WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
a new angel has descended ⎯ ♡ !
© sylvia ♡ mira ꒱ 21 ‹𝟹 lesbian dollidol ☆◞ non-human
rentry templates ◞ layouts ◞ graphics
requests﹕ closed! ❀ inbox: 10/10 ! ❀ archives & tag
♡ whitelist꒱ i love amy , sanrio , bandori , project sekai , d4dj , the amazing digital circus , most animangas (ask) , milgram , bsd , omori , pokemon , loki , good omens , vocaloid , ask away !
♡ blacklist꒱ south park , youtubers / streamers , most of nijisanji & hololive , yandere simulator , killing stalking , most irl / live media , vivziepop , boyfriends webtoon , lore olympus , (iffy , try your luck) enstars
♡ rules꒱ welcome to my blog ! in this blog i will be doing rentry templates themed after your requests ! i will take time to do it so please don't rust me !
♡ do not interact꒱ basic dni criteria , against xenogenders / neo prns , endo systems , toxic irls (doll is okay if you are one, but please don't harass people over it , , , ) , ill think more in my sentry ᐢ..ᐢ
122 notes
·
View notes
@artists who take commissions, how do I become a great client?
As a first time (and very nervous) commission requester, I’m looking for some tips and tricks from an artist’s perspective to make the process not only easy, but fun for any artist I work with. Of course, I know it can vary from artist to artist, but it’d be nice to see if there are any faux pas as well!
I have a couple of questions too, feel free to reblog and add-on because I think it can help other potential requesters who don’t know where to start!
Finding the right artist – Is it best to only look for a style you like, or is it best to request from someone within your fandom?
Green flags – What’s a good thing to look for as a requester to look for in an artist?
No vibes, just references? – Most artists ask for references, but are pinterest boards, or photos that illustrate ‘vibes’ helpful? Or are those too confusing?
Budgets – Should budgets be mentioned upfront?
Deposits vs. upfront payments – Most artists I’ve seen have requested a full payment upfront, is it considered disrespectful to ask to pay a deposit or partial and then full upon delivery?
Feedback – What’s the best way to provide feedback? Notes directly on the image? Is there a standard for revision rounds, or is it up to each artist?
Tips – Are tips expected? What is the code of conduct, or consensus?
What do you look for in clients/projects?
Was there anything your favourite clients have done that made your experience with them more enjoyable?
I’ve also been browsing the #commissions open tag, but if your commissions are open, feel free to drop a comment in the notes ⬇️ Hopefully this post gets traction and it can be a resource for others!
22 notes
·
View notes
ARCHIE-SUNSHINE'S FAQ!
Hi!! I'm putting this together as a quick helpful post to clear stuff up regarding my inbox, because I've been getting a lot of similar questions and I want to be able to tap a sign to let people know what they gotta know without putting in so much effort!
So, here's my FAQ for my inbox!
1: What drawing software/hardware do you use? Are you a traditional only artist?
I use clip studio paint and an ancient wacom tablet that's been chugging since 2018 :] And I also do traditional art, specifically as a way to pass the time in my college classes! my preferred drawing pens are a the 0.5 POLOP Fruits Clip, the Tombow Fudenosuke Brush pen, and the Pigma MICRON Plastic Nib, and i colour with ZEBRA mildliner highlighters!
2: Is your Inbox getting my message?
Yes it is! I just usually have around 30-50 other asks in my inbox that im also working through!! If your ask was super nonspecific as well, I might have deleted it because I didn't know where to start!
3. Are you taking commissions?
Not currently!! I'm closed for commissions right now, but I DO take them, and you can buy them on my KO-FI!
4. What are your thoughts on [Insert TFP character here]/why don't you like tfp
I don't have any because I only watched half a season of that show and got bored to death! and i dislike the show because the pacing is weird, the writing is sub par, the characters bore me to death save for a few notable exceptions, the music is boring, the designs are weird and complicated, and every attempt at comedy falls flat. aka, its just not my cup of tea!
5. Will you draw/What are your thoughts on MPREG/MECHPREG
I don't like pregnancy when it involves a fetus, though I do enjoy dirty talk and scenarios surrounding breeding! I do enjoy oviposition/egg laying, but I prefer it as part of a monster fucking scenario.
6. What would you think [insert character/pairing here]'s kids would look like/what would [insert character] look like as a kid/do you think [insert couple here] would be great parents?
I don't like talking about kids or children!! and I don't like talking about couples as parents in general!
Hope this has cleared stuff up for some of you folks! I'll be adding this post to my pinned post for future reference!!
31 notes
·
View notes
yooo how are you still watching episodes of talks machina after they got removed from the channel?
hello! as mentioned in my faq post: "i am watching talks machina episodes via wayback machine, as this does not generate any additional revenue from content featuring brian wayne foster. i am very intentional about leaving him out of the content of my posts. please blacklist “talks machina” if you do not want to see posts about the show."
27 notes
·
View notes
are there any physical copies of grit available or only pdf?
buy grit here in paperback
39 notes
·
View notes
Welcome!
I'm a Brazilian Tarot reader and Oraculist just trying to make a living to pay for college and help with house expenses, I work with the following divination methods:
Tarot (Rider Waite; Osho's Zen Tarot; Tarot of the Holy Grail)
Lenormand a.k.a. Petit Lenormand ( French Cartomancy, or Gypsy Deck if you're Brazilian)
Vera Sibilla Italiana (a.k.a. Italian Cartomancy)
Elder Futhark (a.k.a. Runes)
Very sporadically I use the pendulum and radiestesy & radionic graphics as well.
My main objective with this profile is to work professionally with divination and spirituality online. If you want to know more about myself before you book a reading or service feel free to ask, I'm an open book.
As this is a professional page and not only a hobby, I plan to charge for my readings, I take payments via Paypal or PicPay (if you're in Brazil, I take payments via pix as well).
However, I also intend to serve spirituality itself, so once a week I'll answer simple questions with 6 card Lenormand readings free of charge via Tumblr's ask function.
My rates in US Dollars:
$5 - 1 card reading using Osho's Zen Tarot Deck
$5 - 3 runes reading using Elder Futhark Runes
$10 - 6 card reading using the Lenormand Deck
$10 - 3 card reading using Rider Waite's Tarot Deck
$25 - Pack of three 6 card readings using Lenormand Deck
$25 - Pack of three 3 card readings using Rider Waite's Tarot Deck
$50 - Lenormand Grand Tableau reading + 3 clarifying questions.
$60 - 1 hour of unlimited questions using your oracles of choice (from those currently avaliable) + 1 Osho's Zen Tarot card advice.
Readings can be made online (texts or videocalls if the app of choice supports it, you choose) via Tumblr Chat, Discord, WhatsApp, or delivered on a PDF via e-mail. I'll always send pictures of the cards drawn and explain everything.
Other services I offer:
$30 - Spiritual Guidance and Advice Sessions ( 1 hour sessions via Discord or Whatsapp Messenger)
$60 - Tutorial on Energetically Cleansing Spellwork (delivered via Discord, E-mail or PDF)
$120 - 30 days of Spiritual Guidance and Advice + three 6 card readings with Lenormand (via Discord or Whatsapp Messenger)
On Spellwork:
I can perform certain types of spellwork, such as:
Abundance, prosperity & wealth rituals
Self-love, self-esteem & self-respect rituals
Peace and positivity rituals
Those don't have a fixed pricing, the price is to be discussed depending on the severity of the situation, on the pricing of the required materials to perform the ritual, and on the financial situation of the client.
I may as well prescribe baths and rituals which you'd have to do yourself.
If you come to me just for the prescription of baths or rituals I just charge the symbolic value of $5 for said prescriptions; however, if you booked a reading or another service with me and I find it to be useful or necessary in your situation, I'll do it free of charge.
Onto the much necessary disclaimer:
I DON'T do binding or karmic return rituals. Do not even ask about it. It goes against my values as a light-worker. Divine justice is there for a reason.
I'm not here to rip off anyone so if you really need a certain service and can't afford it just message me about it and I'll see what I can do to help for FREE.
Most importantly: I am not a scammer, I'd rather be scammed than be seen as a scammer so you don't even need to pay upfront, I don't care to work for free if it means I'll get to help people with my cards.
Payment info:
I just want to make an honest living, if you don't want a reading at all yet want to make a difference, feel free to donate any value to either of the payment methods stated above. Thank you!
12 notes
·
View notes
Hello! Have you ever seen Cruella (the live action movie)? Could you possibly do a character profile for Artie? if you have seen it.
I haven't seen that movie sorry!
11 notes
·
View notes
do we have to pay for the request ?!
Requests are totally free, don't worry!
And you can definitely ask for other people's OCs :D
8 notes
·
View notes
In honor of @glitterypirateduck's GazFest, let's have some Gaz requests in my inbox. NSFW included. I'll try to answer as many as I can over the weekend ❤️
19 notes
·
View notes
will you ever put your townie makeover sims up for download? <3
nope
15 notes
·
View notes
One FAQ to Rule Them All...
Because I'm lazy, I'm putting all of my info in one place! General rules, resources, and answers to common questions can all be found here with appropriate links!
My Blogs
I currently have three other blogs, which are listed below!
My main Transformers blog is here! It's the one I started with and the biggest, if you would like the most comprehensive look at my writing I'd suggest starting here!
My NSFW Transformers blog is here! I started this one with the intent of doing all kinds of raunchy asks but it evolved into a transformers focused blog just because!
My Lego Monkie Kid blog is here! This one doesn't see much activity anymore, but feel free to check it out!
My Requests
So, why am I here? I got started writing requests for free, and I still do them now when my schedule permits! You can pop into my ask box whenever it's open, give me a short synopsis, and I'll write headcanons or short stories. Whether you prefer to be wordy in your request or just drop in with the bare details, I'll absolutely make it happen if inspiration hits. I do try to answer everything in my inbox eventually, but I can't guarantee it, so please don't take it personally. There are many ideas I LOVE but just don't have the spoons to answer properly!
Requests can include as many characters as you'd like, but I always reserve the right to select whichever ones work best for me.
My Commissions
If you've seen my writing and like it enough to want something more tailored to your needs, be on the lookout for when I open up commissions! My current status can be found at the top of my page!
My Rules
I like to keep things casual so I don't have many rules, but here are the essentials, please message me for any clarification.
1. I expect a basic level of decency from anyone on my page and posts, and reserve the right to block without question. Thankfully this one isn't too hard, just don't be a jerk and we'll get along, but still needs to be posted because some people can never remember to behave!
2. If you ever have any issues with anything I've posted, like wanting a tag to be introduced, please notify me through my direct messages! As a forewarning, I will not answer if your issue is related to a ship, headcanon or canon divergence in my writing. You're free to block me and move on with your day, as we both have better things to do!
3. Requests will be answered if and when I have the time and inspiration. There's no problem asking me what I am working on, but repeated inquiring will be ignored. Yes, this means it may never be answered, but unfortunately I work a full time job and just can't dedicate the hours I'd need to answer every ask. Maybe someday that will change!
4. This particular blog will have SFW and NSFW posts, so PLEASE don't follow unless you're 18+!
Common Questions
1. Do I have to pay for requests? Nope! You can leave as many as you want in my inbox, but the caveat is I get to choose which to write and when. If you want to guarantee something is written you have to commission me when I have them open.
2. What are prompts? I tend to enjoy applying the same scenario to different characters, as I find it a fantastic writing excercise, so I will develop prompts around specific situations as a kind of shorthand! The name of a prompt will usually be in the tags, but if I haven't written it in a while a link is always helpful!
3. Will you roleplay with me? I'm afraid I'm just not much into RP, sorry!
That's all for now! Thank you and have a lovely day!
9 notes
·
View notes
hi! i want to submit pedro páramo by juan rulfo please
hello! I’m currently leaning towards excluding this one, for several reasons.
first, it seems to be conventionally grouped with later magical realism, which as I’ve noted previously I don’t normally consider to be fantasy as such (this is, indeed, the point of magical realism, that it’s not really fantasy).
second, even if I did count magical realism, it also predates the full development of magical realism by Boom writers in the ’60s (though it postdates Carpentier’s real maravilloso by a few years).
it does (seem to) use fantastic elements (ghosts) as part of the narrative, but it doesn’t seem to be using them in a fantasy way — I’m thinking again about the distinction John Clute and John Grant draw between The Tempest and Faust in their Encyclopedia of Fantasy entry on “taproot texts”. it seems to me that Pedro Páramo is more in the realm of The Tempest (containing fantastic elements that nonetheless do not “govern its audience's sense of its generic nature”) than in the realm of Faust (“transforming a traditional story containing supernatural elements into a work mediated through – and in a telling sense defined by – those elements”). I don’t think it’s a perfect definition or distinction, but that’s where Pedro Páramo seems to me to fall.
having said that: I haven’t yet read Pedro Páramo, though it’s on my list, so this is based just on the Spanish and English Wikipedia articles about the novel. if you or someone else who has read it wants to elaborate on the fantastic elements and make a case for it, please do — I’m willing to be convinced!
5 notes
·
View notes
Hi! Not a request (yet!) but what all do you do? I’ve noticed moodboards, icons, but I can’t put my finger on anything else. Thank you!
I do outfit boards, custom emojis(selective), and userboxes as well!!
If there’s anything else you’d like, feel free to just ask!
6 notes
·
View notes
↳˗ˏˋ Request Guidelines ˊˎ˗ ↴
WHAT I WRITE FOR:
In short, anyone I'm obsessed with (and feel like I can write lmao) smut, fluff and angst included!
I only write smut from a female POV as I am not trans / nb / etc, and don't wish to spread misinformation or write unconvincingly. Outside of being female, none of my fics have physical descriptors.
Gender neutral requests for angst and fluff are fine! I do not write smut outright for male/trans readers (for reasons above), but I can do gender neutral smut.
This is not a definitive list and will be updated / redacted accordingly :)
CHARACTERS I WRITE FOR:
Mike Schmidt / Michael Afton
William Afton / Steve Raglan
Henry Emily
Masked! Ghostface personas - Billy, Stu, Mickey, Roman, Amber + Ethan
Unmasked! Ghostface personas - Ethan + Mickey (working on Amber ;)
Chad Meeks-Martin
OBX characters - Pope, JJ, Rafe + Barry
Derek Danforth
TOPICS I WILL NOT WRITE ABOUT:
Scatplay / Pissplay
DD/LG
Incest + Stepcest
A/B/O
R*pe / Non-Con
Anything with the real life actors
L0licon
Rimming / Anal
Beastiality
Character x character
If you're unsure, please ask in your request! Be nice, and don't expect things to be filled immediately!
14 notes
·
View notes
July Birthday Event \o/
Hey all!
I'm going to do a drabbles event for the month of July!
I have a set prompt/kink list I'm making, and you can send asks and give me a character to do a x reader drabble with.
As with everything else, it's 18+ - ageless blogs will be blocked ♥
Anon asks will not be accepted.
If you want to send your ask anonymously you MUST message me first so I can verify you're over 18 and/or that I know you.
Below the cut is a short FAQ made up of questions I have preemptively anticipated and answered for your information, and probably entertainment.
Event Starts 7/1 - don't send requests before then! I'll be accepting and writing requests THE ENTIRE MONTH. At the end of the month I'll stop accepting requests and will spend some time in August finishing up any left over requests, so be patient <3
~ FAQ ~
“You did the kinky head canons with anon on, why not now?”
~~ The Head canons were *MY* head canons. This is writing FOR people. The distinction is important to me and that’s all that matters.
“Why wasn’t my request written?”
~~ Either I haven’t gotten to it yet, or I axed it. For any reason. It’s my birthday.
“What day is your birthday?”
~~ Moon Day.
“How old are you going to be?”
~~ Statistically, given the demographics I’ve seen for this site, older than you. (42).
“I’m almost 18, and I love your writing, please accept my request!”
~~ Nope, and you shouldn’t be reading my writing if you’re that young. There’s young adult smut out there, I know I’ve read it. I recommend The Devil Does Exist (manga), and Defying Kurosaki-kun, and Sweat and Soap.
Belly Up, The Hollow Girl, The Awesome, and Gunsmoke and Glamour are also really good (and those are books and not manga). They’re by Hillary Monahan.
Also, harlequin romance novels are likely at your local library, and/or easily procured. Go, be free. (Tiffany Roberts writes for that label and has so much monster fucker stuff.)
21 notes
·
View notes