuck baby, I'm bringing you to my hotel room. I can't leave you like that."
hiii, it's been a while! I hope you enjoyed this story. it was supposed to be a drabble, as usual, it's a failure 🤷🏻‍♀️
Feel free to give feedback and comments (constructive ones only!) 💕
I have to be honest, im not a big mood to write rn but I felt I needed to post this one. please be nice if you find typos or grammatical mistakes, english isn't my first language.
97 notes · View notes
pretty-idol-hell · 2 months
Text
Idol Land PriPara 10
Well... That was a lot.
Tumblr media
I figured I'd open this post the exact way the episode opened. Mario's crotch.
(I'm trying to compare this scene with anything that happened in King of Prism and having a surprisingly difficult time. I think we may have gotten a few Alexander crotch shots, but they were surprisingly rare now that I think of it. And yet, here we are in Idol Land PriPara...)
So, Mario is back in DanPri with his strawberry boxers on full display as he tries his best to overcome his embarrassment so he no longer turns into his rabbit form.
And, actually, it works. Literally flinging the crowd's chant of "deseze!" (lame) back at them, he is able to change it into IIZE!
And so, with a brainwashed Shinya and lots of bugs in tow, Mario's rampage begins.
Instead of getting brainwashed, the dark key meant fror Amamiya ends up locking him in the bathroom, though.
Tumblr media
(Which may have answered one of the most randomest questions I've had about PriPara/DanPri. Are there bathrooms? Are they gender-neutral? Yes, but no it seems.)
Mario decides to give the dark mic he found at the end of the last episode to Shinya, and he goes ham as well, launching a direct attack on PriPara as a concerned Ushimitsu ninja follows him.
Amari and SoLaMi Dressing arrive to find PriPara in shambles, with everyone feeling the brainwashing "whatever" effect of the dark keys.
Tumblr media
Mario confronts them, causing Shion and Dorothy to immediately whip out their kendo sword and okonomiyaki spatula respectively as this is war.
Amari brings out her greatest weapon, Mario's strawberry boxers, only to discover it no longer works. Mario even offers to show them before Amari quickly interjects.
Meanwhile, Shinya is confronted by Ushimitsu just outside the gates. Ushimitsu sobs and grips onto Shinya's leg as Shinya rejects him. But just as Ushimitsu is about to be consumed by the bugs, however, WITH arrives with vacuum cleaners and goat onesies to save him.
After a quick scuffle, Koyoi is able to incapacitate his former teammate as he can see his weak points... only for Ushimitsu to throw a smoke bomb and allow Shinya to escape out of habit.
Tumblr media
Ushimitsu quickly realizes what he's done but it's too late as Shinya runs off to wreak more havoc.
Meanwhile, back inside the gates, Non Sugar has joined the battle, as well as the PriPara nurses. But just as things seem like they are looking up, another threat is revealed:
Shion is dueling a copy of herself. The bugs have started replicating everyone and making dark copies!
The dark copies each threaten their originals in different ways. (Dark Dorothy just lounges around picking her nose, causing Dorothy to flip out about her image being ruined.)
Gaarmageddon-Mi is also fighting the battle in their own way, by performing a ritual outside the gates, when Gaaruru feels the bug inside her stirring again. She wanders off and runs into Mario again who recognizes the bug inside her, reminds Gaaruru of her past, and asks her to join him and return to the way she used to be.
She refuses, so Mario calls Shinya to call bugs to consume her. But Falulu suddenly appears to push Gaaruru aside at the last second and the bugs take her instead!
Mario, however, is pleased with this. Falulu is the ultimate vocal doll, the ultimate idol. Copying her would make the ultimate dark idol!
Falulu vows to protect PriPara, and agrees to challenge Dark Falulu as long as Mario agrees to leave if she wins.
Tumblr media
Mario winds up Dark Falulu for the challenge. (I don't think we've ever actually seen the crank on unawakened Falulu used before, have we?)
Mario declares the winner will be the one who completes Cyalume Change. Which is very usual to me, because Cyalume Change has never been difficult to achieve in the past? Don't we usually declare the winner by who has the most iine? Hmm???
This is the halfway point of the episode, btw.
Tumblr media
Falulu changes into her unawakened form to challenge Dark Falulu (as apparently she can do that at will?) and we get this kinda cool mirrored performance of the vintage 0-week-old.
Dark Falulu proceeds to copy everyone's Making Dramas just like Falulu once did in season one. But Falulu states what she herself learned, that you can't win that way, and awakens herself again in her original Making Drama.
Falulu Cyalume Changes and Dark Falulu is just never seen again.
So, since Falulu is the clear winner, Mario agrees to leave... the arena, He's not leaving PriPara.
Instead, Mario and Shinya escalate things even further, now hurling bugs into the SKY!
Hibiki, observing the situation from their helicopter, quickly decides Meganii is not doing enough to protect PriPara and once again takes things into their own hands.
Tumblr media
The sky is darkened, and Yui is no longer responding as Takki is frozen shut. Mirei points to the sky, where the Yumeme is swarming in bugs. Janice and the time twins rush to try and free it.
As the others try to decide what to do, a crying voice can be heard. "Amari-chaaan!!"
It's Pololo. She thought she was coming to PriPara to visit with everyone, but now she's crouched at the entrance crying in fear over what's going on.
But, determined to show Pololo that PriPara is still PriPara, Laala steps in to solve this problem like she solves every problem: A live!
SoLaMi Dressing and Gaarmageddon plus Gaaruru, Falulu, Fuwari, and Ajimi put on a repeat performance of All Idol Song Precious from the PriParis movie!
Tumblr media
This screen is shown before the performance despite several characters above not appearing in the performance because they weren't characters yet when the movie came out.
But anyway, again it seems to be working! Pololo's happiness starts to convert the bugs once more as kirakira rockets up towards the Yumeme key. A quick shot shows us that Mario isn't going to stand for that, however, and just as the girls begin their Cyalume Change...
The performance is interrupted as bugs rocket up from the manhole covers to flood the skies once more. A live feed comes up to show Mario explaining the "present" he sent them is all the bugs Laala has been collecting all this time have now been released from the cave all at once... (Wow Laala was working hard... but anyway.)
The kirakira has now been depleted to the point where even the time twins and Janice can't keep up. The key falls from the sky to crash into the fountain and Janice even turns back into a baby, falling from the sky as well to safely land into Non's arms.
Tumblr media
Shinya is celebrating their victory when he is swiftly and quietly kidnapped by Ushimitsu and WITH while everyone is distracted.
Meanwhile, Amari, who has been suffering internal conflict throughout the episode, drops to her knees as she looks upon what PriPara has become. The fallen key, Pololo's tears. It's all my fault. Why am I like this!? She thinks to herself. And, in a moment of weakness she yells out how much she hates herself, for everyone to hear.
Mario appears before her and once again invites her to join him, as they'd once planned. But, she slaps his hand away, deeply disappointing him once again.
Tumblr media
And, through tears, Amari formally challenges Mario. If he wins, he can do whatever he wants. But if she wins, he has to stay out of her sight forever.
Mario gloomily accepts.
Amari quietly apologizes to everyone, and explains that since she's the one who created him, she's the one who has to defeat him.
To be continued.
So... yeah uh, as you could imagine. I have a lot of thoughts about this episode. A lot of mixed opinions.
Idol Land PriPara has been honestly amazing and the pacing has been surprisingly good... up until now. This to me is the first and only episode so far that felt extremely rushed. But with the length of the current series as a whole, that's kind of impressive in itself.
If this were classic PriPara, several filler episodes would have taken place in between this episode and the last while Mario tried and failed to handle his embarrassment before finally succeeding and launching an attack. Considering the whole Mario turning into a rabbit thing was just introduced in the last episode only to be overcome in the next, it made me initially wonder why they bothered to introduce it at all.
Also, the whole Falulu vs. Dark Falulu thing would have been its own episode as well, and it would have been proceeded by some scenes if not a whole episode to remind us of the connection between Gaaruru and Falulu. I mean, yeah it makes total sense that Falulu would jump in to save Gaaruru like that, but anyone watching just this series wouldn't fully understand why. It kinda comes out of nowhere.
And it really felt like Falulu, who played such a huge part in this episode, barely spoke at all. Heck she's barely spoke in Idol Land at all!
So this episode was at least three episodes in one, basically. I think they could have easily just made this whole episode just around Mario launching an attack, Pololo getting scared, and the other girls trying to fix things before failing without any of the Mario rabbit/Falulu duel stuff leading up to it. Why bother?
Or so I ask myself while already knowing the answer.
The Mario rabbit thing was just too good to let go. The Falulu duel was too good to let go. This was all stuff they planned out long in advance, perhaps before they knew the series was going to be this short, and they were too good to let go. So they made it work. Sort of.
And honestly. I appreciate that.
That shows love. That shows people who really care about PriPara, about this anime.
So at the end of the day... I liked this episode. They did the best with what they had.
All Idol Song Precious is again, a VERY special song/performance to me (actually my favorite PriPara performance of all time!) and I remembered that recently even before this episode aired while going through my old ticket binders since I found I was using the PriParis coords in some of my last games before leaving Japan. The red/white/blue one had to be collected by visiting the movie theater week after week so it's somewhat rare to have collected all of it.
(Sadly, I left before the actual song was added to the arcade though...) So, I was really happy to see it featured again! I was literally thinking wow, it's so nice to have a version of this uninterrupted by the battle that takes place during the movie when--IT WAS INTERRUPTED and they didn't even finish the song. GAAAAHHHnoooooo...
But I do understand, as far as the episode narrative goes.
And Amari yelling about how she hates herself even after all the growth she went through this season hit me right in the feels. Goddamn, she's so relatable.
And Mario. Behind all of this he's just hurt and lonely and just wants Amari to acknowledge him. So I'm sure that will come out in the next episode.
Anyway, there were no new coords in this episode so I don't know if we'll be getting an episode-based gatcha? They probably will release those PriParis coords in some way but IIRC they were all just SRs so I don't know if they would bother with a gatcha.
If anything, the next song might be morning? (Falulu's arcade song. I think it was on the Switch.)
Oh, I guess I was thinking of one of the 3DS games. I'm surprised 0-week-old is actually on the Switch. So yeah, definitely our next song.
31 notes · View notes
tinyhuman826 · 4 months
Text
Holiday Headcanons - Leon
I'm sorry this GIF is making me smile so hard bro he's such a cutie patootie
Tumblr media
Ok right off the bat Leon spoils the fuck out of his family for Christmas
He treats his mama so well he buys her flowers, jewelry, and sends her handwritten letters
He can go pretty wild with gift giving since he's got a lot of money from sponsorships and brand deals
I mentioned this is in a previous post but Hop still believes in Santa because he dresses up every year
He found Charizard wrapping paper. And since then it has been the only paper he used
Did someone say Christmas cookout??
His favorite meal is a home-cooked duck or maybe a nice smoked ham
He always helps his mom cook the food
He also takes it upon himself to bake cookies, they always end up slightly burnt but they still taste good
If you're his S/O...you lucky bastard
He pulls out all the stops
He'll take you out on a nice dinner a little before Christmas
Then he brings you home to meet his mama the week of Christmas
You all spend Christmas Eve with the entire family watching Hallmark Christmas movies on the couch
Leon loves those movies to death
Not as much as you though
He doesn't hang mistletoe, he just carries it in his pocket to hold over your head randomly during a conversation
Charizard and his team all get their own Santa hats
When he wraps gifts for everyone he always calls them his little elves
Charizard isn't that little but he's Leon's baby so according to him he is little
God imagine the two of you cuddling by the fireplace snuggling under his cape with mugs of hot chocolate
He gets so cuddly around the holidays and it's great because when it's cold he's like a portable furnace
God he's so fucking cute I cannot with this man
Buys you lots of scarves and hats and mittens to make sure you aren't cold when you two spend time in the snow
He dedicates a snowman to you
He also takes every opportunity to flirt
Making snow angels?
"Idk babe I think you're the angel here"
SCREAMING
He and Hop like to play lots of Just Dance and Mario Kart, especially with you
Hop constantly asking when he's gonna marry you lmao
His mama loves you too, she always makes you feel welcome
She even gave you a spare room for when you come visit
Leon is so fucking cute I might explode if I write more
24 notes · View notes
ashes-writing · 11 months
Text
stranger things ● forever, pt 2 ● s.harrington
Tumblr media
warnings
{ part 1 } <- can be found by clicking. everything else I've started will be updated asap. this just grabbed hold and i had to lean into it, that's why there are two updates for it in one day.
Angst, hurt comfort, internal angst (because reader/you and Steve apparently love to overthink fucking everything), baby talk (your kid is 3. she's still grasping speech.), so much dad!steve fluff omg, robin has a crush and might get the girl, (Barb. it's barb and i am fully prepared to die all alone on this hill.), small town judgment and rumors and shit ( if curious.. this has both to do with eventual Robin/Barb and also bc stevie, in my mind, looks like she could be steve's actual daughter bc drama ), huge changes to seasons 1 thru 4 (Everyone but Jason lives, Max is not in between life or death, Billy's brush with death has redeemed him.. slightly, starcourt is rebuilt, the portal to the upside down is closed PERMANENTLY), vaguely hinted at that Vecna may have mentally tortured Steve and it may have gotten in his head a little when Vecna 'attacked' his mind in my version of events for this, alcohol/smoking mentions, eventual filth (probably gonna have Steve's known breeding k*nk front and center, fwiw.), swearing, arguing, roommates trope eventually, slow burn (as slow as I can tolerate tbh ), reader has not had a very good life prior to Hawkins, ( more will come on that later trust me )
Reader/you are Robin Buckley's cousin. Reader/You was born female and you identify as female with female parts and a 3 year old daughter named Stevie and reader/you have personality + a past and backstory. This is self indulgent and I do not apologize.
word count
5302 exactly. I uh.. got carried away.
summary
“Okay, but.. For whatever reason, she’s attached to your friend. It might get annoying, Robin.” you point out after turning your attention back to the television for a few minutes and having a little more time to think about it.
Robin thinks what you’ve just said is hilarious and she’s doubled over laughing as she pauses to look at you and shake her head. “You don’t know Steve. Trust me. This will not get annoying for him. And anyway,” Robin rolls onto her stomach and looks at you, “He likes her.”
aka, the one in which Robin -and Steve also Barb watch Stevie while you try to interview for a job.
taglist + shoutouts
-- taglist is here. if you wish to be added click the bolded part to be taken to it. if you're here for eddie/gareth or other guys from ST and don't want to be tagged please let me know.
@allelitesmut
@chaoticcancer - just wait. my heart was also like ahhhh.. writing these two parts. I really hope you like this, thank you for reading!
@caravelofthesun
@dylanwritesgood
@eddiemuns0nl0ver
@just-a-blue-nerd
@music4life42
@slyisbehindyou
@spaceconveyor
@tbmunson bestie. babe. babesss. i had to do this okay? we needed it. and i proceeded to go ham. oopsies.
other links
masterlist ● steve's masterlist ● about + rules
TWO
You must've put in an application at every place imaginable all over town. It's been a week and the phone lines have been silent. You're starting to wonder if you'll get any callbacks.
"Will you relax? Someone will call, okay?" Robin speaks up from the doorway of her room. You sink down to sit on the bed. "I'm seriously having my doubts."
"They will." Robin is unwrapping a bomb pop and holding it out to Stevie. Stevie takes it and climbs up onto your lap. You grimace at her reddened shoulders from an afternoon spent in the kiddie end of Hawkins pool and she leans back against you as Robin leans forward to hit play on yet another movie Steve Harrington rented for your daughter. Tonight it's Alice in Wonderland and as the opening credits roll, you're surprised to find yourself wondering what he's doing at the moment. It's a thought quickly buried as deep as you can.
As Alice finds herself in Wonderland on the television screen, your aunt's landline rings and you slip off the couch so Stevie goes to sit in Robin's lap. Until she remembers the glittery 'picture' she drew earlier and goes to get them both because she's made one for Steve too, a little thank you for being so nice to her when she knows she might be annoying at times.
"Who's this one for?" Robin asks, looking at the squiggles, circles and squares covered in glitter and drawn in vibrant red marker beneath. The purple glitter is falling off the page, settling on Robin’s bed. 
"Steve. I make him dragon. Only he doesn't breathe fire, he breathes toasts."
Robin laughs and smiles. "I see that. I'm gonna put mine right here. On my bulletin board." She hugs Stevie again and Stevie is hugging back, playing with her hair.
"'Kay!" Stevie laughs, looking up at Robin. “I like Steve. He’s sooooo nice.”
“Oh you do, huh?” Robin laughs again. Stevie nods. 
You wander back in and Robin speaks up. “Well?”
“That was the secretary job I applied for? I’m a ‘risk’ but they’re willing to give me a shot?” you’re still a little shocked because when you applied for the secretary position at some office in town, they were literally the last stop. You didn’t think they’d even look at your application, let alone hire you. “They want me to come in for face to face interviews tomorrow.”
Then it hits you. Your aunt Janet has to work. “Shit.”
“What?”
“I can’t, Robin.. Your mom has to work.”
“And?”
“And, I can’t take Stevie. I also can’t leave her alone.” you bite your lip as you mull it over.
Robin speaks up. “I’ll take her to Family Video with me. I’ve got a shorter shift tomorrow and it’s gonna be slow as hell anyway.”
“Robin…” you eye her warily.
“I’ll take her.” Robin repeats, firmer. “It’ll be fun. Won’t it, Stevie?” Robin gazes down at Stevie. “A little help here?” she asks, fluffing Stevie’s hair. Stevie is nodding. “Please, mama? I be so good.”
“Okay, sweetie, but aunt Robin is working. You have to be a good girl.”
Robin laughs. “Relax. She’s an angel.” she looks over at you and now both of them are begging.
“Okay, alright. Fine. The second I have money again I’ll pay–” you start to tell Robin you’ll pay her but she’s already shaking her head. “You’re not. I wanted to do it.”
“Okay, but.. For whatever reason, she’s attached to your friend. It might get annoying, Robin.” you point out after turning your attention back to the television for a few minutes and having a little more time to think about it. You’re grasping at straws because you’re already seeing Stevie form a little bit of an attachment to Robin’s best friend slash co-worker and you’re just so afraid that sooner or later, the novelty is going to wear off for the guy, leaving your little girl heartbroken and missing something she’s never actually had and most likely never will.
A father.
Robin thinks what you’ve just said is hilarious and she’s doubled over laughing as she pauses to look at you and shake her head. “You don’t know Steve. Trust me. This will not get annoying for him. And anyway,” Robin rolls onto her stomach and looks at you, “He likes her.”
“Yeah. Now, in theory, when he only has to deal with her a few minutes here and a few there. A whole day with her underfoot is different.” you take a deep breath. “I’m just..”
“I get it. You don’t want Stevie to get too attached.” Robin mumbles quietly, nodding in agreement. “You need the job, right?”
“Well, yeah, I’d like to find an apartment sooner or later. I’d like to be able to do things for Stevie..” you trail off, letting the rest of your sentence go unsaid. Because Robin knows exactly how awful your mom was now, the two of you had a really long talk recently. You finally told her everything that’s been going on, full honesty. Instead of letting her believe everything was fine like you’d done before.
Robin nods. A grim look on her face as she shakes her head. “I wish you’d told me and Mom everything way sooner.”
“I didn’t want you guys to worry.” you answer, going quiet. “Okay, alright. Don’t let her annoy him, please?” you give Robin a pleading look and Robin nods. “I’m telling you though,” she insists, “Stevie is not annoying to him. Like… not even a little.”
“Robin.” you laugh and shake your head. “He’s probably got an image or something.”
“Yeah, as a giant dingus.” Robin states, laughing. “I know what you’re thinking. Just stop overthinking already, okay? Steve Harrington is a good guy. He’s not going to treat her like dirt because she’s three.”
You blow at damp strands as they fall down into your eyes. “I just.. She’s never really like.. Attached herself to a person like this before.”
“Could have everything to do with her mommy being stingy.” Robin teases gently, laughing as she looks up at you. Stevie wanders back in with a yogurt cup and spoon. Robin reaches out, pulling her up before you even get the chance. “Guess what, sparkles?”
“Yeah?”
“Your mom finally gave in. We win. You can come to work with me tomorrow.” Robin and Stevie share a laugh and Robin takes Stevie’s spoon and takes a bite of yogurt for herself. “We can watch movies all day.”
“Yay!” Stevie claps her hands together in excitement. “Will my fwiend be there?”
Robin laughs softly. You tense up slightly. Look at your daughter with a soft smile as you warn, “Sweetie, you don’t need to bother him too much, okay?”
“Otay.” Stevie nods. But she has no intention of listening because she likes being around Steve. He’s nice. Really nice. And he gives her piggyback rides sometimes. He tells her stories about dinosaurs and some weird thing called basketball that he used to play and really likes a lot. He showed her how to tie her favorite purple sneaker earlier when he dropped off her aunt Robin after work, because her shoe was untied and he said he didn’t want her to fall on her face.
CONTINUED
The morning comes too early. And it’s off to a not so good start. You’re rushing around because you forgot to set an alarm the night before, and the button’s popped off the only ‘suitable’ shirt you own for an interview.
Stevie’s missing her shoe and she can’t find her current favorite stuffed animal, a stuffed husky that Robin won out of the claw machine outside of Big Buy when they went in to pick up groceries for your aunt Janet. So she’s upset. Robin spots the shoe and holds it up. “Aha! I knew it was in here somewhere!”
“Fank you!” Stevie throws her arms around Robin’s neck. Robin grabs the hair brush from her dresser and motions for Stevie to sit in front of her. You laugh. “She’s tender-headed.” you warn as you flip over your own hair and try to make something out of the wild and thick mess of curls you have going on now, no thanks to your old reliable blow dryer quitting earlier. You’re in the midst of scrunching your hair to create a more defined curl pattern when Stevie wanders over, bending down to look up at you through a curtain of hair. “Mama! Mama, your skirt dirty.”
“Shit.” you say it without stopping to think and just as Stevie looks as if she’ll repeat it, you tack on quickly, “Mommy didn’t mean t’ say that, cupcake. You’re still a baby. That’s an adult word.”
“I know.” Stevie answers, giggling. “It sound funny.”
“It’s not, though.” you smile at your daughter and laugh softly. “You’ll let your aunt Robin braid your hair but you won’t let me? I might cry.”
“Don’t, mama. It’s just aunt Wobin do it better!”
You pout a little, flipping your hair over to stand and look in the mirror. Robin notices the stain on your skirt too and nods to your aunt’s room across the hall. “My mom’s got a suit or something? I think?”
You nod. After digging through your suitcase, you happen to find a modest -and totally shapeless, t shirt style black dress, you grab that and rush down the hall into the bathroom of the trailer to change. 
“This looks like I’m wearing a trash bag. If I wind up working at this place I’m gonna have to get dressier stuff.” you wrinkle your nose at the thought. Because it’s money you don’t want to have to spend, but if you could luck into getting this secretary job, you’d be thrilled because it’ll be more money than you’ve ever made at once before.
And the job actually has insurance.
Robin’s friend Barb pulls to a stop outside and Robin’s giddy, laughing and smiling as if she could float. She drops a quick kiss to Stevie’s head and hugs you, lingering in the doorway. “I’ll see you in a little bit!”
You laugh and nod. “Yeah!”
After Robin’s gone, you scramble some eggs and squeeze an orange to make some juice for Stevie and as she eats ketchup covered scrambled eggs and a piece of fried ham, you try to finish getting ready.
You hate the shapeless dress, it’s one of your least favorite articles of clothing and even adding a belt to it doesn’t do anything to make it look better. You laugh at yourself in your cousin’s full length mirror on the back of her closet door and you toss the belt at your open suitcase on the bed. “Just get it over with. You’re probably not getting the job anyway, they said you were a risk to hire.”
Stevie’s sitting on the floor watching you. “We go, mama?”
“Yeah, we should get going,cupcake. Turn off the tv.”
Stevie pushes the button to turn off the television atop the dresser at the foot of Robin’s bed and you scoop her up,carrying her out. As the two of you walk out of the trailer, the girl with red hair is outside skateboarding again.
Stevie gives her a wave and the redhead waves back, quick to turn back to her skateboarding. The muscular blond with the mullet is leaned in the open door again, you can feel him staring. When he grins at you, cigarette smoke billowing out of his mouth, you manage a stiff wave and turn your attention to getting Stevie fastened into her car seat.
It’s a hard pass on the guy for you. He’s exactly the type of guy who fathered Stevie when you were 17. You are not going down that road again. And as you slip into the driver seat, a thought pops up out of nowhere. Surprises you a little when it does.
,, he’s not as handsome as Steve Harrington, either.” and as soon as this thought rises, you’re quick to shove it back down.
He’s definitely not an option.. You know, if you were even considering anything. The last thing any guy your age is going to want is to get a package deal and you’re just not willing to settle for anybody who won’t love and cherish your little girl as much as you do.
As you drive into town, you hum along with the radio, watch as the tree lined blacktop turns to buildings and houses. You pull to a stop in the parking lot of Family Video right around the same time that Robin and her friend Barb are pulling to a stop. You watch as Barb leans in closer to your cousin and you smile softly to yourself.
Robin mentioned someone in her letters around Valentines Day. You’re wondering if Barb might be the girl she mentioned. You hope so, because the way Barb looks at your cousin when she’s not looking is the sweetest thing you’ve ever seen with your own eyes, hands down. Robin spots you as the two pull away from their super close conversation and she grins brightly, waving.
As Robin and Barb wander over, Stevie’s already grumbling as she fusses with the way her upper harness in the seat likes to hang up. “I just wanna get out! Stupit buckle.” as she fumes and keeps trying to work with it, you lean over and unfasten it. Gently caressing her chubby little cheeks as you look into big brown eyes. “Mama will be back later to get you, alright? Be a good girl for aunt Robin.” you go quiet, adding a second later, “And don’t bother Steve so much when he’s working, please?”
“But mama..”
“Stevie Robin..” you using her first and middle name has the  desired effect, but she’s pouting and not happy about it. “Otay! I try not to bother him! But if he wants t’ play, I not stop him.”
You laugh softly and press a kiss to her hairline. As Robin opens the door and scoops up Stevie, she’s laughing. “Ready for a big adventure, sparkles?”
“Uh-huh!” she laughs and smiles, hugging against Robin. One of her braids is already trying to come undone. You smile at Barb. She smiles back as she reaches for the old backpack you use to keep everything Stevie needs inside when you have to leave her with sitters and you fight down the usual guilt that comes rushing up when you’re thinking about just how well used that backpack is by now and how it means you hardly get to spend any time with your daughter like you always dreamed you would when you were little.
The time your own mother refused to spend with you.. Unless, of course, she took you along with her to try and ply single men by playing the single mom who needs sooooo much help card. 
“She’ll be fine, ___.” Robin’s gentle teasing and the reassuring grin she gives you has you nodding. Smiling at her even though leaving Stevie with them while you go off for an interview is the last thing you want to be doing.
You’d rather be spending all day with your little girl. Making a blanket fort in the living room of your house. Making crustless peanut butter and jelly sandwiches as you both lie around, you reading her book of Grimms fairytales to her. Cuddling. Until the man you love comes in from work, where you’d have a nice home cooked meal, not something frozen or canned or even burned beyond recognition.. The life you didn’t have and always longed for as a kid.
,, you really need to accept the fact that this is your reality. Unless you want to turn into her, parading an endless string of faceless and nameless ‘uncles’ in and out of your life, always leaving you hurt and confused when they were gone and she was mean and bitter all over again.” the thought comes and you shove it out.
You watch as the three of them disappear into the video store, door banging shut behind them. And then you put your car into drive and pull out, merging with traffic. Journey is playing on the radio so you hum along and you hope it’ll distract you from a full to bursting mind. You’re just focused on doing your absolute best at this interview. Because you have to get money coming in somehow.
CONTINUED
Steve’s flipping through the channels on the old tv set that sits down on the counter out of sight. His legs are reclined and he’s just.. Fighting the urge to pass out from exhaustion.
To say sleeping through a full night since March has been a struggle would be a gross understatement. It’s been literal hell on Earth for him because every time he starts to doze, he can feel the earth rumbling beneath him. The sensation of free falling and then a hard thud as he connects with solid. And then he can hear Vecna’s evil laugh all over again. The way Vecna forced him to watch his worst fears and deepest secrets play out in front of him just to torture him. He had to watch everyone move on and leave him behind. He had to watch as his parents just went on with life as normal after his ‘death’, totally unaffected. He had to hear every single dark thing he’s ever thought or felt but never given a voice to, on repeat. 
It’s not until his alarm’s going off every morning that the torment stops as Comfortably Numb starts to play and brings him rushing out, into another long day.
It was the same this morning and yet somehow, it wasn’t. Because Robin let it slip that Stevie was going to spend the day with them while you were interviewing at one of the offices in town for a secretary position. And somehow, knowing the little girl was going to be around to distract him all day just made things a little better.
She’s eating gummy bears that Robin and Barb stopped at the gas station in town to buy her as she makes her way over to him and motions for him to pick her up. “Tell me more about baske..About the game.” Stevie asks, holding out her bag of gummy bears to Steve as she smiles. “I wanna play too.”
Steve chuckles.
“Hang on, little bit.” he reaches for the remote, “Maybe there’s a warm up game on or a replay.” he flips through stations until he finds the channel he’s looking for. “That’s basketball.” he nods to a replay of an old Bulls game. “I used to play in high school.”
Stevie’s eyes fix on the television and she holds the bag out to him again. Steve takes a handful of gummy bears and pops them into his mouth as he arranges Stevie on his lap a little better. 
As this is happening, Barb nudges Robin. “I never thought I’d see this happen.”
Robin laughs softly and nods. “Me either. From what __ has told me, Stevie doesn’t meet strangers though.” she shrugs, “Does he seem off to you too lately? And it’s gotten a little more obvious since Nance and Jonathan left town.” 
“It has.” Barb admits, leaning against Robin slightly. Not enough to be obvious or invateRobin’s personal space but enough that she can feel the slight weight of the other girl and just..be close.
She wishes she could be so much closer. But she doesn’t know how to even begin telling her.
Robin feels her cheeks burn at the slightest hint of contact and she bites back the smallest whimper threatening to break free. She forces herself to pull together and calls out to get Steve’s attention. “Dingus, don’t get her into sports!”
“Looks fun!” Stevie is grinning and she’s turned herself to face Steve. “Open your mouth.” Steve opens his mouth as the little girl’s asked and Stevie tries to toss a bear in but she misses. The blue gummy bear settles on the front of his new polo shirt and he picks it off, eating it.
The bell over the  door jingles and Robin glances over to see who it is.
“Harrington! Yo! Dude!” Billy’s calling out Steve’s name as he wanders the aisles to search for his former enemy turned friend. He finally gives up the search and stops in front of Robin and Barb. “Either of you seen Steve or do I need t’ go over and drag his broody ass outta bed again?”
“Right here, Hargrove, jesus.” Steve speaks up. Billy nearly chokes on the gum he’s chewing as he sees Steve sitting behind the counter with the cute little 3 year old daughter of the hot mom living across from him and his stepsister and her mom in Forest Hills. “You stealin kids now, Harrington?”
“I came t’ him.” Stevie sasses, leaning in against Steve just a little. Steve laughs and shrugs. Robin speaks up. “Yeah, he stole her from me! It took two hours to convince her mom I’d be able to watch her today when she went in for the interview. He’s had her since Barb and I got here.”
“You get her all the time, Robbie.”
“And? She’s my sparkles.” Robin argues back with Steve playfully. Billy chuckles. When he spots the game on tv he laughs to himself. “Girls don’t like that sh–”
“Mama said that’s adult word.” Stevie warns, giving Billy a very stern little look. Billy snickers. “It is, huh?”
“Mhm.”
Steve looks up at Billy. “She wanted to watch it, actually.”
“I did!”
“Anyway, what’d you want?”
“You’re comin with me tonight, dude. Munson’s band’s having a gig at the new bar. Told him we’d go.”
“I don’t have a choice, do I?”
“Fuck no. No you don’t, Harrington. I’ve got tomorrow off, I’m not gonna waste th’ night sober.”
Steve grumbles but shrugs. “Not like anything else is going on. Okay, fine.”
“I guess you can drive the Camaro because I’m not gonna be seen in the grandma mobile.” Billy smirks, he’s purposely being a shit now, hoping that maybe if he just keeps treating Steve like the way he treated ‘old Steve’ it’ll eventually piss Harrington enough to bring out just a little of the fight and spunk that’s been gone completely since March.
He’s really worried about Steve. He figured him out fairly easy right after he hit Hawkins their senior year. So he knows that walking out of the station with Eddie to his waiting car after everything played out in March.. Seeing the girl he wanted to be with more than anything reunite with a guy she claimed she ‘wasn’t sure about anymore’ when they looked like they’d reconnect. Billy knows this killed Steve.
And then there’s the whole Vecna thing, something Steve absolutely refuses to talk about with anyone. Even Robin, his best friend.
Billy just doesn’t want to see Steve go down the path he’s been down already.
“You loud.” Stevie mutters, giving Billy a dirty look as she leans against Steve’s chest and nods to the little television set. “We watch baske..” she gives up, “the ball game.” and Steve chuckles.
“Bas-ket-ball. C’mon, try it.”
“It’s big word! I 3.”
“And you’re really smart for 3, Stevie. C’mon, try it.” Steve coaxes.
With a little grumbling, he gets her to attempt sounding out the whole word. When she finally says it, she’s laughing and smiling, clapping chubby little hands together. “I said it! Aunt Wobin! I said it!”
Steve laughs. “You did.”
Billy snickers. “Try this one, shortstuff.. C-a-m-a-r-o.”
Stevie gives him a blank look and places a hand on her hip. “What that?”
Billy gestures to his haphazardly parked car outside the store and grins proudly. “The best car ever.”
“Uh uh! My mama’s car is best.”
Robin and Barb laugh. ��Oooh.. a three year old just burned you, Hargrove.” Barb taunts and Robin laughs, " How'd that feel, Billy?"
“Shut it, both of y." Billy grumbles. "I'll be over at 9, Harrington. You're going if I have t' drag you."
"I said I'd go. Jesus." Steve gives Billy a dirty look. The guy has gotten it in his head lately that he's gonna make it his daily goal to find ways to annoy Steve.
Billy leaves and Stevie scowls at the door before looking up at Steve. "He's loud. It scare me."
Steve smoothes a hand over her hair. "He does, huh?" he looks down at Stevie and smiles, "I'll tell him to calm down, 'kay?"
"Fank you. I gonna go to aunt Wobin now. But I come right back." Stevie slips off his lap and makes her way over, instantly picked up by Robin. As she sees the movie Gremlins, she reaches for it and Robin laughs. "Sparkles, they don't stay fluffy the whole movie."
"Why not?"
"Because someone fed them after midnight." Barb answers, laughing. "Did you get tired of watching the basketball game, bub?"
"No. Just wanted to come t' you for a while."
CONTINUED
The afternoon is dragging by for him. Hardly anyone's come in since 9 that morning and the pattern seems destined to continue. Then there's a steady drizzle from a surprise afternoon storm as the rain drops pitter patter against the stores tin sheet roofing. Robin and Barb went to get the four of them some lunch and Steve flips the sign on the door from open to closed.
Stevie is asleep in his chair at the circular desk, huddled into a jacket he kept in back in case the store got too cold. The bag of gummy bears is dangling from her fingertips and about to settle on the floor when he decides maybe she'd be more comfortable on the couch in the office besides the break room.
But he's so damn tired, the 2 to 3 hours he's been getting a night since late March, those are catching up to him. He tells himself he'll just sit there and read a magazine while she naps but it turns into him laying down too, on the opposite side of the couch. And at some point, Stevie wakes up, comes over to where he's laying and crawls onto the couch with him, laying on his chest with her little arms around his neck.
This is how they're still sleeping when Barb and Robin come back a few minutes later. Barbs the one to find them and with a finger to her lips, she gestures for Robin to come to the door of the office. Robin peers in over Barb's shoulder, smiling to herself.
"Hang on. I actually think I have my camera with me out in the car." Barb hurries out to go get the camera and Robin stands in thr doorway watching the two of them sleeping on the old leather sofa. "___ is totally wrong in thinking Stevie is going to annoy Steve and I think this is exactly what he needs right now."
After Barb takes the picture, she and Robin decide to put the fast food they picked up for Steve and Stevie into the microwave and just let them sleep.
You make your way in, a brow raised at the silence. You're still processing the fact that somehow, you impressed the office interviewing you so much that you got the job. Robin grabs your wrist and practically pulls you to the office in back so you can see the way Steve and Stevie are sleeping on the couch.
"I hope she didn't bother him all day."
"She didn't. They crashed while we went to pick up food. Steve hasn't been sleeping at all and I think Stevie playing with Will when he came in with the other kids earlier tired her right out." Robin smiles, "by the way, Steve's kids have adopted her.. well, Max, she's still warming up to her but..pretty sure if you want a sitter all you have to do is say so."
"Steve's kids?" you question, brow raised. This leads to Barb and Robin sitting you down in the little break room and as they tell you everything, from the start to what’s only just come to a close -hopefully for good, as of March, you're gaping. “You..He.. Oh my god, why did nobody stop it? Like.. they had to know, right?” you’re looking at your cousin in concern and if you thought Robin Buckley  was a badass before, you really believe it now. Because all she does is shrug it off as if it were nothing. 
"The running joke is that Steve's kind of adopted them all..because we've been through so much." Robin goes quiet. Weighing how much she can tell you without you freaking out on her. Even thinking about the insanity she’s been through the past few years is still a lot for Robin to get her own head around, let alone try explaining it to someone else. 
"Wait..back up." You're trying to process it all, from secret government science labs to these kids -and their teenage counterparts, including Steve and Robin, having to fight as if they were in a war just to save the town. Robin can see you freaking out so she explains quickly, "Billy,Dustin Eddie and Steve saw the portal close because Eddie almost didn't make it up. That nightmare is over now, thank God."
,, well, you think to yourself, now I'm really fucked when it comes to finding a reason, any reason at all to keep from getting feelings for the guy." and of course, this is quickly overruled by one thought.
He's in the prime of his life. He probably wants to enjoy that. He probably doesn't want you and all your baggage plus your daughter. And thankfully, this is just enough, for now, to keep you from letting yourself get in too deep. 
Steve wanders in with Stevie on his hip and his hair sticking up everywhere. Stevie has never liked waking up before she's ready so she's got her sour face on. Steve hasn't said a word to anybody, he possibly hasn't noticed the three of you sitting at the table in the break room or the way you're staring hard right now yet.
He heats up Stevies food and then his own and when he turns around, he finds himself being watched intently by the three of you.
You smile at your daughter. Everything Robin's just gone into detail to tell you comes rushing back and in light of it, you decide that maybe he needs this. Maybe it's okay to let her seek him out until he says otherwise.
"Did you have a nap, cupcake?"
Stevie is still yawning. Steve sits her chicken nuggets down on the table and Stevie climbs into your lap to eat them. "We did, mama! And we watched movies and this boy came and he gived me crayons!" Stevie digs in the old and faded backpack until she finds the crayons that Will gave her earlier.
You laugh softly. 
"How'd the thing..the interview go?" Steve asks, locking eyes with you as he bites into his own double cheeseburger. 
"How did that go?" Robin asks.
" I got the job. And they're willing to let me bring Stevie if I need to." You smile. 
Steve is staring. And as you smile, he feels himself smile too because there is just something beautiful, something contagious about your smile that he can't help but do it too. 
"That's great!"Robin hugs you and you both laugh. 
"I start tomorrow. I'm working in the mornings, so open to 2?" 
You're excited. Maybe everything will finally start to go better for you and your little girl.
58 notes · View notes
Text
Tumblr media
Geralt of Rivia x female reader (reader is a healer in this story)
Warnings: • accidental drug use • my inability to come up with dialogue
Summary: Geralt accidentally ingests catnip and somehow ends up confessing his feelings for you!
Author’s Note: This is an old fic from my old blog (raspberrydreamclouds). I'm reuploading all my old stuff because I really just want to build my masterlist again. I did make a bit of editing to it.
------------
A few short raps had effectively woken you up from the pleasant dream you were having. Grumbling and still under the sandman’s spell, you fumbled around for your dressing gown. Who on earth would be knocking at your cottage door at this hour? The villagers knew that if they ever needed your services they would just have to ring the bell that hung on your doorjamb.
With half a mind to lambast whoever it was who disturbed your rest, you squared your shoulders and headed for the door. The stinging insults that made its way to the tip of your tongue vanished like smoke; there standing in your doorway was none other than Geralt of Rivia, his moonlight hair a stark contrast to the sun-gold of his eyes, which were now peering down at you.
“What? Why are you here?” you grunted.
A soft chuckle came out of his lips. “Did I wake you Petal? Forgive me but I need lodgings for the night.” he merely said.
Rolling your eyes, you stepped aside to let him in. You’d known Geralt for roughly five years now, first encountering him in the woods that surrounded your home. He was slumped over an oak tree, clutching a large gash on his side and his freshest kill meters away. It was an adventure to say the least of getting him to your cottage where you had tended to his wounds. Since then, he had come by whenever he was around town. Oftentimes covered in blood, monster guts and a host of injuries or sometimes it would be nights just like this, where he sought out a place to rest his weary bones and heavy heart.
Like clockwork, you move to help him out of his armour. All the while the heat of his gaze is on you, never faltering, never breaking. His hot breath tickled your cheek as you set your fingers to the buckle that held his swords to his back.
He stops you.
“That’s too heavy for you my love.”
You wished he’d stop saying things like that. You were tired of it. Of all the mind games and of him saying things that made you think that there could be something more.
“Alright. I’ll leave you to it. Goodnight, Geralt.” you said and without thinking gave him a quick peck on the lips.
-------
The morning dawned bright and cold when Geralt woke up. He found a note on the kitchen table telling him you’d gone to check on patients at the village and that he was welcome to help himself to your larder.
Geralt fixed himself a breakfast of smoked ham and bread as he thinks back to last night. You had kissed him. There was always chemistry between you two, that he knew for certain, but he didn’t want to overstep any boundaries. You and he fell into an easy friendship though more often than not you did things for him that a lover would normally do for their significant other.
But as the years bled into one another, he often found himself thinking of you and your home in the woods, of the cheerful fire crackling in your hearth, of your kind hands and of the patience in your voice. How worry and concern would mar your features when he came to your doorstep, half-dead from wounds and exhaustion. How he searches for you in every woman that he meets.
He tried not to dwell on his thoughts. You deserved someone who would stay and he knew he couldn’t give it to you much as he would love to, so he buried his feelings and kept silent.
Sighing, Geralt picked his bags from the floor where it rested and made his way to your well-stocked medicine cabinet. Organized and labeled, the cabinet had a wide array of herbs and medicinal plants that he was always welcome to use.
-------
“Geralt?”
Geralt was on the floor of your cottage hunched over like a nautilus in the sea.
Is he…? He’s purring. Like a content housecat that’s found a patch of sunlight to snooze in.
Kneeling down his hunched form, you coaxed him to lie on his back.
“What happened?”
He mimes grinding something on a mortar. “Mint.” is all he says.
Looking around, you see a discarded mortar and pestle, scattered vials and what looked to be like an empty satchel of catmint.
Oh no, no, no. This wasn’t good. It seems like Geralt had used the entire stock of catmint.
“Petal? Look!” he hooted. You turned to see him following what looked like lint floating around in front of him.
You needed to check if the catmint hadn’t done any serious damage. And after what seemed like an hour of pleading and wheedling, you managed to make him walk to your room and he plopped himself once again on the floor.
“Wouldn’t you like to lie down on the bed love? Its softer see?” you coaxed him, taking his hand and letting him feel the goose down pillows. “Hmm...” and promptly mushes his face into the pillow. Biting back a giggle, you help him settle on the bed. You still needed to check if he was really alright.
“Geralt, love. Lie still for me please. Can you do that for me? Let me have a look at you and then you can sleep. ” you huff, pushing his hair out of his face. An inquisitive “mrrp?” comes rumbling out of him and you notice that his pupils are blown wide; black eclipsing his citrine eyes and then very quickly switch to narrow slits. He does this several times with an occasional “mrrow” thrown into the mix.
“Does Petal…love Geralt?” he asks, so quietly.
Your stomach did somersaults.
There was always something between you and him – a sort of pull – but neither of you had ever acted upon it. Instead choosing to maintain a respectable distance and cultivate a friendship, one that had blossomed over cups brimming with blackberry wine and bellies aching with laughter. Yet you found that your feelings for him bloomed into something infinitely more and each visit from him left you bereft.
“Oh, Geralt you won’t remember all of this by tomorrow. Sleep.” you said getting up from the bed but his hand juts out to stop you.
A rumbling sound comes out if him.
“What’s that love?”                   
“Geralt wants Petal to stay.”
“Okay.” and sat down beside him.            
Geralt placed his head on your lap, nose nuzzling the fabric of your dress.
“Does Petal… does Petal not love Geralt?” he asks. “Petal, afraid of me?”
A rush of emotions glimmered in the honey-mead of his eyes.
Your heart breaks. Such high walls Geralt has built, for people so often accuse him of being incapable of feeling anything that they do not see the breadth of his kindness and the depth of his love.
Your hand cups his cheek and he leans against it.  “Petal does love Geralt” you answered. You kiss him to soothe his fears and you’re rewarded with a smile.
“This means I can kiss you lots right Petal?” Geralt mumbles, like a shy boy whose known love only in dreams. A giggle escapes your lips. He really was out of it.
“You’ll be m’wife right Petal?” slurring his words together. “You’ll marry me?” “Petal?” he pouts at the lack of response from you. “Petal!” he hollers. You like it, you think. You’d like to hear him say the nickname he’s given you all those years ago for the rest of your days.
Ever so patient, you wait as he stumbles through his words.  “Didn’ answer…question.” he says.
Pushing a hand through his snowy hair, you lean forward to peck his cheek. “Yes, my love. I’ll marry you.” and he answers with a loopy smile.
“Petal…Will you -” he pats the space next to him.
You slip into the bed and lay your palms flat against the broad expanse of his chest. He grips you so tight, scared you’ll vanish into the night like a ghost, folds himself and slips into your bosom, yielding to your love as all things yield to the stillness and rest of night.
227 notes · View notes
jerzwriter · 10 months
Note
Here’s a food for thought in regards to your dirty secrets which are NOW out in the open:
You’re the fakest fucking bitch ever in Tumblr to ever exist along with your precious Jamespotterthefirst and your little crew. You love to bully others who don’t write Open Heart fanfiction but yet you bully others who write “Laws of Attraction” fan fiction and hate on the book. By the way, @flowernewsqueen is the “Queen of Laws of Attraction” skills and she’s much more better than you. Do not act like you don’t know her because she’s a gem in the fandom over on instagram. So go fuck yourself for talking shit about her and anyone else who loves the book.
You ruined everything with the characters of Ethan Ramsey and Tobias. Get help you fucking cunt.
Tumblr media
Uh... Nonny... sweet, sweet Nonny... you may want to have your meds adjusted. No shame in that game, really. I do it when needed, and I suggest you should too. Trust me.
This is my face at the moment because:
a) I bully those who don't write OH? Uhm. OK. I actually write for stories other than OH and want to expand on that... and I spend an insane amount of time running CFWC to support all Choices creators. But you listen to those voices in your head, boo. Like - what do you do to support anyone else in the fandom? Send sweet messages like this? It's unimpressive, honestly.
b) I hate Laws of Attraction? Really? That's news to me. Like, do I hate ham sandwiches too? Because that's just as fucking random. I have no issues with LOA, and even if I did, I wouldn't begrudge anyone else the right to enjoy it - much less bully them over it. Truly. Baffled.
c) I don't know the writer you refer to. I am almost never on Instagram; I only created an account there to support artists who aren't on Tumblr. Like, what kind of weed are you smoking, Nonny, and if it's that fucking good, can you share it with the rest of the class? Don't be stingy.
Babydoll, I'm here trying to determine if you have really bad sources if you were dropped on your head, or both... because you're buggin'. If attention was your goal - well - I apologize for giving you any. You won't get any more...but I decided not to delete this because it is just SO FUCKING RANDOM and I'm in my Reputation era - so I don't give a fuck.
Oh, and being fake? Bitch. Call me a bitch. Call me crazy. Call me whatever you like. Opinions are like assholes, we all have one, and the majority of them stink. But fake? I'm me in all my ridiculousness and proud of it. I parade my crazy out on the front porch and serve it sweet tea in plain view - hope it provides a little entertainment. I'm not some pretentious little c*nt trying to act like something I'm not. Mirror, sweetheart - get to a mirror. Fast.
You must be really bored or need a new hobby. Go outside, man. See a movie. Attend a concert. Visit a friend. Get Laid. Touch some grass...anything... because you're off your fucking rocker.
34 notes · View notes
bokettochild · 16 days
Note
if you were a bunny I'd hold u really gently and give u a lil hat
i would just make u a whole house out of cardboard filled with the best stuff
idk if this is weird but I just have affectionate emotions sometimes and I don't know how else to express them and I cant keep telling u to get urself a lil treat and u being like "I'm gonna have coffee!" for the end of enternity (not that I mind)
also just to catch u up I've been having the strongest hyper fixation for an au I've ever had in my life and im gonna start posting about it soon
its like a fs DND au and I have art and everything lol
also whatve u been up to?
im just waiting till the end of Ramadan so I can stuff my face with sweets
have u ever had bakhlawa because its crazy good
what type of coffee do u like btw, personally I don't drink coffee but I do like herbal mint and green teas, I love good quality juices tho
whats ur favorite food or a great comfort food for urs, for me my comfort food is either fajita or fettuccine with air fried carrots and zucchini
i honestly just like cheese and carbs with some savory
finally do u prefercold or warm sweets? My preference is generally cold sweets like ice cream or cheese cake but I also have a very soft spot for traditional sweets that have honey/semolina/flower water/date paste in them
this has been my check in and blabbing, I hope ur doing well kottie
I think being a bunny would fix me
If it helps at all, my little treat for today is chocolate raisins (my beloved) and I got two bags so I can have plenty this week!
I have been straight up existing recently. Just....chilling (resisting the urge, again, to start posting my new multi-chap before it's ready). I did get my yearly cold that will last for the next month most likely, but my urge to write is back! So I'll take that trade off!
I have not had it, but I think my dad said he's had some, made by hand! He said it was delectable :)
I like mochas, although there's a cinnamon flavored drink at the cat themed coffee shop I go to called the "Cinn Kitty" which is pretty good too! I have no clue what kind of coffee it is, just that it's hot and cinnamon-y.
I think a comfort food for me is potato soup, with a bit of cheese sprinkled on top and maybe some ham? Maybe. And you're right, cheese is the best thing ever :) (my favorite cheese is smoked cheddar)
I like warm sweets. Like, it's cold up here most of the time, so it helps me stay comfy (I run cold) but in the summer I love sweet fruity things because they're usually cooler
I hope you're doing well too!
13 notes · View notes
cobwebcorner · 1 year
Note
Hi! Which Weskennedy fanfics do you recommend?
Oh boy it's been a while since I did a fic rec post. Ask and ye shall receive!
Note: I am including WIPs on this list if, and ONLY if, what is posted already has a significant chunk of Wesker and Leon interaction. This is still a rare pair after all, and a bit of a crack ship, so pickings are slim. They may or may not be abandoned so get invested at your own risk.
The Lost Mission: Black Smoke (WIP) by saltiestofqueers
yes top of the list is a WIP but there's over 100k words in it and it's got plenty of food for you!
A classic tale of boy tracks down villain to spooky castle, villain infects boy with virus, boy unexpectedly bonds with virus and gains mysterious powers that villain needs, boy and villain now have to learn to get along in their strange situation.
This is an AU that uses a lot of RE 4 and 5 beta content to great effect, including a reworked Excella who is very compelling. But you're not here for Excella, you're here for Weskennedy! And the boys have a wonderfully complex dynamic in which both men slowly come to terms with the fact the other is more than they expected. Leon is haunted yet stubborn, and Wesker is his usual calculating and pragmatic self.
The worldbuilding and atmosphere are also excellent.
*
Wearing White Will Make the Blood Look Pretty by Madamn_Resident
Post-RE5 Wesker tracks down Chris for revenge and accidentally winds up at Leon's apartment instead. Leon takes him in and nurses him back to health because he's just too nice for his own good.
Simultaneously a goofier yet darker take on this pairing (Wesker shreds a teddy bear at one point because A Redfield Touched It HISSSSS). This Wesker is the RE 5 incarnation with all of the camp and ham that that entails, and he bounces off a world-weary yet unfailingly kind Leon in a very fun way.
Do note that the fic ends on a bit of a cliffhanger and while there is a sequel, it is unfinished. This author also has a vampire AU which is very fun (also a WIP).
*
Weskennedy Crack series by Julius_Ranch
As it says on the tin, a series of very short, mostly cracky one shots with Wesker and Leon in an established relationship getting up to shenanigans. Awful puns abound.
*
All Work and No Play by AllHailBurnoel
I would like to direct everyone who can't wait for me to write that wesker/ada/leon threesome to this fic. It's a kinky PWP oneshot with the three, and it's not actually non-con despite how the beginning reads. I'm making note of the fact that they're doing a scene because rape fic isn't my bag, personally, and I know many of my followers aren't into it either.
*
for need and want by bloodpearls
This is a short, sweet(?) oneshot in an established relationship, essentially just Wesker angsting and working through his feelings as he cuddles a sleeping Leon.
*
In the Blue Twilight by Gawains_Green_Knight
Another established relationship. This one is half character introspection and half PWP, with very well written character interaction.
*
talking in your sleep by tenenbaums
For the dead by daylight fans, here's one in that universe. Consists mostly of Leon bantering with the newest killer, and Wesker being very bad at flirting. Author has also written a follow-up to it.
*
More Sinned Against than Sinning (WIP) by Androdamos
This is the only permutation of 'Wesker abducts Leon to get back at Chris' that I would recommend. Post-RE5 Wesker is revived by a sinister organization and then trapped into working for them. He orders Leon to be abducted ostensibly for science but really because he's bored, and the two of them unexpectedly hit it off.
They raise so much hell together and it's delightful to see. Wesker is very crafty and Leon is 1000% done with this shit. There are a lot of complicated power dynamics, stubborn heads butting against each other, and reluctant heart to hearts.
This author also has other fun short pieces for the pairing.
*
Something Human (WIP) by Visceral_Poison
This is a new one that hasn't gotten very far yet, but what there is so far is very good. It's one of those Leon-actually-gets-to-be-an-RPD rookie AUs, and one of the few I would recommend, because it nails Leon's rookie characterization, letting him be a little meeker and less confidant in himself without making him unrecognizable. The shadows of his future strength and stubbornness are there and it's wonderful to see him growing more confident already. Wesker is also well done, and doesn't come off as creepy or predatory despite the age gap. Neither of these two set out to seduce the other, they just keep having meet cutes and the chemistry is irresistible.
(Your mileage may vary, of course. I personally can't stand the soft bullied baby cop Leon uwu trend that's popped up lately so it's a big relief that this fic isn't that)
58 notes · View notes
satans-helper · 4 months
Text
Reaching for Stardust - Part XVI
Tumblr media
Read Looking for Space here / Playlists / Read RFS on wattpad
Word Count: ~2800
Warnings: none:)
A/N: Thank you everyone for being patient with my posting! I'm normally very punctual but I also like to make sure I have enough future chapters written ahead of time. It's also just been a tough time lately. But I plan on getting back to more timely uploads. Hope you're enjoying <3
---
It really hit me just how big my family had become once Christmas came around, which came unbelievably quickly after Danny’s birthday passed. My own blood-family, the Kiszkas and the Wagners all blended together, crowding the Kiszkas house which was the biggest but still noticeably too small for three families bundled together. We weren’t little kids anymore–we were all adults with our own big, adult identities and voices to match, a big bunch of personality crammed into a childhood home that was beginning to feel further and further away.
I got drunk enough to not be bothered by the perpetual strangeness of my parents mingling with Josh’s–it’s not like that was an entirely novel experience, but each time the interactions began I felt the same trepidation and edginess, like my nervous system was preparing for something awful that, thankfully, never came. Everyone got one so well, so much so that I had to question if I was far drunker than I thought and seeing the world through rose colored glasses, a pair of which actually existed in Sam’s old bedroom. 
But the champagne and cocktails kept flowing, leaving me basking in a warm glow with my sweetheart. We’d all gone the silly sweater route this year, parents included, and when Josh had topped off his outfit with that adorable little penguin hat from that first Christmas we shared, my heart felt like it was going to burst and break with love. Beyond that, we were all coordinated in our itchy, glittery, ridiculous sweaters–Josh and Jake were matching in their midnight blue and silver bells, Sam and Danny in red and gold, Kirsti and I in white and green. Everyone was festive and everyone brought something to the table–literally–beginning with Jake spearheading the appetizers once again. Once I thought I couldn’t stuff myself with any more toasted bread and rich, buttery cheeses, the Kiszka parents brought out a succulent ham in tandem with my parent’s traditional roast turkey, both completed by a myriad of Wagner-made side dishes. So, by the time dessert rolled around, I felt like I really had, in Josh’s words, expanded too much to fit into my wedding dress.
But, keeping Josh’s eternal wisdom in mind, I didn’t worry. Christmas eve was easy and fun, all of us soaking in the new bonds we were forging and the old ones too. Us “kids” stole away time in the garage to smoke a bowl between meals and pound cheap beers Sam had found in the basement and I was laughing so much, enjoying myself so much, that I felt like I was in one of those cheesy Hallmark Christmas movies. Except maybe the most unorthodox one you could think of, where everyone was getting drunk and high, three of the main characters were in a band and the other two were getting married in a way that Hallmark would never capture. Our wedding would be even better than anything that had ever been on TV, I drunkenly concluded to myself. 
Still, the romance that was laden in those cheesy movies held true to my reality. Each time I passed the bowl around, lifted my drink or fork or moved in front of the fireplace made me look at my ring. Whenever I moved my hands as we sat at the table, the candlelight making the diamond and the tiny sapphires shimmer and gleam like the snow outside, and each time I looked at it, I looked at Josh next. He caught my eyes each time, face so serene and soft, and I couldn’t believe how lucky I’d gotten after all those years. Not that I was ever unlucky, but that life often felt monotonous. Never all that special. But when Josh had entered my life, it shifted entirely and suddenly “too blessed to be stressed” felt about right. My concerns about the wedding, even though it was right around the corner, were gone, at least during Christmas eve and Christmas day, when Josh and I hopped back to our blood family’s homes then back to our apartment for our own quiet time.
“For fucks’s sake,” Josh said with a laugh, gently nudging a gift bag away from the front door with his foot while we shrugged our coats off. “Our little home is just bursting with presents. What are we going to do with all of these?”
“Buy a house,” I said with a sigh, bending over to grab two more bags and move them into the living room. “Someday. Hopefully someday soon.”
“It’ll happen when it happens,” Josh assured me, helping to carry in another couple of bags. “The right one will appear before our very eyes when the time is right. Trust in the universe.”
“I always do,” I told him with a wink, then gave him a gentle jab of my elbow. “I trust you more though.” 
To be fair to all our family members, most of the gifts were totally practical and wouldn’t take up a whole lot of extra space–a new scarf for each of us, a new ugly Christmas sweater for Josh courtesy of his brothers, slippers, towels, a new set of sheets. Then there were smaller, more sentimental things, like the handwritten card Danny had given me that I immediately sat upright on top of our bedroom dresser and my favorite lighter that Sam had finally returned to me after he accidentally stole it, i.e, forgot he took it. But I knew the best gifts were being saved for last and upon returning to the living room in my comfiest pajamas, Josh was sitting on the floor in front of the coffee table, two mugs of hot chocolate sitting atop that.
I sat down beside him, immediately resting my head on his shoulder. “Don’t you wanna get into sweatpants or something?” 
“Good idea. I got distracted preparing the cocoa” Josh nudged a red envelope across the coffee table toward me as he stood up. “Open your present now, darling.”
“No, no,” I said, though I was already grabbing it and re-crossing my legs, excited–we’d agreed no “real” gifts, but anything Josh ever gave me was so real that I always felt it pierce my heart. “I’ll wait.”
“No, no, seriously,” he insisted, bending down to kiss the top of my head. “It’s sort of embarrassing to me but I know you’ll get a kick out of it.”
I watched his backside as he left. “Embarrassing? Really?” He half-turned his head to reaffirm my question and, curiosity and intrigue peaking, I decided to open the envelope. There was no card but there was one folded up piece of notebook paper, which I flattened on top of my knee and began to silently read:
Confirm ring size
Figure out proposal–where? SHE SAID YES! 
Engagement photos 
Confirm lodging
Suits
Call caterer
Cake flavor? FROSTING? what is a compote anyway...
Decide on cake design, find someone to bake the fucking thing
Work on vows–those words are just for her
Ring
Thank you cards
Reading each little line made me smile bigger and bigger. When Josh came back to the living room, I felt like my jaw was going to fall right out of my skull, I was so delirious. He looked just as happy when he met my excited gaze; he laughed and plopped down next to me, curling into my side. 
“What is this?” I asked, laughing, though it needed no explanation.
“It’s the undeniable proof of my own neuroses,” Josh told me, stealing the list back to review himself. “Tangible evidence that I worry about the same things you do.”
“You’ve never been a list man,” I noted. “This is surprising.”
“Yeah, well, I think we both know how many things go into a wedding now. It turned me into a list man.”
I held the piece of paper up into the blue and white glow of our Christmas tree lights–we never had enough space for a full tree, but we made do with a miniature one tucked into the corner of the living room. “I love it so much. I’m inclined to frame it,” I told him, and Josh laughed. I reached behind myself for the envelope I’d prepared, still waiting on the end table by the couch, and placed it in his lap. “Now yours. I gotta warn you though–it’s cheesy.”
“I like cheesy,” Josh assured me with an eager smile, tearing it open. It was the cheesiest yet one of the most important gifts I could think of, and the look on his face when he saw the picture affirmed that. “Wow. Yes! Our initials as the centerpiece in our wedding, inlaid in the same wood we fell in love around–of course!”
It was just that. Well, not a centerpiece–more like an entry piece, if there was such a term. Most of the wedding lingo still went in one ear and out the other. Whatever the proper word for the item, I’d custom ordered our initials–the exact way we’d carved them into the barn–to be engraved in a raw cut piece of wood and propped up just inside the lodge. It had ended up being just about the last wedding detail I needed to sign off on and it was the one I was most proud of. 
“The real thing is just for us,” I said, finally reaching for my hot chocolate. “You know, I’ve never told anyone else where our barn is. It really is our secret place.”
“Me either. It really is the place we fell in love too,” Josh said, tucking the photo back into the envelope. “It feels like just yesterday you texted me asking me to come look for constellations with you. I finally cracked you.”
I chuckled, licking foam from my upper lip. “The fact that you brought gummies helped.” 
“I know you sometimes, or rather, you often, worry that things won’t always be like this. You worry things won’t always be good,” Josh began, inching closer, his body warm and comforting. “And I know sometimes how I move so fast all the time makes you worry more. But things can always be like this, you know.”
There were so many ways that could be interpreted. “Like how?”
“Easy. Happy. Whole.”
“Goddamn,” I muttered, smiling just the same. “We really are in a Hallmark movie now.”
“I’m fucking serious, doll,” Josh insisted, quick hands assaulting my sides until I nearly toppled over with laughter. “We have everything we need! The last thing to make our lives complete is happening very soon.”
“I know. I’m excited. But isn’t that sort of daunting? If getting married is the final thing we need for our lives to be complete, won’t the rest of it be super boring?”
“There’s no such thing as ‘boring’ when it comes to you and me.”
I smiled again, bringing the hot chocolate back up to my lips. “Fair enough.” 
“It’s no secret that I worry too. You know why I meditate so frequently.”
I set my mug down and slid up to actually sit on the couch, reaching my hand down for Josh to follow. As he settled back next to me, leaning against my chest, I asked, “What are you most worried about now?”
“You know…” Josh said slowly, running his fingertips down my arm.
I nodded. “Yeah, same here. All of us being together throughout the holidays made me want it even more. Our family is supposed to stick together, but instead the boys are getting further and further away.” 
“They’ll always come back,” Josh mused. “That’s not the problem.”
“No. That’s reassuring. But where do we want to be, Josh? We still haven’t figured it out.”
“I’ve been waiting on the universe to guide me in that decision since I can’t decide.” He rubbed his cheek against my shoulder with a soft groan. “That’s okay, right? We’ve made so many decisions over these past few months–what’s wrong with putting aside this one for a while?”
“Nothing at all. I’m totally fine with that.”
Josh hummed and nuzzled my shoulder harder before he popped his head up and said, “24 more days.”
I blinked. “Seriously? It feels like it’s happening like, next week. January 18th sounds right around the corner from now.”
“Don’t wish all the time away. We need room to breathe.”
I laid my hand over Josh’s chest. “We really do. Speaking of–you’re still doing alright?” He’d recovered from his little bout of pneumonia nearly three weeks ago, but the worry of that, the memory of my own fear, still came back to bite at me every once in a while.
“Fit as a fiddle, my love,” Josh said, patting my hand over his heart. “Now should we watch one of those cheesy Hallmark movies that you think our lives are mirroring?”
“Yes,” I said emphatically, reaching for the remote. 
Twenty minutes into the movie, it was obvious that it didn’t quite mirror our lives–neither of us had some slightly obscure, ridiculously high-paying job that led us away from our hometown. We hadn’t had some random meet-cute in a snow-covered city square to bring us together. We certainly hadn’t said “I love you” after a week of knowing one another and we hadn’t gotten engaged that quickly either–not that those things already happened twenty minutes in, but I knew the play-by-play of these so-called films like the back of my hand.
“Another thing,” Josh chirped, stringing along the critique of the movie and the comparison of our lives to it. “We’re both better looking than these two leads. You know I don’t like to say anything negative about anyone, but they’re very average.” His head was in my lap and he looked pointedly up at me to add, “You’re a stunner.”
I tapped the tip of his nose. “You are, Joshua.”
“You are, mama.” He sat up and reached to the coffee table for the bowl of popcorn courtesy of both of our never-ending appetites. “I see why people like these movies so much despite all of their flaws. They’re whimsical. It’s the most cut and dry love story one can have, all nicely wrapped with a big bow.”
“Yeah, pretty much,” I agreed, stealing a handful of popcorn for myself. “You could make a really awesome love story into a film, Josh. I know you haven’t been working on anything like that lately but maybe someday–you know?”
“All of my films are love stories.”
“I know that. But like, you could do something like this but a thousand times better. A thousand times more real.”
Josh hummed softly, leaning against my shoulder. “I do want to create something big soon. I’ve been reading through all of our poetry for inspiration.”
“Really?” I asked brightly, flattered. 
“You know what I just thought of?” Josh asked, the words as bright as my own had been. “Our wedding vows are going to be like another collaborative poem. It’s like we’re going back to the beginning.” 
I smiled, chewing. “Oh my god,” I said after the mouthful of popcorn was gone. “You’re so right. I didn’t think of it that way but–yeah.” 
“Have you finished yours?”
“No,” I said shamelessly. I’d been keeping Josh fairly up to date on my vows, mostly about how nervous I was for them to be perfect and how scary it was to say them in front of other people, but the thought that it was just like another shared poem eased my mind. 
Josh chuckled, nuzzling his cheek against my shoulder. “Me either. But I’m so close. I wish I could have you proofread them for me but I think that would diminish the magic.”
“Have Jakey do it for you,” I encouraged, using my clean hand to fuss with Josh’s hair. “I bet he’d be happy to.”
“No. No one gets to see or hear it or see it before you do,” Josh said, so suddenly serious. That, too, was flattering. 
I stepped out onto the balcony for a brief look into the night sky before we went to bed. It was an exceptionally clear night despite the season and the lights of our complex and the town around us–above me was an endlessly deep ceiling of midnight blue, the color so rich and dark but not quite onyx yet. The moon was free of clouds, a startlingly bright white nearly full circle, the haze shimmering off its surface pink and blue, and the stars around it twinkled fiercely silver. It was perfect. 
Inspired, I had to look up what the moon phase would be on our wedding–a half-moon in Taurus. One side in shadow, the other in light, the whole celestial being radiating in Josh’s sun sign. That was even more perfect.
---
Tagging: @sparrowofrhiannon @starbuggie @lightsofthe-living-gvf @sanguinebats @gvfrry @clairesjointshurt @bizzielisteningtogreta @jjwasneverhere @gvfrry
If you’d like to be tagged in any of my fics, you can go here or DM me :)
9 notes · View notes
wolfiery · 2 months
Text
writing patterns: first lines
~~~ Rules: list the first line of your last 10 (posted) fics and see if there's a pattern!
ahh, thank you for tagging me, @emryses ! i haven't been writing much these days but this still seemed really fun and interesting to do! continuing the format steal from mona, because it also pleased my brain LOL
Arthur freezes when the sound of glass shatters. fluke [merlin | merthur]
It’s hidden here, marooned from morality. i'm at the end of the world with you [merlin | merthur]
There had a been a tunnel-like staircase to get into the basement; the wooden bar nearly felt damp from all the lingering smoke within, the brown-bagged bottles and teacups on the table were left behind with an obliviousness of impermanence. ne me quitte pas [merlin | merthur]
“I used to be the glue. The man with a plan." sandglue [ teen wolf | sterek]
Merlin's mind is groggy, but he's been here before. aiming for heaven above (an angel ain't what i need) [merlin | merthur]
Merlin sags defeatedly at the mess on the table, silver platters heaped with torn-up bread and half-eaten ham, forgotten about as the patrons inevitably gave way to drink and dance instead. i know what hands are for (and i'd like to help myself) [merlin | merthur]
There’s a heat wave in Hawkins, a vicious temperature spike in the air that’s made its way into Steve’s hair, now falling flatter than usual since not even Farah Fawcett hairspray could withstand the agony of a hundred degrees. these are the dreams we should be having [stranger things | steddie]
It's a heavy feeling when moonlight doesn't creep in through the white blinds on the window; instead a blurred streetlight does, barely illuminating the coarse, white carpet. carried my cross of shame [teen wolf | sterek]
Nick shuts his bedroom door with an utterly prolonged sigh, his hand frozen on the doorknob as he takes in the massive conversation he just had with his mum. i wanna feel them all [heartstopper | nick/charlie]
They say that she’s out of touch with her people. midnight strikes (not posted yet but i've been working on it for 2 years so it's getting a mention) [merlin | guinevere/oc & merthur]
apparently i do have some love for a semi-colon. absolutely no pressure! @insane-ohwhyfandoms @tansyuduri @idyllic-idioms @fictivecircle @lesbianlefay
4 notes · View notes
Note
As per the most recent ask game:
39 & 40?
Hey, thanks for the ask!
39. Share a snippet from a WIP
Mmmm alright thennn
“That is exactly what you should have done,” Karl says, though Peter suspects his irritation is more a facade for concern. He knows the type. He carefully doesn’t think of his scarred hands fluttering over the shoulders of a friend shorter than he; of glaring down at a gentle face split with a rueful grin; of a softer voice placating his own edge of concealed terror. “I didn’t want to,” Hobie says, like he’s convincing himself of a white lie. “It’s not his fault.”
40. If someone were to make fanart of your work, what fic or scene would you hope to see?
Oh shit uhhh I don't really have a preference? Honestly go ham, anything you want to throw my way will be received with rabid glee. Maybe something for the first cigarette scene in take a bite right out of the sky, where the dialogue "D'you ever stay out in the rain?" is said??? (I'm just a sucker for them smoking together DON'T SMOKE KIDS DON'T RISK UR LUNGS FOR HOMOEROTICISM)
Thank you so much for the ask!!! Here is the masterpost for anyone interested!!!! This was a joy to get and answer <3
3 notes · View notes
lumine-no-hikari · 1 month
Text
Dear Sephiroth: (a letter to a fictional character, because why not) #94
I am daunted.
There is a thing that I think I have to do. And doing it is gonna require me to gather up a bunch of skills that I currently do not have. I have to delve into what looks like a bunch of really complicated information before I can even begin to try. The thing has a lot of moving parts, and though I know several individual details about what it is that I wanna do, the overall shape of it continues to elude me.
…What if I do a bad job? What if I run into insurmountable obstacles? What if it takes more time than is generally acceptable?
…But is there really a such thing as an "unacceptable amount of time"? Or is that just leftover from a time in my life when nothing I could do was considered "good enough" because I could always have done it "faster" or "more efficiently"?
The notion that "smart people do things right the first time EVERY time effortlessly and without struggle" was drilled into me as well, and I know for sure that this plays a role in my feeling daunted. I don't have this bullshit expectation for other people, so I'm really not sure why I continue to carry it and impose it upon myself, knowing that it's fucken bunk.
…Whatever. It's just yet another thought habit that I'm gonna hafta change. Cuz this thing that I wanna do is IMPORTANT, and I'm not gonna get anywhere running around in circles, scared, like a headless chicken. Bok bok, muthafuckaz.
Sephiroth. Like everything else I do, every breath I take, every thing I create, every melody rendered by my voice, every delicious thing I prepare and every person in this place I help… this, too, will be for you. So that you can be happy. So that you can be safe. I expect that my letters to you might be shorter in the coming days as I work on gathering the required skills to do this thing. But please do know that I will be thinking of you, striving for you. Everything that is me, ultimately, is for you. Because I would not be here at all if it wasn't for you; I would have succumbed to the oppressive darkness of this place a long time ago.
I can't tell you what it is yet. But I do know that I'm gonna hafta ask for help. Lots of help. Because like anyone here, I have no idea what the fuck I'm doing at any given time. Most of what I do feels like useless flailing. But I guess somehow some people seem to like the shape of my flailing, so… guess I might as well keep trying things and seeing what sticks, right?
In the meantime, Br is making collard greens. You simmer it in some kind of stock (chicken, in this case) and a little bit of vinegar for a long time, alongside cooked bacon, caramelized onions and garlic, and smoked ham hocks:
Tumblr media
I've had collard greens on multiple occasions and never liked them, so admittedly, I'm a little wary about this. But then again, I also used to think that I disliked peas, asparagus, and brussels sprouts; I've discovered in the course of my living that for lots of foods, whether or not it's good is really just a matter of how it's prepared, as well as the intentions with which it's prepared. Things prepared lovingly tend to taste a lot better than things prepared begrudgingly, resentfully, or frustratedly, for whatever reason.
Thinking about it, you know what? If we have magic in my world it comes in these forms. In my world, our perceptions shape reality around us in various subtle ways that I don't really know how to articulate to you. But the way it manifests goes like this: even with the same exact ingredients and preparation, a bowl of macaroni and cheese made by a person with loving intentions tastes different (and better!) than a bowl that was made in a more detached or irritated way. And it's like that for EVERYTHING, not just food; the art made with love hits different than that which is made in a cursory way. I can't explain it; it just is. Even for observable phenomena that we don't create - they are changed by how they are perceived, in ways that I really don't know how to explain to you.
Some time has passed since writing the last paragraph. Br has made for us some basmati rice and a pan full of chicken thighs; I helped to season them! Once the rice was ready, I incorporated the drippings from the chicken thighs into the rice, and so now the rice tastes like chicken, pepper, paprika, and garlic, with a hint of salt.
Today marks the first day I've ever eaten collard greens and enjoyed them. I want a second bowl of it, and I'm going to be very sad when it's all gone. I would do just about anything if it meant I could give you a plate of what I'm having for dinner. But I can't do that, so I guess I'll settle for showing you this picture:
Tumblr media
I'll continue to implore you to stay safe and to make it through to the end of whatever it is that you're trying to do. There are delicious things you can eat that will warm both your body and your soul, and you deserve to experience them, because everyone deserves this, no matter the mistakes they've made before.
To close, I'll tell you that a very weird and, to my knowledge, seemingly impossible thing happened today as well; the others who observed it with me were also dumbstruck. Though it seems auspicious, I shan't speak on it. Though there's a part of me that wonders if you'd understand it if I did. How curious.
I love you, and I'll write again tomorrow.
Your friend, Lumine
3 notes · View notes
acaplaya-musings · 2 months
Text
Voiceplay Visuals: Little Mermaid Medley
I already knew right from the start that this was going to be a long post, but how am I only just now realizing that the video itself is like nearly 8 minutes long? Like I knew the Wicked Medley was one of Voiceplay's longer-length videos, but somehow I never realised that this video is in fact longer by 10 seconds! (I guess it's just so good that I never noticed!) God I hope I don't hit the picture limit on this one, because I have a lot to talk about, so let's begin!
Tumblr media
Bit of a far cry from the Moana Medley 3 years prior, hey? (This was released in September 2020 btw). I may be wrong, but I believe this is called "we have a bigger budget now" 😂
Right, so Eli (already doing a subtle Eyebrow Raise, might I add), is dressed as Flounder, Rachel is of course Ariel, J is repping Sebastian, Layne is Chef Louis (I think that's his name), and Geoff went freaking all-out as Ursula (aka "Geoffsula"). The hair! The necklace! The airbrushing on the skin! (Seriously that ain't just a standard layer of face/body paint, there is shading going on there!)
(Also what's up with the green wristbands which I've never really acknowledged till now?)
J and Rachel echoing the "heave ho!" bit to each other (gonna try and limit my screencap-taking just a little bit, because I'll probably end up including a ton anyway)
Tumblr media
Rachel slipped on that bracelet really smoothly, is it just me? Like girl how did you do that so easily?
Tumblr media
Love the little detail of Rachel throwing up the fork (aka "dinglehopper") and it not coming down again. No clue how they did it
(Also that is a very pretty bracelet. And cute necklace!)
Tumblr media
I wasn't exactly searching for this screencap, but I felt like I had to include it when I paused on it!
Layne "blowing bubbles" out his mouth!
Tumblr media
I love J's little dance moves here 😄
Tumblr media
Geoff on air bass again! (representing the line "the plaice play the bass")
Tumblr media
Whose idea was this? 😂 (Layne was in charge of both the arrangement and the video, I'm guessing it was him?) And then Voiceplay stuck it on a shirt and made it into merch! (And also for J's farewell party, they got him a cake that had a picture of snail!J on it!)
Tumblr media
We're about to get into my favourite part! (Also cool painting!)
Tumblr media Tumblr media
Eli and J hamming it up as Flotsam and Jetsam 😝
Tumblr media
J's face makes me laugh every time 😆
Tumblr media
Purple flames in his eyes! (Voiceplay used a very similar effect last year, on Geoff again, during the Hellfire video)
Tumblr media
Hang on what was that little move that J just did there?
Tumblr media
"This one longing to be thinner, this one wants to get the girl, and do I help them?"
Tumblr media
"Yes indeed"
(Also fun fact: the woman shown here is Rachel Evans, one third of the singing group The American Sirens, who collaborated with Geoff a year later on his cover of Mele Kalikimaka, and the man is her husband!)
Tumblr media
"They come flocking to my cauldron crying SPELLS!" "Ursula please!"
(Also shoutout to Eli for the lighting design! He always does such a fantastic job!)
Tumblr media
The colouration/tint of the lighting does really interesting things to Geoff's blueish skin colour in this video. In some shots the skin is a really vibrant colour (e.g. see a couple of the shots above), whereas in others, like this one ^ here, it almost looks close to regular skin tone.
Tumblr media
This little moment greatly pleases my drama/theatre kid heart 😁
Tumblr media
Not talking about vocals not talking about vocals not talking about vocals not talking about-
Okay but the signature bit was very cool, and definitely feels like something Voiceplay would not have been able to do back in 2017
Tumblr media
Pfft 😂
Also the lighting here is making Geoff's hair (which got coloured grey for this video) look almost blonde!
Tumblr media
Cool smoke effects!
(Also the only reason I haven't done fanart of "Geoffsula" (other than the fact that I don't wanna keep drawing him in black outfits) is that I would not be able to do the skin colouration justice here. Shoutout to Rick Underwood for the makeup!)
Tumblr media
"Sing" (sir you're not allowed to look that pretty while looking like that!)
Tumblr media
Yeah nah yeah they really went off with the effects on this one
Tumblr media
I am getting dangerously close to the image limit and I don't wanna have to split this into two posts, but Layne's whole Les Poissons bit is comedy gold and screencaps don't do it justice anyway
To quote Elizabeth Zharoff: "it takes a confident man to Seagull!" 😂
Love Rachel's awkward-yet-cute little wave at the start of Kiss The Girl (and her dancing a bit further into the song!
Tumblr media Tumblr media
Confusion(tm) 🤣
Tumblr media
Firstly, Rachel's acting is 100% on-point, and second of all, I love Geoff's evil smirk here, doubly confirming that Rachel is being Vanessa, aka Ursula in disguise!
Tumblr media
And now that "Ariel" has got her voice back, everyone else is super happy/animated, while "Ursula" is very subdued. Visual storytelling!
Tumblr media
Just managed to avoid the image limit, thank goodness! Also J pops a bubble right at the end 😁
It's hard for me to say whether this is one of Voiceplay's best medleys or not, because how can you compare it to the Boy Band Medley or Trapped or A Chance To Fly? But I will say it is very deserving of the 5.5 million views it currently sits at on YouTube. A lot of effort went into both the arrangement and the video (well done Layne!), and honestly when it comes to Disney stuff, Voiceplay never fails!
4 notes · View notes