#but there’s always next time

[liquidstar]

If my mom sees a significant amount of blood she gets lightheaded, and has fainted on some occasions. Once it happened when we were kids, I wasn't there to witness it but I heard the story from my dad. Basically my brothers, around 7 or 8 at the time, were playing outside while my mom was making their lunch, and she accidentally cut her finger. It wasn't anything serious, but it drew a fair bit of blood and she passed out. My dad saw this and rushed over, but he didn't really know what to do so he just sort of started slapping her to wake her up (not recommended, but he had no idea and panicked)

At that exact moment my brothers both came in from playing, and all they saw was our mom unconscious on the floor and our dad slapping her. So, like, without even saying a word to each other they both just INSTANTLY start whaling on him, like, full blown attack mode to defend our mom. Which obviously didn't help the situation, but she did wake up and everything was fine.

Now our dad says that he's actually really glad they attacked him over what they thought was going on, because it means he raised good boys. And I still think that's true, they're very good boys.

#i think about this story sometimes like yeah I'm proud of them for that too actually. good job baby brothers #they're not babies anymore of course they're turning 20 next year which is crazy #but they're still the type of people who'd do something if they saw something of this sort happen for sure #respectful of women and everyone else too. they're good guys #I'm glad I ended up with them living in my house against my will for like 14 years #anyway i have no idea where i was for all this but my best guess is probably a friends house given the time period #i was always at my besties house lol #i hope she's doing well too actually. haven't spoken in forever... #bestie from greek elementary school... if you're out there... let's get muffins and fanta at the bakery across the street again someday 💜☮️

[floccinaucinihilipilificationa]

#selfie bee #good evening friends!! how are you doing! C: #I'm very very sleepy I got a new ikea office chair and I build it all myself #I think it went okay! I don't think I pulled the back screw tight enough and now the back is a bit loose #I can probably fix it but I can also ignore it for the next 18 years #thats how long the old chair held up!! in germany it could now drink vodka and drive a car!! #not at the same time that is illegal! not at the same time!! (❁´▽`❁)*✲ﾟ* #but the day is not over yet my uncle asked me for a big art quest and I do not want to disappoint #he wants a muppet tattoo and asked me to draw it #my uncle has started to get tattoos a few months ago #as far as I know he has now gotten 3 note clefs 3 stars a flower and multiple birds #he also started getting piercings but so far I managed not to know exactly where #I think tattoos are super cool (´｡･v･｡｀) I wish I had a good idea for a tattoo but the last time I was very sure about getting a tattoo #it was heath ledgers face as the joker #at that point I was 12 and would not see the actual movie for two more years #a muppet tattoo is a way better idea!! he asked for the count van count! that is also one of my top 3 muppets ₍՞◌′ᵕ‵ू◌₎♡ #I always thought I knew a lot about muppet lore but since I started looking up muppet pictures I think there are still a lot of secrets #can the muppets from the Sesame Street actually leave the Sesame Street? #I think Kermit is both on the Muppet Show and on Sesame Street but he is also like the boss muppet #he might have special abilities #I hope you're having a good day friends!! C: #I think I'll post a Sherlock comic later this week #miss you!! ♥♥♥

[crumb-crumblet-s-crumbington]

uagauauaaaagaauagauauga

#denki kaminari #hanta sero #kamisero #mha #bnha #rewatchjing the show #they like #dont even have any scenes together #HELLP #like #idk where 14 year old me got anything from #like yeha they r always standing next to each other but sero has so little screen time he doesnt even do anything 😭 #crumb cuptoast forever doomed to always like characters who r sidelined

[attleboy]

sorry for making them so miserable lately.... here i can still be nice to them see!!??!!!

big fan of the seamstress ragatha headcanon so here's some buttonblossom with it <3

#i love the hc that pomni has no clue how to dress so its like comfy solid color tshirts and hoodies #and ragatha let her pick but if she had her way pomni would've been dolled up like crazy... oh well... there's always next time #(very unsubtly setting myself up for a pomni in cute clothes post) #buttonblossom #the amazing digital circus #tadc #pomni x ragatha #ragapom #pomni #ragatha #my art

[quarks-pussy]

Remade this post of mine

#and this time i actually spelled his name right 🫣 (tho in my defense it's not like canon always gets it right either lol) #noonien soong #data soong #lore soong #(it is my personal conviction lore is also fully functional. with no ulterior motives whatsoever of course) #star trek the next generation #tng #ah heck it. gonna also tag the misspelling since it's so common #noonian soong #dr soong #star trek #original posts fresh from quark's pussy

[basketobread]

a little warrior to help brighten your dashboard ⭐⚔

ive never animated something like this before so forgive me if its a bit wonky HAHA but i love drawing lil lae'zel so its okay this was really fun huehue <33 shes hugging her favorite sword!!!

#baldur's gate 3 #bg3 #bg3 fanart #bg3 art #baldur's gate iii #baldurs gate #baldurs gate fanart #baldurs gate 3 #lae'zel #bg3 lae'zel #lae'zel of k'liir #baldurs gate laezel #dnd #dnd art #bob the artist #dungeons and drawings #dungeons and dragons #im sorry lae'zel i wish i couldve animated u better but its ok... there is always next time!!!

[royalarchivist]

Over 6 years ago, Technoblade and Etoiles played together on United UHC. Although they never got to meet each other on the QSMP, it's nice to see that they already had some nice banter and a fun dynamic developing during the brief time they knew each other. Here are some highlights from the video where they played together!

Subscribe to Technoblade! Technoblade's United UHC video

[ Part 1 || Part 2 || Subtitle Transcript ↓ ]

-

Technoblade: Bonjour, mis amis! (Hello, my friends!) Oh god, we already have a zombie on us. No! It's targeting me 'cuz I have subs!

Etoiles: Excellent teammates.

Technoblade: Do trees spawn in these worlds?

Etoiles: [Laughing at a screenshot of Technoblade saying "deforestation has gotten pretty bad"]

Technoblade: It's gotten pretty bad, man. What is this?

Etoiles: B-bonjour.

Technoblade: Stop speakin' Chinese.

Etoiles: You're the best Skywars player, dude. That's why.

Technoblade: That doesn't mean much.

Technoblade: Oh my god, I found diamonds!

Etoiles: Oh, whoa.

Technoblade: Subscribe to Technoblade! I'm suddenly a UHC god.

Etoiles: Oh, I got diamonds too! :D

Technoblade: ...Wow, way to ruin my moment. Wow. Can I just have this one moment?

Etoiles: Yeah.

Technoblade: Does everything- does everything need to be a competition? First diamonds I've ever mined in Minecraft.

Etoiles: Let's redo it, Techno. Let's say I don't have diamonds. I don't have diamonds, you have-

Teammate: I found diamonds!

Technoblade: Oh my god.

Technoblade: I have seven diamonds! And I'm not saying that to one-up you, but- I mean I am, but I mean I'm- I'm also tellin' the truth.

Teammate: Nobody knows which one of you guys is the mole.

Technoblade: Yeah, that's gonna be very awkward.

Etoiles: Maybe Technoblade is already-

Technoblade: I'm right behind you.

Etoiles: Technoblade is already saying to his friend-

Technoblade: I'm already in the Mole chat, plannin' your death.

Etoiles: Like, I'm kind of scared of Technoblade, actually.

Technoblade: I'm not even good, why would you be scared of me?

Etoiles: Because you're the King of Bedwars.

Technoblade: Alright, ok, ok, so here's how it works- I get paid per episode, right? So I'm not gonna betray you on Episode 2.

Etoiles: [Laughs]

Technoblade: Now let me enchant.

Etoiles: I'm so bad at hearing sound because when I'm hearing lava-

Technoblade: Nah, it's 'cuz the sounds are in French, isn't it?

Etoiles: [Laughs] I'm gonna kill you, bro.

Technoblade: No!

Etoiles: [Laughs] I'm gonna kill you.

#Technoblade #Etoiles #QSMP #Untitled UHC #Edited #I'll have to upload the next part tomorrow #I decided to add subtitles and that always takes a little bit longer #If it sounds like there's a mic echo it's because there IS a mic echo in the original audio #As always if you have a hard time reading the subtitles please let me know! Happy to adjust the font for the next iteration #been using this one for a hot minute but might switch it up sometime if I find something better #Subtitles #I'll upload the rest tomorrow I've got a few things I gotta wrap up #Portfolio

[smoosie]

Local angry bird trying to chill like a snake

#crowley #good omens #anthony j crowley #david tennant #good omens fanart #demon #snake #fanart #good omens art #artists on tumblr #mine #my art style is totally random as always but I'm starting to get really comfy with that uneven white square background thingy haha #tho my next fanart will be on paper for suuure bc I've almost gave up one hundred times during the process of that full digital painting ug

[umbrvx]

🍭

#omniscient reader's viewpoint #orv #han sooyoung #yoo sangah #sangsoo #AGHHHH FINALLY FINISHED A WIP [tearing my shirt off] #was this an excuse to draw more ysa? yes. Also.yuri #lesbian oomf in progress commentary on this was: 1 giving detailed input on what color ysas manicure should be #and 2 others requesting she have 2 nails be short next time LOLL #‘how does she have a manicure in the apocalypse’ by being a cuntress #school has been beating my ass creatively but i need #Todraw more orv BADLY!!!!! #im always itching to draw kdj in particular but i wanna draw more girlies first bc ive been rlly wanting to #heres hoping i can have solid ideas <o>__<o> #oh side note theres 2 easter eggs in here btw LOL. not necessarily orv related easter eggs just sillies

[melimelotus]

entertaining the idea of eeveelutions as survivors of their own type. evolving when struck by lightning or caught in a fire/explosion as a way to survive

#pokemon #jolteon #flareon #art #fanart #burning #scars #scarring #eye trauma #<- sorta? just in case #skeleton #ask to tag #i didnt have time for vaporeon but id like to go back to the idea next week when i can draw again #basically eeveelutions as caught between life and death and harnessing the power of what should have killed them #to evolve and get a resistance to it #and theyre all dual type specter. #the idea is that the lightning strike that hit jolteon still resides within. the flame that burnt flareon down still consumes its body #so theyre always fighting against it. 80% of their focus/energy is devoted to that & bc of it they have poor control over their element #so they cannot deal heavy attacks. but they CAN tank any incoming attack of their own element #basically volt absorb and flash fire abilities #many thoughts to be had here #myart

[breakbleheavens]

CRUEL SUMMER The Eras Tour — São Paulo, Brazil (Night 1) | November 24, 2023

#tswiftedit #taylorswiftedit #tswiftgif #taylor swift #the eras tour #eras tour #lover #cruel summer #*mine #*2023 #*gifs #mine: eras tour #mine: lover #1k #last post eras city cruel summer edit of the year ft THEE BRIDGE OF THE YEAR #haven't actually giffed the full thing in one set it was always just a part haha #the next time I gif this song it will be professionally filmed in hd FINALLY

[chiricat]

acheswan 🔥

#cat’s art #penacony #honkai star rail #hsr #hsr fanart #acheron #black swan #acheswan #it's been a while... alas #i've either been super busy or having generally less than pleasant feelings about my art ... #enough about that though #MY PROTAG NUIS CAME!!!! THEY ARE SO CUTE AND LOVELY AND SOFT #and i'm almost finished with p3re! I'M SCARED... EVERYONE ALWAYS SAYS THAT THEY WERE BAWLING AT THE ENDING SCENES #also what is wrong with ryomina. RYOJI IS SO FUNNY LIKE BRO... BRO? ARE YOU G #will i be able to ryomina or will i get paralyzed by “they're too beautiful and i could never do them justice” ... find out next time

[kaybzzart]

The farmer and people from Pelican Town :)

(part 2)

I love to fit the farmer into their environment and try to imagine how they interact with the rest of the village

(will probably do a part 2 at some point)

#Aaron (the farmer) is always there to try stuff for Emily even though it's way out of their comfort zone #Rasmodius was pretty mad at the farmer for this but he got a lot of help from them so he accepted anyway #And Shane is really just teasing the farmer all the time; but in an endearing way #i really enjoy the breaking bad Rasmodius doodle don't know about U #will probably do the A.S.S gang next 👀 #and Harvey of course ! :) #maybe Elliott too ? we'll see #my art #art #doodle #sdv #stardew valley #sdv farmer #sdv shane #sdv emily #sdv rasmodius #stardew #stardew valley emily #stardew valley rasmodius

[gaytedlasso]

Just a gaffer and a journalist holding hands while the assistant coach yells "WHISTLE!" at the players.

#theyyyyyy god I love them #I know Trent always has graphic tees but I was too lazy to draw that lmao #next time tho lmao #sketch.art #ted lasso #ted lasso fanart #tedependent #tedtrent #tedtrent art

[cherrirui-official]

"You know... You didn't have to take that with you."

"But I promised him I'd take him out to see the ocean one day."

#for context uhmm how do i explain this #so around a few weeks after Jd arrives Bruce is like “Hey... where are the others?” #and Jd is like “ooooh 🤪🤪 he doesnt know...” #Since at this time JD believes that the entire tribe is dead. including his brothers and grandma #so Jd has to take Bruce to the now abandoned troll tree and give him the bad news #Bruce doesnt believe it at first. even if the tree is abandoned they cant be dead? right?? they cant be #so he rushes over to their grandma's pod. thinking that theyre just in hiding and waiting for them to return #and all Bruce is able to find in the empty pod is Branch's old stuffed toy Croco #which solidifies to Bruce that everyone is dead. their friends their family. everyone #Bruce is obviously devastated by the news. he doesnt show it a lot but he doesnt take it too well #he ends up bringing Croco with him back to Vacay Island and patches Croco up #since Croco is a bit worn out due to being left in the pod for years #and since then Bruce always keeps Croco hidden in his hair. both as a memoir of his baby brother #and also a reminder of how he failed as an older brother... ouch #ofc the others arent dead. its just that now both Jd AND Bruce believe that the rest of the trolls are dead #also King Trollex is there bc i wanted to put him there. I like Trollex :] #a knee ways more bb au art i promise the next bb au art will be lighthearted #tho now im gonna work on the next violet gijinka batch bc ive been starving my friendlocke audience for too long #sorry friendlocke fans ill feed u next dw #cherris canvas #trolls #trolls band together #trolls john dory #john dory trolls #trolls bruce #bruce trolls #king trollex #beach bros au #sorry for rambling in the tags i hope u dont mind ahaha

[lilybug-02]

#sneak peek #whew this next update is taking me longer than I thought I was going to #I have a two hour time limit for my drawing app. And I don’t always draw every day. So it can be a slow process. #and I also don’t really have future pages like- up and ready to make so it’s idnfdfvdvddv it just takes me a while #I wish I had a better upload schedule rather than just like once a month. But it just kind of be like that. :( #I’m a busy college kid. I’m truly surprised. I’m even still doing this comic. I’m glad I am.