WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Ok so I have been stewing this crossover au in my brain nonstop for the past few days and. I am nothing if not committed to the bit, so. Volume cover redraws :)
Here are the originals:
If you want to read more about my one piece spy x family crossover, keep reading!
So the idea is simple! Crossover reincarnation au where ASL is reborn in Spy x Family. They’re each born separately and none of them are born with the same names as their previous lives, and with no way of finding each other, they each find their own thing to do in the world.
Sabo, too used to the dangers of being a spy, eventually finds a cause to devote himself to again, in preventing war from engulfing the country he was reborn in. Ace, drawn to fire as he was in his previous life, used arson as a means to rob rich people for sustenance and survival, and is eventually scouted and hired by Garden as a fire specialist and assassin. And Luffy, though born in perhaps the poorest condition, grows up happily and takes whatever part time jobs he wants to do.
The thing about Sabo is that, as much as he seems like a young man of good repute and high standing within society, everyone in WISE knows that he is a massive nuisance. Nobody knew in the beginning how a child less than half the age of most of their veteran agents could have the same skills and knowledge in their profession. Sabo was— and still is— hyper competent, and by the time WISE figured out just how much of a menace to society he was, it was too late.
Ace forgot for the first few years of his new life that he wasn’t made of fire, and consequently, received multiple accidental burns. This did not deter him, however, from growing up to be a very skilled arsonist, well-practiced in every which way to start a dumpster fire or house fire. As a teenage he would use this often to draw attention as he robbed rich people blind. When he was caught, he was given an ultimatum by Garden: join them and receive payment for starting fires and causing problems under contract, or face the government and authorities for his crimes. Begrudgingly, he joined Garden, but eventually comes to appreciate that he can make substantial money in his element.
Luffy is Luffy. No telepathy or experimentation, no fancy schools, no gimmicks or secret identities. But he has still lived an extremely colorful life in this world, full of fascinating and kind individuals who have helped him grow up healthy and relatively happy. He goes where he is free, and he takes whatever part time jobs he wants in order to make the minimum he needs to survive.
Ace and Sabo find each other first, in their late teens, and neither of them realize that the other remembers their previous life, but both refuse to separate. (Sabo thinks Ace doesn’t remember, because Ace didn’t recognize him. Ace never saw Sabo grow up past 10, however, so he doesn’t recognize older Sabo immediately. By the time he does realize who exactly Sabo is, Sabo has backtracked and pretends to know Ace from a dream, or from somewhere else.)
Sabo’s attachment to Ace, predictably, causes problems between Sabo and WISE, but by then, Sabo is indispensable to the organization, and they make an exception for Sabo to be able to remain with Ace, so long as Ace never finds out what Sabo’s actual job is. Ace, on the other hand, hides his job because he doesn’t want his brother, who he has just found and who does not know Ace well enough yet, to know that he makes a living from killing people.
And they find Luffy sometime afterwards, prior to the beginning of the Spy x Family canon. Luffy figures out, not long after moving in with his brothers, both of his brothers’ secret occupations and the fact that both of them remember their past memories. He thinks it is common knowledge, however, and so he never brings it up.
1K notes
·
View notes
Dp x Dc AU: Tucker gets hired by the JL to work on the Watchtower’s cybersecurity... He might have a few friends visit.
Batman looked over the application for visitors presented to him by Dr. Foley, who was nervously wringing his hands but seemed excited to talk about his two close associates, and it appeared that everything was in order for the pair to be allotted a short visitation time slot.
The paperwork was established by Batman himself after all, needing a way to permit non-members (His Children) to visit him at his office in the watchtower. Looking over Dr. Foley’s application, the invites to Dr. D. Fenton and Dr. S. Manson seemed to be somewhat warranted.
Dr. Fenton is a well known astrophysicist and Dr. Foley had been upping the security to reflect more complex physics models as the ‘lock’ mechanism for access to Watchtower servers. Dr. Manson was a more controversial figure in social justice but a biochemist to rival Dr. Pamela Isley, not to mention she was someone Bruce Wayne had met a number of times and not completely hated (though he was sure she hated him and everyone else in the gala). She was a fan favorite guest by his children and a great advocate for animal and human rights.
Batman approves the application, allowing their visitation for a few hours at a time once a week until the completion of Dr. Foley’s project.
He doesn’t hear much from it, nor from Dr. Foley, but things start to come down the rumor grapevine that the two guests were more than they seemed. Red Robin was the first to comment on it to him, and as practical and efficient Tim could be, there was a look of chaos in his smile as he discussed the two additional PhDs. He was stingy on details and that always meant something bad for Bruce’s mental health. A few others asked a few questions as to who exactly the pair were visiting, and Cyborg commented that they weren’t really doing too much to assist Dr. Foley.
Batman decides to intervene and meet these two for himself when he hears Constantine complain (not that the man wasn’t always complaining about something) about the two new magic users being way too OP for normal humans.
This is how the JL gets to become allied with Ghost King Phantom and Thorn (not Poison Ivy pt.2 as Robin insisted). Turns out they weren’t sure if the JL could be trusted with interdimensional politics, so Tucker spent the last two years gaining their trust to let Danny and Sam up here to ‘check the place out’ before they committed to becoming members.
Batman doesn’t even get to raise alarms at the espionage of it all because Red Robin has already programed their new badges and welcomed them on with open arms and a project to take down the LOA’s Lazarus Pits “safely”.
2K notes
·
View notes
bound to want (part two) /// part one
rest of pages under READ MORE after ID
[ID: 23 page digital comic of Vashwood from Trigun Maximum. The comic is in a limited palette of a dark blue, light pink, white, black, and a light beige color for Vash's skin and a mid-brown color for Wolfwood's. This comic is the second part to "Bound to Want" and is spoiler-free. The first part is linked here.
It begins with a panel close up of Vash's expressions. The sky colored in dark blue can be seen behind him. He has a neutral expression, but he holds a slight frown and the reflection of his glasses covers one side of his eyes. Wolfwood says, "Hey. What's with the distance?" In the second panel, the shot widens to show both of them, a clear physical distance separating them with Wolfwood walking ahead and Vash trailing a little behind. Vash responds, "What? I'm just walking a bit slower today..." Wolfwood looks at him with a an irritated expression, clicking his tongue. Wolfwood says, "I was going to wait for you to start... But yer just running away away."
Vash is seen looking away, unable to hold eye contact with Wolfwood as he continues, "You've been avoiding me since that night. Did ya think I wouldn't notice? It's about that dream, right? Tell me about it already if you're going to be moping like this." Vash looks slightly downwards, his brows furrowing and he starts to walk ahead of Wolfwood without looking at him and responds stiffly, "I really don't want to talk about it..." Wolfwood looks at him with a surprised expression, but doesn't probe.
A panel close up to Wolfwood's eyes as he watches Vash go on ahead before he follows suite with an irritated sigh. The panels are overlapped by Wolfwood's hand holding the bottle of the Bride with motion lines, indicating a transition in time.
A wide shot of Vash and Wolfwood in a room now. Vash is seated, his back turned away from the viewer, while Wolfwood's body faces the viewer with his eyes looking towards Vash. He rests the bottle of the Bride on the table with a "clack" and his other hand holds two shotglasses. The background is coated in a light pink.
A panel shows a close up of Wolfwood's face, his eyes looking downwards to Vash as he says, "Let's drink." Next to this panel is Vash looking up at Wolfwood, his brows furrowed and a slight frown. The bottom half of the page is a wider shot with Vash's body turned away from the viewer as he says, "I'm not going to talk about it." Wolfwood responds, "You don't have to." as he sits down.
A wide panel of Wolfwood holding the shotglass, pouring in the drink as he continues, "I'll talk." The next panel is a profile view of Wolfwood, his eyes looking down at the now filled shotglass as he continues to say, "You're..."
"... upset with me." Vash can be seen next to this speech bubble with narrowed eyes, looking towards Wolfwood. The panels are all coated in with a dark blue background. Wolfwood continues, "I can't be certain why since yer not telling me a thing -- but it's probably... my bad." The panels show Wolfwood about to bring the shotglass to his mouth but he turns way as he continued to speak, his eyes not on Vash. The bottom page shows him looking away completely with a guilty expression as he says, "I'm sorry.
If you can ever tell me why, I can try and adjust to make it more bearable. But if you're just trying to get rid of me--" The panels follow Wolfwood's certain expression as he says this, "I don't intend to leave you. I can't... and I won't." A panel shows Vash's wide-eyed expression, surprised upon hearing this, and then his eyes soften as Wolfwood again concludes with, "I'm sorry."
Vash's inner thoughts begins, a boxed speech at the center of the page and panels of his eyes, his brows furrowing again and a resigned, but frustrated expression. His thoughts starts, "Stop. I shouldn't be happy hearing that. And why are you apologizing? I should be the one to..! I can't let anything like that happen to you. You deserve to live a long steady and peaceful life. I want to be optimistic. I want to protect you, but I might end up doing the opposite." The text surrounds Wolfwood from Vash's perspective, the other man drinking out of his shotglass, his eyes downcasted.
"I shouldn't have you. And you won't leave." Behind these text is a panel of Wolfwood's eyes finally looking over to Vash. Vash's thoughts continues, "It's so unfair." When Wolfwood sees Vash, his eyes soften and he frowns. The last panel shows the lower half of Vash's face, but tears begins to flow down his cheek. Wolfwood's hand is already reaching to wipe at them as he starts to say, "You know..."
A wider shot of Vash and Wolfwood, Vash slightly leaning forward with his mouth tightly shut, and tears steadily continuing to flow out of his closed eyes. Wolfwood continues to wipe at them with his hand as he continues, "This isn't a dream anymore. I don't know what you saw for you to be this shaken up, but whatever happened, you'll overcome it, right? If not you, I'm here too. You'll be okay, Spikey. So..." Wolfwood's expression grows more tender, "Have a little faith in me... and come back already." The dark blue starts to fade.
The wide panel has the dark blue background faded and replaced is the light pink. It shows Vash in full up to his shoulders, his eyes are still tears littered, but there's light in them as he says, "Wolfwood..." making eye contact with the other. The next panel shows Wolfwood's tender expression, his eyes and brows fully soften and he has a small smile on his lips, finally seeing the other return a level of sincerity with him.
The next panel shows the bottom half of Wolfwood's face and his hand is offered towards Vash for a dance as he says, "C'mon. We don't have to talk, but this is okay, right?" The background is now white and a ribbon flowing across the page separates this panel from the next sequence. Vash's inner thoughts continus, "I've spent too long avoiding this. It's scary to want after I've taken so much from others." A sequence close up of their hands is shown, with Wolfwood's outstretched hand on the right and Vash's reaching hand on the left. Vash gently places his hand in Wolfwood and at the bottom, Wolfwood wraps his fingers across Vash's.
Throughout the page, a dark blue ribbon starts to flow around the both of them with confetti raining alongside the effect. Vash and Wolfwood are hand and hand, dancing together with Wolfwood as the lead. The viewer can see a peak of Vash's expression, full of fondness but also a hint of sorrow as he looks down at Wolfwood. His inner thoughts continue, "I don't deserve this. I don't deserve you. But why is that even though I have these burdens, I still want to love you. I still want you to be by my side."
With a close up of their mouths, Vash's thoughts continue, the text covering his mouth, "Wolfwood, I--" Wolfwood's speech bubble covers Vash's text as he completes his sentence, "want you." Vash's eyes widen for one panel and in the next, his eyes spark, a blush appearing on his cheek and the confetti flows and spark. Tears ease up on his eyes again.
"Want me too already, Spikey." Wolfwood has leaned in enough to rest his head against Vash, a hand of his on Vash's neck, holding his nape and another hand pressed gently against his back. A ribbon separates this panel from the next, a mix of confetti flows across the page, as Vash envelopes Wolfwood in a hug too, holding him and his hand gripping tightly onto his back.
This page is just the ribbon flowly throughout the page on the white background, one white ribbon and the other a dark blue. Near the bottom, the ribbon envelopes each other in a loop. A conversation of Vash and Wolfwood is held over these ribbons, Vash starting to say, "What if I hurt you? What if you..?" Wolfwood responds, "You? How could you hurt me?" Vash, "You know what I mean... You see it everyday..." Wolfwood responds, "If you think I'm going to kick the bucket so easily, I suggest you look at me more closely from now on, idiot. I'm not that easy to get rid of."
The next page has the ribbon criss cross over the top of the page. Vash and Wolfwood can be seen in their dancing position again, Wolfwood now resting a hand on Vash's shoulder, as Vash takes the lead. Vash continues, "Well, I know that... I tried." Wolfwood responds, "But you won't anymore... since you want me... around, yeah?" Wolfwood's head cocks to the side, smiling with assurance, cheeks flushed. Vash looks at him with a wide smile and fond, loving eyes. The confetti flows across the bottom of this page and as it eases into the next page, it starts to disappear.
Vash responds, ".. Yeah... I do..." as he pulls Wolfwood into a hug again. Wolfwood says, "Not going to run away anymore, are you?" Vash says, "No... I trust you." A panel shows Wolfwood's turning away slightly with a shy expression, muttering "Geez..."
In a more simplified style, Wolfwood is seen gripping Vash's cheeks now with his hand, "Though... You do remember you avoided me for two weeks straight, right? How are you going to make that up to me?" Wolfwood asks. Vash responds with eyes closed and a pucker of his lips. A vein of irritation appears on Wolfwood's face. Wolfwood starts to squeeze at Vash's cheek with both hands, shouting, "Now that you've recovered, you're trying to be funny, huh?!" Vash says through the squished cheeks, "I'm just happy..."
The next page opens with a closed up panel of Vash's widen eye as Wolfwood's hand moves from squishing his cheeks to gently holding them and Wolfwood leans in. The inner thoughts starts again, "There's a chance I'm not making the right choice... My dreams, my fears of losing you, it will never go away. But you said you won't let it happen... And I want to hang onto your words closely this time. After all, if it's anyone who can make me believe, it's you." The white ribbon from previous pages flows across the page and it visibly ends at the bottom of the page, enclosing the two of them as they share a gentle kiss with Vash holding Wolfwood's face, a tear in his eye.
The next pages starts with Wolfwood saying, "You cryin' again?" Vash responds, "I'm just grateful..." Wolfwood responds, "But you've always had me." Vash responds, "Being like this is different from staring at you from behind all the time though..." The two can be seen together again, Wolfwood pressing his elbows against the table with Vash leaning over him. Wolfwood is easing the tears out of Vash's eye again, just like earlier. A close panel of Vash's fond expression is seen as he says, "Thank you, Wolfwood." Wolfwood looks up at him with a small smile, gentle eyes. Confetti starts to flow lightly across the page as text starts to appear against the white background, "I'm the one who's grateful...
That you'd embrace someone like me, when I'm not fit to hold you in the first place... But I know better than to hesitate. The moment I acknowledged it, I knew I'd spend the rest of my life loving you. So, have as much of me as you want, Vash."
The final page shows the confetti gently falling down the page and at the bottom shows Vash and Wolfwood pressing their foreheads together, Wolfwood's hands cupping the side of Vash's face gently, and both of them smiling brightly with each other. ID END]
2K notes
·
View notes
how about that uhhhhh Fantasy Julie. she gets her sword <3 no one can take it from her <3
rambles:
SIKE you get an extra, lower quality doodle
SIKE AGAIN here's the rambles
yeah... i caved and gave her a tail... I'm Not Sorry! it's cute! i wanted to stick with her sorta flower motif - it's stronger in her princess look, since I imagine that when she was part of the royals she was very blatantly flower power based. it was her Thing!
but a Julie free of her noble shackles... she deserves her big sword. like yeah, she has flower magic, but who needs it when she has a Giant Blade??? on the royalty vein, and if we're classifying "rainbow monster" as a species, i feel like horn size/curve would be a status symbol of some kind. maybe Julie would have kept her horns filed short. but if she ran away from that life... longer horns! i like to imagine that they'll keep growing until she has a pair of Extra Weapons attached to her head! curved forward like mammoth tusks maybe!
i imagine that like Frank, she goes with minimal armor - range of movement over protection, yk? some scale mail over her front, a thick leather flower over her chest w/ scalloped leather pauldrons, wrist armor and metal knuckles! i'd think that the faux-suspenders include a back sheath for her sword... i wish i'd thought of that Before i finished the little ref! i don't feel like going back and editing!
i imagine that she was forced to cut her hair when it got caught in something (a gelatinous cube, mayhaps). it didn't look good! don't let anime and Mulan fool you! cutting your own hair with a blade will not look nice! but someone - Eddie, probably, he's good with scissors i'd assume - cleaned it up for her. and hey, it didn't look bad! plus, Julie probably liked being able to just tuck up her long strands into her hat when she's feeling a bit more like a Julius than a Julie!
it's been a fun challenge transforming their canon outfits into a similar variation with fantasy flavoring and twists! i want them to suit the setting but still maintain Themselves! Julie's was tough i gotta admit. i was messing around with the princess look and the fighter look side-by-side. it worked better when i sat back and thought "fighter Julie is Julie unrestrained. that version would be more aligned with her canon look"
i wanted her princess form to look Restrained! she has to be a ~delicate flower~, a noble woman, pristine and poised and very much a princess. soft colors, poofy clothing, bright white gloves that are not to be sullied. carefully bundled up hair! jewelry! that dress must be Heavy and hard to move in! her tail must be so cramped under there!
but Julie Unleashed? violent pinks! rose gold accents! short skirt so that she can sprint and Kick! fun boots that she can be active in and delight in watching them get dirty! her hair is free to whip in the wind and get caught in things! fun straps and Deadly Accessories! a sword that she stole from the royal armory on her way out the window! she has forearm wraps both to match Frank and to support her wrists!
605 notes
·
View notes