Underrated Birds II
1, Rufous Hornero Furnarius rufus (LEAST CONCERN)
2, Razorbill Alca torda (LEAST CONCERN)
3, Barn Swallow Hirundo rustica (LEAST CONCERN)
4, Maleo Macrocephalon maleo (CRITICALLY ENDANGERED)
5, Ribbon-tailed Astrapia Astrapia mayeri (LEAST CONCERN)
If you have any recommendations of some underrated birds, let me know! Thank you to everyone who commented a handful of birds!
248 notes
·
View notes
Hey folks! Birdwatcher, that board game I illustrated and posted about nonstop during its kickstarter, is now up for preorder! If you missed the kickstarter, here’s your chance to get a copy for yourself - literally, if you like, as it includes a solo mode! Zakir, the developer, really thought of everything.
I have an early copy that we used during playtesting in the development period, and it’s super fun to play, with a variety of different modes and difficulty levels and tons of bonus cards you can use to change it up. Check it out!
314 notes
·
View notes
In the still morning when you move
toward me in sleep for love,
I dream of
an island where long-stemmed cranes,
serious weather vanes,
turn slowly on one
foot. There the dragonfly folds
his mica wings and rides
the tall reed
close as a handle. The hippo yawns,
nods to thick pythons,
slack and drowsy, who droop down
like untied sashes
from the trees. The brash
hyenas do not cackle
and run but lie with their paws
on their heads like dogs.
The lazy crow’s caw
falls like a sigh. In the field
below, the fat moles build
their dull passage with an old
instinct that needs
no light or waking; its slow beat
turns the hand in sleep
as we turn toward each other
in the ripe air of summer,
before the change of weather,
before the heavy drop
of the apples.
----
Tropics
Ellen Bryant Voigt (B.1943)
----
Graphic - Amanda Lynn
9 notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
if you request something thats in the "frequently requested" section of this post i will come to your house and pour fish oil in your AC unit
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes