#the original text has each member talking about the other members + himself

[mspaesthetic]

Tidbit: The “Posterization” Effect of Panels Due to the Consequences of GIF Color Quantization (and Increased Contrast (And Also The Tangential Matter of Dithering))

There’s this misconception that the color banding and patterned dithering found in panels is an entirely deliberate, calculated effect Hussie manipulated the image into looking with some specific filter, but this isn’t the case, exactly. It wasn’t so much a conscious decision he took but rather an unavoidable consequence of the medium he partook in: digital art in an age where bandwidth and storage was at a premium.

Not to delve too deeply into the history and technicalities of it, but the long and the short of it is back in the early nineties to late aughts (and even a bit further into the 10s), transferring and storing data over the web was not as fast, plentiful, and affordable as it is now. Filesize was a much more important consideration than the fidelity of an image when displaying it on the web. Especially so when you’re a hobbyist on a budget and paying for your own webhosting, or using a free service with a modest upload limit (even per file!). Besides, what good would it be to post your images online if it takes ages to load them over people's dial-up Internet? Don't even get me STARTED on the meager memory and power the average iGPU had to work with, too.

The original comic strip's resolution was a little more than halved and saved as a GIF rather than a large PNG. That's about an 82.13% reduction in filesize!

So in the early days it was very common for people to take their scans, photographs, and digital drawings and scale them down and publish them as smaller lossily compressed JPEGs or lossless GIFs, the latter of which came at the cost of color range. But it had a wider range of browser support and the feature to be used for animations compared to its successor format, PNG ("PNG's not GIF").

You'd've been hard-pressed to find Hussie use any PNGs himself then. In fact, I think literally the only times he's ever personally employed them and not delegate the artwork to a member of the art team were some of the tiny shrunken down text of a character talking far in the distance and a few select little icons.

PNGs support semi-transparency unlike GIFs, which is why Hussie used them to preserve the anti-aliasing on the text without having to add an opaque background color.

While PNGs can utilize over 16 million colors in a single image, GIFs have a hard limit of 256 colors per frame. For reference, this small image alone has 604 colors:

For those who can't do the math, 256 is a pretty damn small number.

Smaller still were the palettes in a great deal of MSPA's panels early on in its run. Amazingly, a GIF such as this only uses 7 colors (8 if you count the alpha (which it is)).

Not that they were always strictly so low; occasionally some in the later acts of Homestuck had pretty high counts. This panel uses all 256 spots available, in fact.

If he had lowered the number any smaller, the quality would have been god-awful.

To the untrained eye, these bands of color below may seem to be the result of a posterization filter (an effect that reduces smooth areas of color into fewer harsh solid regions), but it's really because the image was exported as a GIF with no dithering applied.

Dithering, to the uninitiated, is how these colors are arranged together to compensate for the paltry palette, producing illusory additional colors. There are three algorithms in Photoshop for this: Diffusion, Pattern, and Noise.

Above is the original image and below is the image reduced to a completely binary 1-bit black and white color palette, to make the effect of each dithering algorithm more obvious.

Diffusion seemingly displaces the pixels around randomly, but it uses error diffusion to calculate what color each pixel should be. In other words, math bullshit. The Floyd-Steinberg algorithm is one such implementation of it, and is usually what this type of error diffusion dithering is called in other software, or some misnomer-ed variation thereof.

The usage of Pattern may hearken back to retro video game graphics for you, as older consoles also suffered from color palette limitations. Sometimes called Ordered dithering because of the orderly patterns it produces. At least, I assumed so. Its etymological roots probably stem from more math bullshit again.

True to its name, Noise is noisy. It’s visually similar to Diffusion dithering, except much more random looking. At least, when binarized like this. Truth be told, I can’t tell the difference between the two at all when using a fuller color table on an image with a lot of detail. It was mainly intended to be used when exporting individual slices of an image that was to be “stitched” back together on a webpage, to mitigate visible seams in the dithering around the edges.

To sate your curiosity, here's how the image looks with no dithering at all:

People easily confuse an undithered gif as being the result of posterization, and you couldn't fault them for thinking so. They look almost entirely the same!

Although I was already aware of this fact when I was much younger, I'm guilty of posterizing myself while editing images back then. Figured I may as well reduce the color count beforehand to help keep the exported GIF looking as intended. I view this as a complete waste of time now, though, and amateurish. Takes away a bit of the authenticity of MSPA art, how the colors and details are so variable between panels. As for WHY they were so variable to begin with, choosing the settings to save the image as requires a judicious examination on a case-by-case basis. In other words, just playing around with the settings until it looks decent.

It's the process of striking a fine balance between an acceptable file size and a "meh, good enough" visual quality that I mentioned earlier. How many colors can you take away until it starts to look shit? Which dithering algorithm helps make it look not as shit while not totally ruining the compression efficacy?

Take, for example, this panel from Problem Sleuth. It has 16 colors, an average amount for the comic, and uses Diffusion dithering. Filesize: 34.5 KB.

Then there's this panel right afterwards. It has 8 colors (again, technically 7 + alpha channel since it's an animated gif), and uses Noise dithering this time. Filesize: 34.0 KB.

The more colors and animation frames there are, and the more complicated dithering there is, the bigger the file size is going to be. Despite the second panel having half the color count of the first, the heavily noisy dithering alone was enough to inflate the file size back up. On top of that, there's extra image information layered in for the animation, leaving only a mere 0.5 kilobyte difference between the two panels.

So why would Hussie pick the algorithm that compresses worse than the other? The answer: diffusion causes the dithering to jitter around between frames of animation. Recall its description from before, how it functions on nerd shit like math calculations. The way it calculates what each pixel's color will be is decided by the pixels' colors surrounding it, to put it simply. Any difference in the placement of pixels will cause these cascading changes in the dithering like the butterfly effect.

Diffusion dithering, 16 colors. Filesize: 25.2 KB

This isn't the case with Noise or Pattern dithering, since their algorithms use either a texture or a definite array of numbers (more boring nerd shit).

Noise dithering, 16 colors. Filesize: 31.9 KB

Pattern dithering, 16 colors. Filesize: 23.1 KB

There's a lot more I'd like to talk about, like the different color reduction algorithms, which dither algorithms generally compress better in what cases, and the upward and downward trends of each one’s use over the course of a comic, but since this isn’t a deep dive on GIF optimization, I might save that for another time. This post is already reaching further past the original scope it was meant to cover, and less than 10 images can be uploaded before hitting the limit, which is NOWHERE near enough for me. I should really reevaluate my definition of the word “tidbit”… Anyway, just know that this post suffers from sample selection bias, so while the panels above came from an early section of Problem Sleuth that generally had static panels with diffusion dithering and animated panels with noise dithering, there certainly were animated panels with diffusion later on despite the dither-jittering.

Alright, time to shotgun through the rest of this post, screw segueing. Increasing the contrast almost entirely with “Use Legacy” enabled spreads the tones of the image out evenly, causing the shadows and highlights to clip into pure black and white. The midtones become purely saturated colors. Using the Levels adjustment filter instead, moving both shadow and highlight input level sliders towards the middle also accomplishes the same thing, because, you know, linear readjustment. I'm really resisting the urge to go off on another tangent about color channels and the RGB additive color model.

Anyway, there aren't any examples in MSPA that are quite this extreme (at least in color, but I'll save that for a later post), but an image sufficiently high in contrast can be mistaken for being posterized at a glance. Hence the Guy Fieri banner. In preparation for this post, I was attempting to make a pixel-perfect recreation of that panel but hit a wall trying to figure out which and how many filters were used and what each one's settings were, so I sought the wisdom of those in the official Photoshop Discord server. The very first suggestion I got was a posterization filter, by someone who was a supposed senior professional and server moderator, no less. Fucking dipshit, there's too much detail preserved for it to be posterization. Dude totally dissed me and my efforts too, so fuck that moron. I spit on his name and curse his children, and his children's children. The philistines I have to put up with...

In the end, the bloody Guy Fieri recreation proved to be too much for me to get right. I got sort of close at times, but no cigar. These were some of the closest I could manage:

You might be left befuddled after all this, struggling to remember what the point of the blogpost even was. I had meant for it to be a clarification of GIFs and an argument against using the posterization filter, thinking it was never used in MSPA, but while gathering reference images, I found a panel from the Felt intermission that actually WAS posterized! So I’ll eat crow on this one... Whatever, it’s literally the ONE TIME ever.

I can tell it's posterization and not gif color quantization because of the pattern dithering and decently preserved details on the bomb and bull penis cane. There would have had to have been no dithering and way fewer colors than the 32, most of which were allotted to the bomb and cane. You can't really selectively choose what gets dithered or more colors like this otherwise.

Thank you for reading if you've gotten this far. That all might have been a lot to take in at once, so if you're still unclear about something, please don't hesitate to leave a question! And as always, here are the PSDs used in this post that are free to peruse.

#tidbit #homestuck #problem sleuth #gif #dithering #posterization

[miwaqrsp]

Okay soo these are going to be some headcanons of our favorite Ghost <3 also I changed the colour of the text to a dark purple cause the normal colour would turn it black for some reason 🤷🏻‍♀️

♡- It would take this man years to open up but when he does, he’s like a clingy teddy bear.

♡- PDA is not really his thing in public but like I said in the previous sentence, he’s your personal teddy bear.

♡- he likes it when he’s a lil spoon, not all the time but especially when he has nightmares then him laying his head on your chest and hearing your heart beat as you gently pet his head is a must!!

♡- If you also worked in the military and lets say at the same base or in his team. He would get super protective of you. Basically if anyone looked at you the wrong way he would glare at them or if sumn were to happen to you he would send them to an infirmary.

♡- So Ik that in the original comic abt Ghost shows him with dark brown hair and now the new version of the MW2 shows him with blond hair. I feel like he’s insecure still about his past and dyes his hair blond in order to look like his mum (he still misses her a lot sometimes) because when he has his brown hair I feel like it would remind him a lil too much about his father and how shitty he use to be to both his mum and him.

♡- As much as he would deny this and say its bullshit. He wants a family of his own, a big one. He wants to be the father that he never had to his children because his was absolute shite. If you yourself have a large family and he caught you once holding your baby niece/nephew he would picture in his head of how would your kid look like. Would it have his hair or yours? Will they have your or his personality? Eyes? Smile? Anything. He would just picture himself holding a small being that both of you created and cherish it like a little drop of sacred water in his palms.

♡- When you catch his ass staring at you while holding said family members child he would just say “Your shirts a little dirty” or something like that. While trying to hide his embarrassment.

♡- Speaking of embarrassment. His cheeks don’t blush, like at all. Unless its freezing cold and he’s out with a thin balaclava on. But when he gets embarrassed the tips of his ears will get extremely red. Johnny would tease him about it.

♡- Privacy. On. Point. 100%. All the time.

♡- Will only disclose information about where you two live only to Price. Even your family has the wrong address of where you two live. Since he doesn’t want anything happening to his new family that would send him through a spiral like the last time it happened.

♡- Depending on how long you two know each other. Lets say that you two know each other for a long time now. He will keep his mask off at home. At all time. But outside in public he would still wear a balaclava or a surgical mask with a hood on.

♡- He likes it when you hold his hand when you’re outside. He just loves having your little hand in his and just holding it.

♡- HUMAN HEATERRRRRRR!!!!!! NEED DO I SAY MORE FELLOW READER????

♡- He’s not big when it comes to emotions but he will be there for you when you need him. If you want to just cry and for him to be there. He will. He would sit by your side focusing his gaze on somewhere else while the sounds you make are breaking his heart. Slowly chipping away at him. Until you two cuddle.

♡- If you want to talk about why you’re crying, he would sit there just listening to you while rubbing your back slowly and gently.

♡- After crying session cuddles are mandatory. Either if you or him cried to the point of finally letting go of everything, cuddles are a must.

♡- Loves it when you’re laying your head on his chest while the rains pouring on the outside. Something about it calms him so much its unbelievable.

A/N: I’m gonna make another part of these hcs but nsfw edition but if you would want me to add another one please say so or if you have any hc suggestions don’t be shy drop ‘em in the comments. Love ya 💗

#call of duty #simon ghost riley #headcanon #cod headcanons #x reader #simon riley headcanons #cod #ghost cod #gaz cod #soap cod #headcanons #cute headcanons #ghost x reader

[thoughtspresso]

Aqua plans to die.

And his death will be necessary to take Kamiki down.

While the full details of Aqua’s revenge plan isn’t entirely clear to all of us yet, his intention to place himself in danger as he tries to take Kamiki down is a very clear, and very crucial part of the plot that he anticipates.

Before we can dive into how Aqua is going to achieve his revenge, we need to back up a little bit and understand who he is as a person, how he makes decisions, and what he personally wants.

What is Aqua’s Goal?

From a top-level view, Aqua has a singular emotional goal:

Aqua wishes to take responsibility for the deaths of his mothers.

Aqua/Gorou absolutely believes that after two lives of the same thing, that he was the common denominator. He was the fault his mothers both died, because he was useless and helpless. Had he never been conceived, and more crucially, if his mothers did not have to lie about his existence, they would have both stayed alive. If Gorou’s mom didn’t have to conceal the pregnancy from her parents, or did not have one at all, she would have lived a long life. He believes that perhaps his second chance at life was to save Ai, but he was paralyzed and helpless during her murder. He blames himself for Ai’s death too.

This is a driving force in Aqua’s character, and informs all of his decision making, even to the detriment of his own plans most times. It leads us to his supplementary goal:

Aqua wants to keep the people he loves safe.

Whether it was shielding Ruby from entertainment or making sure she’s in a safe agency with good group members, or Akane not going too far in enacting his revenge plot for him, or Kana from steering clear of a career-ending love scandal, Aqua’s key traumas has led him to feel compelled to take action and do whatever it takes to save people if he had the power to do so.

Here is a breakdown of Aqua’s plans, and some key questions we have to ask about each one.

1. Why make a movie called The 15-Year Lie? And what is “Ai’s true wish”?

I have reason to believe that Ai’s DVD for Aqua would have either been a message about wishing to be loved truly and be hated with full honesty for the person she really was, that she wanted her actual self to be revealed to people. In line with that, I think Aqua’s DVD included Gotanda’s original documentary for the B-Komachi dome event. Which is why Gotanda tried to defend Aqua's decision to reveal her secret in chapter 112, and why in chapter 108 Gotanda says about the script that “this is finally my time to fulfill that promise.”

2. What does he mean by “using Arima Kana”?

There were theories circulating that the person who texted Frill Shiranui could have been Aqua, trying to get her to encourage Ruby to play the role of Ai in the film. However, that couldn’t be any farther from the truth. As we know, Aqua was saying that Gotanda should “grow up” and understand that the most important thing for a movie is to succeed commercially first before we talk about artistic value. 

If Aqua had full control over the situation, he would have just straight up casted Akane. After all, that was what he initially proposed, and even contacted her for it despite saying he’ll never have anything to do with her again. What he needed, more than anything, was for the film to succeed commercially. And with the headlining actress no longer (a) the most famous celebrity of their generation, or (b) the heralded genius of their generation, Aqua has no other options.

Except: Arima Kana.

I think the aspect of him using her or manipulating her is mainly to encourage her publicity activities. He’ll be encouraging her to do well in her work to garner more star power for the movie to really be a success, and for her to help his sister be the perfect lead for the show. He’s also going to bank on the idea that Kana will do things for him because she has a crush on him, which he only realized in Chapter 102 after Mem-cho points it out, that he can pursuade Kana to get out of the way of his revenge plot if necessary to keep her safe or place her in the spotlight to attract people’s attention for the movie.

While unlikely, he might even encourage her to stay on a little longer until Ruby gets to the Dome performance.

Or, and maybe this is my shipping delulu talking, but it can also be that he’ll try to just be around her frequently to garner media attention about their relationship. In this way, keeping her close without actually dating her could serve a dual purpose: get people talking about them and the movie, but also make sure that Kana stays safe and nobody makes a rumor of pairing her up with anybody else.

Lastly, also not super likely but another option could be to convince her to headline the show, and play Ai in Ruby’s stead.

3. Why does Kaburagi say that the film is bordering on illegal?

This is a truly crucial piece to unveiling Aqua’s plot. We know Kaburagi likes producing shows that include good-looking young people, and that seems to be his main strategy for raking in young audiences and cashing out.

So why would he have hesitated, even for a second, on a plan to cast the top talent of this young generation, on the biggest news Japan has been talking about, handed to him by a first-hand source--the son of Ai himself?

On all accounts, this would have been the perfect formula for a smash success. So why would Kaburagi say things like, “do you have enough evidence”, when everybody already knew about the University student stalker that murdered her? What was so controversial?

Unless, when they said Aqua will play the culprit, they didn’t mean the Ryosuke.

They meant he was playing Hikaru Kamiki.

Here’s what we know about the film, and what I think Aqua is trying to do:

1. Portray Kamiki in the worst possible way and destroy his reputation.

The 15-Year Lie will be a biopic about Ai’s life from when she was starting out as an idol.  Ai will be portrayed as a poor girl abandoned by her parents, searching for the true meaning of love. We know that this framing will be part of Ai’s characterization because of the scenes where Ruby struggled the most:

In the search for love, they will show her falling for a young man and talented actor at Theatre Lalalai--that being Hikaru Kamiki. Once he gets Ai pregnant, he abandons her, and she runs off to the countryside to hide from the press. When Ai asked him to come visit her, Kamiki, in wanting to protect his career, attempted to send out a stalker. A few years later, seeing his kids wotagei on social media, he manages to find them again and kill Ai.

It is a complete and utter character assasination of Hikaru Kamiki, and while revealing Ai as a flawed person, draws for the sympathy of the viewers to love Ai for who she truly is. Which is exactly why Gotanda keeps insisting for Ruby to play the role, even when Aqua and Kaburagi have sensible recommendations for Akane and Frill.

At that moment, when Ai dies, Aqua will reveal his face, and openly declare that it was his father who orchestrated it all. Then he might even portray his father murdering Ryosuke himself, instead of the suicide that was reported in the media.

2. Aqua will use himself to bait his father out, and force Kamiki’s hand to kill Aqua.

The main reason why Aqua finds it necessary for the film to be a commercial success is because he needs the general public to be one hundred percent in agreement that Hikaru Kamiki is an evil man that deserves to be jailed. (Whether or not he reveals his name in the film, which he could but doesn’t need to.) This public lynching is his first control.

But here’s the thing: Kamiki didn’t directly murder Himekawa Airi and Hoshino Ai himself. At this point in time, Aqua is not aware of Katayose Yura’s murder either. And there is no evidence that connects Uehara Seijirou and Ryosuke’s suicides as murders by Kamiki’s hands.

And on top of all that, when these things happened, Kamiki was fully a minor.

Akane’s fears and interpretation was that Aqua would murder his own father because it’s the only form of revenge he could enact himself. 

But she’s wrong, there’s one more thing Aqua could do: make Kamiki commit murder again. If he kills Aqua, there will now be a murder that the public agrees without a doubt was done by Kamiki himself.

He can go to jail once and for all, or he can also get stabbed by an angry fan--Aqua doesn’t care. All he cares about is that it’s a sure win, and it’s over forever. He launches his sister’s career into the spotlight, he keeps everybody safe, and he atones for the death of his mothers with his own life.

In summary: Aqua plans to get killed by his father, so that an actual murder has occurred for which he could be jailed or publicly ostracized or even killed.

And here’s why I think Aqua will fail:

Aqua’s assumptions about his father are incorrect.

He believes that Kamiki’s reason for killing Ai was because her pregnancy would ruin his reputation and career as a rising actor. That’s why Aqua tries to hit him there. And he believes defaming him might provoke him to get killed.

But I don’t think Kamiki cared about his reputation at all anymore. He left his career as an actor behind after Kindaichi kicked him out of Lalalai, and went on to graduate from Faculty of Science. He never went back in front of the spotlight, instead opening a talent agency around the exact time he believed his kids might be joining the industry.

I have reason to believe that Kamiki thinks murdering Airi and Ai was to protect his children or some other great act of justice against his rapist(s). And that even killing Katayose Yura was done because he didn’t want a liar like her to take the spotlight that was supposedly for his daughter Ruby.

I don’t think Kamiki will harm Aqua.

But I do think he will come forward and expose himself and his twisted justification, and he might even openly give interviews to the media.

Instead, I do believe Kamiki might pay attention to Kana’s honest acting--something he’s never seen before in a person, and try to get close to her somehow. And if Kamiki’s name is not revealed, and if the theories are true that Frill works for Kamiki’s agency, he might recruit Kana to join him.

All this is to say, get Kana out of this manga. Somebody, please save her.

#oshi no ko #oshi no ko spoilers #onk spoilers #onk fantheories #oshi no ko fan theories #Hoshino Aqua #Aqua Hoshino #Arima Kana #Kurokawa Akane #Hoshino Ruby #ruby hoshino #Hikaru Kamiki #Character Analysis #If you're reading these tags please know that Aqua is like Edward Cullen planning to walk in front of the Volturi in broad daylight #And Arima Kana is Bella driving a yellow sports car in full speed trying to not get him murdered #But seriously he blames himself so much we should get Robert P to play him in the live action good god #The Chuunibyou is strong with this one #These are the gambles #I am allowed to be incorrect

[pencil-peach]

G Witch Onscreen Text: Episode 22

Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.

<< If you forgot, Episode 21 will remind you of What You Can Do Now Or you can go to the Masterpost.

It's the dawn of a New World.

After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.

TEXT: (Lefthand side) - Link Strength with Aerial currently

(Middle) System Report -Permet Inversion Reactor STATUS:

Permet fluctuation reduced to [???]

Topological heat exchange catalyst replenished

Permet inversion reactor output decreased to 61%

Permet field stabilization in progress

(Righthand side) - Link Strength with Gundnodes currently

Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...

I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.

It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....

The news report Rouji presents is from PNB, and the headline is:

Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero - Assembly League fleet devastated, evacuation warnings issued over wide area. - Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."

It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.

The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).

We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.

Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force. In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.

I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.

Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.

But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.

And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).

On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.

Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)

Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.

Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.

In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.

At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.

Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.

In the end, it's not violence that allows Suletta to rescue Miorine. It's love.

And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.

When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.

Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.

And sometimes, he's still your dad.

Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.

It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...

It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.

Rolls up my sleeves

(Left, Top to Bottom) Quiet Zero - Current status summary

MOBILITY - After restart, movement velocity of enemy basepoint is predicted to increase - Velocity of each enemy MS also predicted to increase by average of 37% - Evasive Maneuvers of main unit will be complex

DEFENSIVE FUNCTIONS - Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach - Defense barrier strength 67942049 - Very difficult to invade domain while mutual defenses of basepoint and MS are linked

(Right, Top to Bottom)

WIDE-AREA DATA STORM CONTROL FUNCTIONS - Expands data storm domain and stabilizes it over a wide area - Domain is predicted to expand further in future

DATA STORM DOMAIN - 60%

PERMET DISPERSAL SYSTEMS - Permet dispersal index exceeds 200 - Permet density x 27.1 - Density increase is accelerating

REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES - Increases interconnectedness of overall enemy - Each MS appears to become a sub basepoint - Basepoint and all Gundnodes are linked - Link multiplexing confirmed, jamming impossible

A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.

In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links

(Baori Pack) - Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions. - Can also be separated from the main unit...

The 'Daedalus' multi tool system...interessante...

In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).

When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.

If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.

I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.

Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!

Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions

I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.

The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.

If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.

In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.

'CGG' functions as a blank space between words.

So, for example, if you wanted to write, "I love you, Suletta." The code would be:

GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT

In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)

I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.

You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.

But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice. (The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)

Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.

Sibling fights....

It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...

To find out, Click here to go to Episode 23 >> Or maybe the Masterpost could remind you.

#g witch #gundam the witch from mercury

[dearweirdme]

I would love to hear your thoughts about the yoongi text after watching suchiwita.

I started doing a little more digging and didn't realize how much jungkook had to do with the potential disbandment. I originally thought it was because of a rapline member and tae, but its starting to seem like it was a taekook issue. When we first found out about the text, my initial guess was that it had something to do with tae and jk coming out, but now I'm not too sure. Could taekook have been having a rough patch/break up and it was affecting the group?

Hi anon!

That text is going to haunt us forever isn’t it? I don’t think it has anything to do with Tae and Jk breaking up or having a tough patch, though things cannot have been easy on them back then. I think the band as a whole was overworked and stressed out by the fame and the pressure that came with it.

Although it breaks a bit of my heart to hear him talk about comparing himself to others and thinking of himself as weird and slow, I so much love that he wanted to be open about this with us. It was evidently a really vulnerable time in his live and it takes strength to share this with the world. He was so overworked! He felt so tired all the time that he even wanted to get injured just so he could get some rest. All he could think about was resting. And if you top being tired to the bones all the time with constantly feeling not good enough, you start thinking about quitting. I really think Tae though he couldn’t do this.

I talked about Jk’s golden maknae status being a burden at times, and he too was clearly overworked. Edit, since I wasn’t complete on Jk here: Jk has also had trouble with coming to terms with being famous and not being able to do what he wants. While the life of an Idol give a lot of great opportunities, it takes away a lit of others. Jk was super young, and he has a taste for trying things. Being famous made it hard for him to do things he wanted. Insecurities and tiredness are really hard to deal with for a longer period of time. If we add to that Taekook being a couple but having no freedom to show it and being separated even. I can imagine them thinking about leaving together.

And that is where I think Yoongi’s text comes in. Because although Tae and Jk had their separate issues, just like the other members had theirs… whenever 2018 and the disbandment talk comes up.. we get Taekook as a unit.

It’s Yoongi sending them a text. One they had clearly shared with each other and talked about, but they did not share with the others.

It’s Jk comforting Tae in a way we had not seen before, even though they were supposedly awkward and distant at this time.

And now, we get Tae talking about it… and he is talking for both of them. He is talking about him and Jk as a unit in this. It’s a situation in which they shared something and in which they were going through the same motions and they were sharing their experiences (again, while supposedly being awkward and distant). Not only that, the members also see them as a unit in this.

So yeah, although we will never get to know what’s what exactly, I do feel this situation is quite telling. I think Yoongi’s text was able to at least ease some of the worries Tae and Jk shared. And I’ll forever love Yoongi for being able to help them get through a tough situation.

#taekook #Taekook analysis #yoongi text #suchwita

[plasticflwrs]

anything junyeong and everything junyeong related PLEASE!! i’m that man’s biggest fan🙏🏾

★⠀⠀ ⁄ ⠀⠀ kasey says ⠀ — ⠀ ... ⠀fun fact about junyeong: he's gone through the least amount of plot changes and face claim changes! originally, he was a kino fc named kangmin but the whole "dancer turned drummer" plot has always been his along with his backstory! i actually adore this guy and it doesn't really show but we've been to hell and back.

i need to talk about his relationships with the other members so... here we go

JUNYEONG would consider SALEM his best friend and the only bitch that he trusts. they're also friends with benefits. they share so many of the same morals and views about their career that it just makes sense for them to be this close. them teaming up to try to expose oliver was actually so iconic lmao i just love when they put their brains together for evil. the band often tries to do thing democratically but the decision always come down to deurim because salem and junyeong will ride or die their ideas and argue until everyone is giving into their ideas.

JUNYEONG sees JIYEON as a little sister. he's always been an only child, but there's something so pitiful about jiyeon that makes him feel bad for her. shitty parents, in love with a weirdo, whatever she had with minghui, jealously... how could you not feel bad for her??? he's the person that jiyeon goes to when she needs advice bc she knows junyeong would give it to her straight and not sugar coat it. i can fully see jiyeon, misty eyed, knocking on junyeong's door and he takes one look, closes it before texting her something like "get over yourself and then knock again". he's such a menace for no reason REJHFGJER

JUNYEONG doesn't hate DEURIM like the other members, but he thinks there's something weird about her. he's always been suspicious of her because the whole "biggest fan joins band" thing just felt too perfect. don't get him started on his theories though, you'll be there for hours. now, he just kind of ignores her in the dorm and goes about his business. there's no need for him to be close with deurim and he doesn't enjoy her company, so why force himself to have a friendship??

JUNYEONG and OLIVER are over their great civil war of 2023 and are actually pretty close for a junyeong friendship. now they're the only boys and junyeong's realized that the whole solo debacle wasn't oliver's fault, so they often look out for each other. that doesn't mean junyeong likes oliver, however, because he still finds oliver pretty annoying and doesn't like to be around him for very long EJRHGJER i get him tho! junyeong's very much in his "protecting my peace" era and being around oliver makes that literally impossible.

★⠀⠀ ⁄ ⠀⠀send me random questions that prompt me to talk about my character(s) !!

#﹙ 🎸 ﹚ ✶ ׅ plastic flowers ノ answered

[spaceagebachelorstan]

i am very bored rn, so

ride the cyclone youtube au

they all have semi-popular yt channels in this au. i dont know what counts as popular so take that as anywhere from 1-20k each. whatever you see it as will work

mischa

had to start with the king of kaching himself. Obviously he posts frequently to badegg, most of his time on his yt chamnels goes to his music, but he'd start badegg_games as a little side thing and react to horror games he really likes, which gets peoples attention. he puts links to the original badegg in his descriptions which leads to more people finding his music. how much more? you decide. he also collabs pretty frequently with ricky, and brings other choir members on sometimes. his backgroud is just his room, maybe with some extra lighting. he edits his own videos and they are exactly how you'd expect them to be.

ricky

he absolutely has a gaming channel. he might stream as well. he's played every single fnaf fangame, including all the dating sims. hes also played onlycans. that one got age-restricted. any niche game he finds he makes a video on it. he uses text to speech in his videos, most of the time in post production so he doesn't have to type as he plays, and adds big subtitles. he also has a complete timeline of zolarian history. mischa and him collab pretty frequently, often playing multiplayer horror games together. he spends a lot of time on his video borders, and his channel logo is very fun and colourful. his cats show up very frequently in his videos, and when its something he doesn't think will jumpscare him, they're often sat on his lap as he plays. rpgs and sci-fi are some of the main types of games he plays, but theres a big variety. his channel name is linked to cats, zolar, or both.

ocean

she is freesciencelessons, but for every single subject. she is the only reason anyone is passing anything. she started it as either some extra credit project or as a way to revise, but people started following her and she actually quite liked making the videos, so she kept going. she doesn't bring other people onto her channel very often. her videos range from ten minutes to half an hour, depending on the subject, and shes very thorough. if its on any type of standardized test, ocean has made a video on it. she makes props for her videos and asks penny or ricky to animate things for her sometimes. her channel name is something simple like rosenbergrevision or something.

constance

did anyone watch quake n bakes? because that is what she'd do. shed post themed tutorials on how to bake different things. if it was a choir member's birthday, shed make them a themed treat and give it to them in the recording (if they were ok w it). her most popular tutorial/recipe were these 3D minecraft mob marshmallows she made for ricky, but her personal favourite are these little rose-shaped meringue cookies. sometimes she posts sewing videos as well, or little arts and crafts videos. she also promotes the cafe or makes cafe vlogs, but not often. her set up is pretty aesthetic and neat, but nothing extremely fancy. her intro is. short but sweet and she. has a little logo. her channel name is smthn like blackwoodbakes or connie'skitchen.

noel

he started making videos about poetry and film history and french cinema just to talk about them really. it was a passion project, he wasn't really too bothered about how many people saw it. he put work into it because he liked it, and he's haply with the followers he has. his videos are really long, and he goes super in depth. and then, he loses a bet to someone in the choir, and makes one of those "i watched _____ so you didn't have to" videos about some rlly bad movie that everybody takes the piss out of (think after or something). im picturing him with like a wine glass in hand making quips about whatever scene is on. it gets so many more views than his other videos. he's absolutely livid. but he makes more bcs people genuinely seemed to like the video. his dramatics and insults were quite interesting to watch, and soon its a pretty regular thing (if regular means once every four months). he still mostly makes his videos on things he likes, though. also, he managed to rope ocean into watching some horrible basic film with him and people like their dynamic, oddly enough. on halloween he reacts to horror movies with mischa. his channel name is something serious and probably ties into france somehow.

penny

shes a faceless youtuber and she has a pretty wide variety of videos. she used to be a stan acct for johnny moon before legoland, and she had to post a video on why what she did was wrong as community service. that one got a lot of views. she has a lot of art tips and speedpaints, as well as a lot of vlogs and a draw my life. she has a lot of videos about different types of music as well. her username has something to do with jane doe, she thought abt it because shes faceless and doesnt show her identity online and thought it was a fun idea. her set up is pretty basic, but its nice, and ezra's voice features in a lot of videos. the other choir members don't normally appear on her channel, but she, ricky and constance did an art challenge once.

#noel gruber #mischa rtc #ocean rtc #constance blackwood #ricky potts #penny lamb #noel rtc #ocean oconnell rosenberg #mischa bachinski #ricky rtc #ride the cyclone

[queer-as-used-by-tolkien]

I have full executive authority to modify my text posts for another audience - to express the exact same sentiment but in words that the new audience will understand. To translate, if you will, from "broad and unknown Tumblr audience" who speak the Tumblr lingo and dialect and who could be literally anybody, to "close family with a humongous bunch of shared experience and similar language to talk about them," who share my worldview and understand what I'm saying without getting offended by a caveat I forgot to include or a specification or detail that I thought was unnecessary. (E.g. on Tumblr I might say "my friend X", but to family I'd just say "X")

Translation from one to the other, and vice versa, is necessary for both clarity and brevity. Different audiences require different approaches.

Tumblr audience might have sentences providing caveats or clarity or introduction to a concept that the family audience already knows or doesn't need. For brevity, I would cut those out, but I might also add sentences to help with transition or to aid in pacing of the ideas, concepts, or story. (This also goes for fic; is the fic for fans only or is it friendly to fandom-blind readers? Same story, told in slightly different words sometimes.)

But they are still my words and all those words remain as true as they were in the original form (assuming I didn't decide to lie to one group). In fact, if somebody had access to both versions (and understood both), they could see more of my mind, heart, and will than otherwise; for example, my willingness to even do such a thing as translating or providing two different versions. A family member who forgot my relation to X might be reassured by the label "friend" when describing her. (It might also mean a lot to the friend, if she read both accounts.) It always helps to see further caveats, examples, side notes, details, or even just different phrasing that I thought would help one group's perspective but wouldn't be too useful for the other unless they were doing a deeper study of my words, for whatever reason.

Now if I DID decide to lie, of course, you can't believe either version (or any new one I came up with), because now I'm a liar and you can't trust anything at all. But assuming I'm not a liar (and nobody has messed with my words, or it's not an outright faked screenshot or deep fake or whatever) - assuming I am truthful and you trust me (and/or my messenger), you can learn a lot from the differences of how I convey the same idea.

Between the two versions I might also do things like update typos or accidental occurrences of misgendering, clarify grammar, institute proper capitalization, and so on.

It makes me think of a post I saw once about the differences between Hunger Games books and movies; how the books tell a story of how awful war is to kids, and how awful the capitol is to make them have a love triangle to survive, and how awful it is for them to sit back and watch it as entertainment. And how the movies have us sit back and be entertained while children have a love triangle and fight each other. It seems like a classic case of "movies butchered the books," but the author was actually involved in and had quite some say in the production of the movie. Looking at them, they both together tell a more powerful story than otherwise. I'll see if I can find that post because it was a JOURNEY.

Anyway. The author has ultimate authority to translate their work to different audiences, with different emphases and details, whether the work is a Tumblr text post or an essay or verbally telling a friend what happened to me today.

Same goes for the Lord Jesus Christ, the word of God (John 1). (For one thing, translating God Himself into human form while preserving his divinity? Major translation skills there.)

The four gospels are an example of this; Matthew, for example, is addressed primarily to the Jews and includes many extra details, adding things like "BTW this was in fulfillment of XYZ prophecy" and including the genealogy through David and all like that. Luke is written by a Gentile to Gentiles, and tells similar stories but often with different details.

Only one gospel mentions that when Jesus fed the five thousand, it was at evening; only one mentions that it was a little boy who had the five loaves and two fishes; when Jesus asks a disciple what they're going to do, only one gospel mentions that Jesus said it "to try him."

John is far more focused on Jesus' divine nature, including many stories not included in the others. Different details, different emphases, different audiences, although ultimately, all four are available to us who have lived after the first century AD.

The gospels also show off another aspect of the author having final authority to translate while still being pure, truthful, and accurate: quotations from the Old Testament.

The OT was written in Hebrew. Jesus reads from a Greek translation and calls it Scripture. (I.e. equally as inspired as the original.) The apostles and writers of the New Testament often do likewise.

The same can be true of other translations as well. Translations into Latin, into German, into French, into Old English, into Early Modern English... God is the master of language. He created it, after all. Jesus is the word. All Scripture is inspired and profitable for doctrine, for reproof, for instruction in righteousness...

But only the author has that authority. If I tell my sister one thing and she tells my friend something in anything other than my own words, it may still be true; but it's slightly less true than my own words. Hopefully, usually the difference is negligible, but in a contest, anything I've ever said or written on the topic is more accurate than what somebody else said.

Hence, if there's something strange about the story my sister tells, my friend would do well to take it with a grain of salt (or more than one, if she knows I have a bad relationship with my sister.) If not, this can pass from one to another like a game of telephone until it devolves into gossip that's wholly untrue, outright malicious, etc.

I and only I retain the right to point to two different versions of my words and say both are equally true. My sister can't say "her words and mine are equal" unless she was there, and even then, any differences would be down to her own different perspective (and level of honesty), not mine.

You never know when somebody might embellish a Bible translation. I hear Satan has quite the interest in perverting God's words (just see Genesis 3). Compare your translation carefully with both itself and others.

On that note, let me share some comparisons to get you started.

One of them has to be wrong. What do you think?

#Bible #Kjv #Kjv-only #Christianity

[absentcaryatid]

Call Me

An ATEEZ Mingi fanfic by AbsentCaryatid

A misunderstanding over your phone's contact list leads Mingi to hurt feelings that are resolved with a mutual confession of love.

2.6K words, Content note: all ages, gender neutral reader, angst that ends well, crying, discussion of kissing, mention of mental health break and anxiety, Mingi has a self-esteem issue

~

Wooyoung had been the one to introduce you to the other members of ATEEZ. Given the longstanding lack of romantic interest on either side, he lovingly called you his cousin, and it might as well have been true the way he deeply cared for everyone he took a liking to. Actually you had met in school before he thought to pursue stardom and that history made you a trusted friend Wooyoung could count on to be there for himself rather than his fame.

While his busy life made seeing each other in person a rarity, you were able to keep in touch by text and various apps. Still, Wooyoung missed being in your presence and made the suggestion that you stop by KQ Entertainment sometime at the end of his work day if you were close by. Originally intending to go out for dinner as a pair, you ended up ordering in because you had easily fallen into conversation with the rest of ATEEZ after being introduced.

It was Yunho who had first made you feel welcome among them by suggesting the change in plans. Seonghwa seconded his idea and now all eight surrounded you, enraptured by your storytelling. They took an interest in yourself, but San in particular gleefully pumped you for information about Wooyoung's past. Seated around KQ's kitchen table you recognized from some of Wooyoung's cooking content, the conversation led to spilling quite a few secrets about the younger version of their outgoing friend, from a time even before Yeosang had met Wooyoung at Big Hit.

Not minding the attention at all, you could see Wooyoung pleased at the way his work friends took to you even if, as he admitted later, it came at the cost of his dignity. That conversation another day also revealed how impressed he was that normally reserved Jongho had warmed up unexpectedly fast. You knew the reason for that had been quietly divulging a few choice ways to torment his roommate Wooyoung whenever he was too annoying.

Hongjoong too had liked you too if his flurry of questions between yawns had been any indication. Wooyoung had been reassuring that the yawns were truly not a sign of disinterest, merely exhaustion from Hongjoong's late nights in the studio. The only member you did not get a good read on that first night was Mingi who had been quietly watching rather than talkative and you did not know what to make of him other than how much you were drawn to his looks.

From that occasion forward your life completely changed. Becoming friends with a whole team of idols had never been something you looked for in life. In fact, you had always been rather blasé about Wooyoung's career since your own tastes ran to more traditional music and sometimes international pop slowly making its way into your awareness. It may have been the lack of being starstruck why the men so quickly felt comfortable around you. Regular visits occurred as time went on, even to the privacy of their dorm for evenings of laughter and video games.

The greatest change however, came not from the newly expanded friend group, but due to the member who immediately caught your attention during time together. From the very first meeting you had been smitten by the quiet man with kind eyes often found behind stylish eyeglasses. Mingi quickly won your heart with a dazzling smile brought out by frequent laughter.

Guessing how much attention Mingi must get from fans led you to hold back, hoping to spare him feeling pestered with all the questions you had about his work writing rap lyrics or thoughts about fashion. Cutting off every conversation in person or by text sooner than you wanted risked giving the wrong impression, but you felt that was a better alternative to discomfort should he learn of your daily deepening crush. Still, it was clear to you Mingi was your favorite among the recently made friends even if you took great pains not to let it show.

It was that reservation on your part plus a big misunderstanding that led to causing him anguish, as unintentional as it was. Even though the eventual outcome was positive, it still hurt to look back on how everything came about. There were far better ways you could have handled your attraction without breaking Mingi's heart, even for a moment. The trouble started with another visit at the end of the group's work day.

Talk turned to planning another a fun evening eating together in the staff break room but nobody had any strong feelings about where to order from. When Mingi asked what some of the options were you thoughtlessly tossed your phone to him opened to the contact list so he could browse all the saved restaurants among the entries. So busy in discussion with Yeosang over the merits of various chicken places in town, you missed the falling look on Mingi's face as he scrolled.

The rough way he slid the phone back to you before leaving suddenly did not go unnoticed however. Seeing the other guys around the table just as clueless about Mingi's behavior, you shrugged your shoulders along with them. Conversation resumed after Seonghwa took the lead and picked a restaurant then made an order for nine people with enough variety in dishes to please everyone.

While waiting, you realized your water bottle was still in the practice room so you headed back to where you had first greeted the guys. You did not get far for rounding the corner led you straight into a sniffling Mingi. He seemed crumpled into a seated position on the floor, back against the wall as he attempted to hide the tears he was obviously wiping on his sleeve.

Concerned, you immediately knelt at his side. “Are you injured? Do you need me to get the others?”

“Only my pride.” Mingi raised himself up and turned to walk away. Stopping, he faced you again and took a deep breath as you stood. “Do you really want to know?”

“Of course.” Perhaps because of his still disheveled and pitiable state you let slip, “I care about you a lot, Mingi.”

“I think not.”

Baffled by his answer, you looked at him while awaiting an explanation.

“It was hard to take the time Yeosang did not have my phone number, but this felt a million times worse. Every other member is in your phone except me. But I get it. The team functioned perfectly fine without me during my hiatus. Seems you view the group as complete without me too.”

The gasp that came from your mouth went ignored as Mingi continued. “My looks are not like Yunho's; I don't have Jongho's voice or San's charm. I am not witty like Yeosang, as creative as Hongjoong, nor do I possess Wooyoung's dedication or Seonghwa's elegance.”

You were heartbroken by the litany of perceived shortcomings. Over the eight months of Mingi's absence for a mental health break Wooyoung had constantly confided in you how lacking the team felt without their friend. Now that you had a sense of Mingi yourself, you understood how true that would have been. He was a vital part of the eight member team.

At this point you didn't care if you revealed your feelings, only supporting Mingi's self-esteem. “None of that matters to me. Truly though, the man I see right now has looks that make me weak in the knees and a sense of humor that can have me laughing like no one else ever has.”

“You are just saying those things to make me feel better. If you really liked me I would be in your phone with the others.” Mingi scoffed, “You even have some air conditioning company or repairman listed but not me!” The man you adored agitatedly ran his hand through his hair before continuing. Mingi looked crushed as he admitted, “You have always been brusque with me but I thought we were at least friends. Clearly I was wrong.”

“Mingi, wait.” Your plea stopped him as he walked away. He was in obvious pain and this was the very last thing you had wanted to happen.

Over his slumped shoulder he called, “It really hurts. I liked you. I even wrote my lines in 'Feeling Like I Do' about you!”

Going over those lyrics would have to wait for another time because you were currently bewildered by the AC repairman comment. There was no entry for anything like that. Looking at your contacts, it finally dawned on you what happened. Knowing you had only this moment to reassure him, you walked around to face Mingi again. “I can only prove this to you right now, once you walk away you will never know the truth of what I am about to say. Call me, you will see you are already in here and not added in after.”

Mingi looked skeptical, but your voice was the deciding factor as you begged, “Please,” sounding on the verge of tears. It felt like forever as you mournfully looked at each other with hurt on both sides. Sighing deeply, Mingi took out his own phone and initiated a call.

The Groove Chasers remix of Bruno Mars' 'Just the Way You Are' began to play on your phone from the chorus lines:

When I see your face There's not a thing that I would change 'Cause you're amazing Just the way you are And when you smile The whole world stops and stares for a while 'Cause, girl, you're amazing Just the way you are

Before you cut it off after lines addressing the listener as a girl, you made sure to turn the screen to Mingi. His eyes went wide as the entry ACT COOL scrolled across the phone. What in his upset state he had mistaken for an air conditioner repair service revealed itself in a crawl to be quite different. 'ACT COOL......your crush is calling' was the label for Mingi in your address book.

Still processing his comment that he liked you, you decided to take the risk of being further open with Mingi and explained, “This song always makes me think of you.”

Mingi's face was unreadable.

It was possible you had insulted him. “Sorry it is a song for a girl. I can change it to the remix of Pink's 'F**kin' Perfect' if you want, or delete the number from my phone entirely and leave you alone for the rest of your life.” Trailing off sadly, you waited to see Mingi's reaction. The pause before he spoke was more than made up for when it went far better than you could have dreamed.

“I'm not hung up on gender, so that is not my concern. It’s more being thought of as amazing that I have trouble wrapping my head around. I get it when fans think that about my managed idol persona, but you have seen the real me.”

His easy acceptance of the lyrics about a woman made sense. Gender was never going to be a sticking point for someone who ran around calling himself princess. But it was a love song, and that had not fazed him either.

“You really do like me back,” he mused in wonder. Mood completely recovered from his earlier despair, Mingi followed up by asking with a smirk, “Isn't there something about kissing in the song? Lips being kissed all day if they would let the singer do that?”

He stepped closer, near enough for you to see tears from earlier still on his cheek. As you brushed them away with your thumbs, Mingi whispered, “I'd let you kiss me all day. It is something I have been thinking about for a while. That's why my apparent absence from your contacts hurt so much. I am sorry I did not believe you though. Letting my emotions run away with me is no excuse.”

Your face felt heated. This was not how you wanted your confession to go, if you ever had worked up the courage to say something. You doubted things would have made it that far on your own. Rather than jump into kissing, you took a slower approach more your style. “Thank you for the apology. It is appreciated.”

Now feeling a little more relaxed, you reached for his hands. “Truly, you are amazing, Mingi. Do you want me to stop saying things like that though? Would it be bad for you due to your anxiety? I don't want pressure on you to live up to my adoration.”

Mingi broke out in a stellar smile and you fell deeper in love. “No, I think it’ll be good for both of us to think of me that way.” With a final leftover sniffle, he suggested getting back to the others as he led you by the hand. Entering with a pair of wide smiles, the group was quick to notice the change in behavior between you.

Yeosang was the first to find his voice. “Somebody finally confessed?”

“About time,” Wooyoung declared loudly. “I thought I was going to have to sit you two down for a talk.”

Mingi was surprised. “You knew we liked each other?”

“Even I noticed, and I don't care about these things.” Jongho's teasing was evident when he smiled and added, “Congratulations.”

While the others chattered excitedly at the table, Mingi guided you to the couch nearby. It still had not sunk in what he meant when he mentioned writing lines about you. “You really wrote your part in 'Feeling Like I Do' with me in mind?”

“Yes, 'I want your love so bad' is all I can think when I see you. And you come to mind when I sing my lines in 'With U' and 'Thank U' these days.”

Filled with awe, you snuggled deep into his arms to help you both recover from the extremely stressful reveal. After some time spent in silence you had both calmed down somewhat. Your heart was still racing, but from a completely different reason at this point. Mingi's next words only added to that.

“I think it is time to change my name in your phone, don’t you? Boyfriend maybe?”

While some people might have found the label moving too fast, before a date even, your time together told you this was exactly what you were ready for. Typing away, you grinned after showing him the updated entry.

“'Mingi My Favorite Boyfriend Ever!' Really? That is a confidence booster but I have not even done anything for you yet.”

Burrowed into his chest, your smile was hidden but your voice carried the same indication of joy to his ears. “Certainly is true that you are my favorite boyfriend.” Dropping to a whisper, you revealed, “I have never dated before.”

Now it was his turn to grin. “I shall live up to the new title as if competing against hundreds in your past.”

“Okay, that is sweet Mingi, but sounds burdensome. Just be yourself because that alone is everything I could ever want.”

Using his newfound boyfriend privileges, Mingi kissed the top of your head to a chorus of boisterous cheers from his teammates. “You have me then. Now, let’s pick a good label for you in my phone so I can proudly show it off to the guys whenever you send me a message. I like your idea for 'F**kin' Perfect' as a ringtone if you are okay with that.”

You agreed immediately, hoping the self-affirming lyrics whenever you called would be a good reminder for Mingi not to be so hard on himself. And, if your new boyfriend considered you perfect too, well who were you to argue with him about that?

~

Mingi Masterlist

General Masterlist

#ATEEZ #ATEEZ Fanfic #Kpop Fanfic #ATEEZ Angst #Mingi Angst #Gender Neutral Reader #Mingi #Song Mingi #ATEEZ Mingi #Mingi Fanfic #cross posted on ao3 #Kpop Angst #angst with a happy ending #It was a rare day off #Mingi x Reader #Mingi x You #diverseinsertknet

[acorrespondence]

omg I'm so glad you reblogged this! 19, 32, 40, and any other one you want to answer!

19. Tell me a story about your writing journey. When did you start? Why did you start? Were there bumps along the way? Where are you now and where are you going?

Oh man, I really have no idea when or why I started writing because I don’t remember a time in my life when I wasn’t doing it! I started reading at three (I have a touch of the ol’ hyperlexia, as is fairly common with autism) so I suppose it must have been after that. Maybe my first year of kindergarten? (Yes, I went twice.) There were definitely bumps; when I was around ten, my dialogue was all “he said, she said” and existed pretty much as islands of quotation marks in the middle of blocks of description (when I say my biggest issue has never been dialogue or narration but the integration of the two, I’m not joking, though I like to think I’ve improved since then).

Anyway, when my dad read one of my stories and pointed this out, it led to something that my parents still joke about to this day: an opening sequence where I painstakingly described every member of a family around a table and their exact relationship to the narrator as they each, one by one, contributed a single sentence (or two, or a fragment of one) to the conversation, before the next person in the circle was introduced. This lasted for like two and a half Microsoft Word pages. Twelve point font, single spaced.

32. Answered here!

To make up for that (and because you offered :)) — 17. Talk to me about the minutiae of your current WIP. Tell me about the lore, the history, the detail, the things that won’t make it in the text. (This one’s for i put this heavy heart in you)

When Boyd and Raylan were in the first grade, they grew bean sprouts in science class. Boyd overwatered his, so he swapped out his plant with Raylan’s when no one was looking. Tragically, it died. Raylan knew Boyd switched their plants, but he pretended to think it was the little girl Boyd had a crush on so that Boyd would have to pretend to be mad at her on Raylan’s behalf or else admit his treachery.

Many years later, two-year-old Pemberley dropped an entire scoop of ice cream on the kitchen floor. When Boyd got back with the mop, most of the scoop (aside from what had been directly touching the ground) had disappeared. Boyd obviously blamed the child, and Raylan is a horrible person who let him believe this lie. But Pemberley ratted on him, and Raylan has never lived down this shame.

40. Please share a poem with me, I need it.

This poem has been attributed to Margaret Atwood, but the page where I originally found it has disappeared off the internet and I’ve never been able to find any other proof of its existence aside from a woefully unsourced livejournal post. It’s very beautiful, either way.

You Heard the Man You Love

You heard the man you love

talking to himself in the next room.

He didn't know you were listening.

You put your ear against the wall

but you couldn't catch the words,

only a kind of rumbling.

Was he angry? Was he swearing?

Or was it some kind of commentary

like a long obscure footnote on a page of poetry?

Or was he trying to find something he'd lost,

such as the car keys?

Then suddenly he began to sing.

You were startled

because this was a new thing,

but you didn't open the door, you didn't go in,

and he kept on singing, in his deep voice, off-key,

a purple-green monotone, dense and heathery.

He wasn't singing for you, or about you.

He had some other source of joy,

nothing to do with you at all—

he was an unknown man, singing in his own room, alone.

Why did you feel so hurt then, and so curious,

and also happy,

and also set free?

(Questions here)

#ask game #love-leah #poetry #justified #my fic #heavy heart #thank you so much for the ask!! #these have been so much fun :) #writing #you heard the man you love #long post #justie2justie communication #raylan/boyd

[lire-casander]

#29 doing something silly to cheer them up

doing something silly to cheer them up original prompt list here

TK notices something’s off with Carlos the moment his fiancé enters the loft. It’s in the way his keys clink against the ceramic plate Carlos’ niece Martina has gifted them with. It’s in the way Carlos seems to drag his feet across the floor instead of his usual sure step. It’s in the way even Carlos’ greeting sounds bland and dull in TK’s ears.

“Are you okay?” he asks, standing up from the couch where he’s been reading the latest installment in the comic he’s following. “You sound off, babe.”

“I’m fine,” Carlos says.

TK steps closer to him and kisses Carlos on the cheek; he can feel the tension oozing from every pore in Carlos’ skin. “You sure?”

“Yeah, I’m sure,” Carlos insists. “I need to take a shower, then I’ll make dinner, okay?”

“Fine,” TK replies, unsure of how to react before Carlos walks away and into the bedroom. As if on cue, TK’s phone beeps with an incoming text message. When he checks the screen, he sees it’s from Andrea. He can’t help to think that something bad must have happened. It’s not that he doesn’t talk to Andrea, but they don’t usually text each other after having lunch together that very same day.

Please take of Carlitos, he’s very upset, he reads on his screen. He frowns, but before he can text anything back, Andrea’s sent a new message. Celia has told him that she won’t be able to make it to the wedding. Her boss needs her in Manila for the whole week and there are no flights back in time from there.

TK sighs. He knows how important Celia is to Carlos; she’s his big sister, the one he looks up to. She’s also a very busy woman, with a boss that keeps her on her toes and, apparently, sends her to the other side of the world the same week she’d asked off for her brother’s wedding.

That sucks, TK replies swiftly. That man should learn empathy.

He missed that class in preschool, Andrea jokes back, but TK can read a hint of sadness between the lines. He knows she must be upset too; after all, there has never been a big Reyes family event where one of their members had to miss it.

After a few more texts, TK clicks his screen off and places the phone on the counter. He looks around, searching for a way to try and cheer Carlos up, and he comes up with the silliest way. He laughs to himself, and he gets down to work.

When Carlos gets out of the bathroom, he’s greeted with the sight of his fiancé in an apron, standing in the middle of the kitchen space, covered n flour. “I’m afraid to ask,” he says.

“I was trying to make a cake for you,” TK explains, turning around to face him. “It was a tight fight between the flour and me. The flour won.”

Carlos scoffs. TK counts that as a win. “You know better than to make such a mess in the kitchen,” he begins. “In fact, I’ve seen you bake a cake without a fuss. It’s the only thing you can do in the kitchen with your eyes closed. What’s really going on here?”

TK holds Carlos’ gaze for long moments before cracking up. “I know about Celia,” he finally admits. “Your mom texted me. I just wanted to cheer you up?”

“By making a mess in the kitchen?”

“By making a mess in the kitchen to see that could make you smile,” TK continues. He clocks his head to the side and looks at Carlos carefully. “Is it working?”

At first, it doesn’t look like Carlos is giving in, but after a few seconds a small smile finds its way, and it lights up Carlos’ eyes.

“It’s working!” TK exclaims triumphally.

“Only because it’s you,” Carlos says in a low voice as he approaches the mess TK’s made of the kitchen. “I love you so much.”

“And I love you,” TK reciprocates, leaning up to kiss Carlos’ nose.

“I know,” Carlos tells him, looking around. “Believe me, I do.”

#lire's 40 to the 40s #prompt 29 #prompt 29: doing something silly to cheer them up #tk strand/carlos reyes #carlos reyes/tk strand #tarlos #911ls #911 ls #911 lone star

[astra-galaxie]

"Now, we just need to get it on the back! Want to help me, Gigantor (Fili)?" - Danyon Wilson

Biographical information

Full Name: Danyon Wilson

Gender: Demi boy

Sexuality: Gay

Status: Alive

Age: 18 (season 1)

Birth: 1995

Race: Human

Nationality: American

Origin: Fairview, Grimsborough, USA

Residence: Fairview, Grimsborough, USA

Profession(s): High School Student

Partner(s): Noah Smith (boyfriend) (deceased)

Affiliation(s): Fairview High School LGBTQ+ Club

Profile

Height: 5'9" Age: 18 (season 1) Weight: 147lbs Eyes: green Blood: O-

Danyon is a teenager with short, curly brown hair shaved on the left side. He has bright green eyes and a blinding smile that can light up a room. In his case appearance, he wears dark blue shorts with teal suspenders, light blue sneakers with rainbow socks, a blue tank top with a darker vest, and a turquoise bandana around his neck. He also has multiple rainbow bracelets on his wrists, a heart-shaped earring in his right ear, and spare miniature flags in a bag attached to his belt.

As per his suspect appearance in The Ways of Death, it is known that Danyon has read Animal Farm, eats Nanaimo bars, and uses hair dye.

Synopsis

Danyon was the boyfriend of the late Noah Smith and a high school student at Fairview High School. He was the president of the school's LGBTQ+ club and an active member of the Grimsborough pride community. He volunteered at many local events in support of his fellow LGBTQ+ members and always looked forward to wearing his rainbow colours.

He met Noah at a rally outside of Grimsborough after convincing his parents to let him and his friends go for the weekend. He was surprised to see Noah there as he had heard stories about the man bullying others for their "differences." And yet, there was Noah decked out in rainbow colours, smiling and having fun with his friends. He couldn't believe his eyes, so he decided to talk to Noah and find out who he really was.

After the first awkward conversation, Danyon and Noah exchanged phone numbers and began texting. Soon they became friends and later boyfriends. They discovered they had a lot in common, and Danyon learned about the Noah behind the mask. He was pleasantly surprised by how friendly Noah was once you got to know him and loved his tiny nervous laugh.

Danyon began helping Noah to apologize to those he hurt in the past. When Noah returned to Grimsborough for the culture festival, Danyon introduced him to his friends and members of the Grimsborough LGBTQ+ community. It was hard for others to accept that Noah wasn't the man they thought he was, but they gave him a chance to redeem himself.

When Danyon learned of his boyfriend's murder, he was heartbroken. He had JUST been talking to Noah at lunch, and while his boyfriend complained of a stomach ache, Danyon never thought Noah was actively dying! He wishes he had stayed with Noah; maybe then they would have realized something was wrong and could have gotten him to the hospital in time to save him. But Danyon will never know if that would have saved his boyfriend…

After Noah's father was arrested, Danyon was furious at the man. How could he kill his own son just because Noah loved another man?! It wasn't fair! Noah was doing so much to turn his life around, and this was how fate repaid him?! He should have been alive, graduated from university, and started a career; maybe even he and Danyon could have gotten married! But now, those dreams can never come true…

But even if Noah was now gone, Danyon is happy that his boyfriend got the justice he deserved. He vowed to do everything he could to ensure Noah's true self lived on in his memory and even has plans to one day create a foundation for youth in need in honour of Noah. He knows it will take time, but he doesn’t doubt that Noah will be watching over him. Danyon hopes one day, they will be able to reunite on the other side and be together again, happy and safe in each other's embrace.

Story Information

First appeared: The Ways of Death

Trivia

His name comes from two IRL gay men that I know

Likewise, his personality is based on the two of them

He aspires to be an elementary school teacher and do cosmetology on the side

He has a condition that is making his hair turn prematurely gray, so he dyes it brown

I themed his clothes after the gay flag (a mixture of greens and blues)

Disclaimer: Character design was created using Rinmarugames Mega Anime Avatar Creator! I have only made minor edits to the design! Background courtesy of CriminalArtist5

Links to my stories:

The Case of the Criminal (Ao3/Wattpad) Killer Bay (Ao3/Wattpad) Where in the World are the Killers? (Ao3/Wattpad)

#criminal case #astra's ocs #my ocs #criminal case grimsborough #grimsborough

[ravenloftbythelamplight]

what're some fun facts and/or dreadful curses about your party? i wish to hear as many juicy details as u got about these poor unfortunate souls O:

Ohohoho we've only had three sessions but I very much so have thoughts to say regarding the party of four that my players have handed to me. Possibly, too many thoughts, but nevertheless! I'm gonna go through in order of the introductory vignettes from session one for the sake of convenience, talk about my thoughts on each so far, and give some fun facts (and dreadful curses) along the way.  I originally spent a day typing this out in a document on my phone and oh lord this is way longer than I thought it was, apologies in advance for the wall of text-

Kestrel: Out of all the members of the group, I as the DM know the least about Kestrel. This is due to factors mostly out of game, but in game I too would say this is the result of our desert-wandering tabaxi cleric being the most (I say this lovingly and this is the best word I could think to use) "average" among the party. By that I mean he could've very easily been put in with the PCs of a non-Ravenloft campaign and would fit right in, likely even more so than the actual group he's gotten himself saddled with. I, personally, think this is a stroke of genius for a number of reasons. They're the everyman archetype as someone who neither lives in and has thereby adapted to the nature of Ravenloft nor someone not tied to the setting but is still horror-based; a regular, unwitting person with no expectations for the terror that awaits. Kestrel's average-ness, in fact, makes them stand out amongst the other party members. He both sharply contrasts with and balances out fellow setting outsider Lemeia; a contrast that makes their dynamic and fast friendship such a blast to watch. I'm also excited to see how his dynamics with the other two evolve in the next session. So far Kestrel has stood as a neutral anchor-point amidst Brynmor's fear-driven worry, Nocturna's jovial indifference, and Lemeia's eerie fascination: understandably afraid in the face of their current predicament, but for the most part remaining level-headed and curious. I would not boil them down and describe them as "holder of the sole brain cell" because that just wouldn't be true, but he has been a grounded and often inquisitive facet of the group; not quite the voice of reason just yet. They haven't had any particularly big moments to themselves asides from discovering the dismembered mannequin in the kitchen, but I hope to ensure that such won't be the case for long. Fun fact time! Kestrel has an interest in plants! His character sheet has the herbalism kit and a journal of notes on plants and herbs listed in his inventory, and his player inquired on if The House had any potted plants to study during session one. Planning on having them get some in-world translated books on domain-native plants and seeing what they're able to do with that. Unsurprisingly for a character decidedly not steeped in dread like a nightmare-themed tea bag, Kestrel lacks a great deal in possible dreadful curses. However, they were the only member of the party to have been, uh, gently pushed in the direction of The House by shadows rushing past at the corners of his vision. This could come back as something of note, but as of now I'm not exactly sure on a good plan for that. His backstory is likely to, maybe literally, haunt him as well.

Nocturna: Nocturna… ooooh boy oh boy where do I even begin? The party's Lepalï (homebrew from somewhere online I was sent by player) warlock hailing from The Carnival as the child of two illusionist performers is a character that I and their player had discussed many 'a time prior to the beginning of the campaign proper. They are… well, they're a lot, which is quite fitting. If it gives any strong indication: with no prompting or prodding from me, the player had Nocturna sprint head-first into the mists completely ignoring the immediate concern of the other Carnival residents and this act was entirely on brand for both player and character. Additional note, as relayed to me by their player, she has also definitely done this more than once before. Yep. A never-ending fountain of whimsy and mischief, Nocturna has taken the situation in stride; seeing the investigation of The House as a fun adventure rather than a omen of ill occurrence. They've ran off from the party to explore, drawn on the walls, tore a hole in another wall, and solved a major puzzle without actually fully solving it; they're just hear to have fun! Incredibly reckless fun! The whimsy, however, belies the single-minded determination that she has found herself gripped by on multiple occasions over the course of the time spent in the house. Putting others at risk, literally knocking Brynmor over and trying to dig through his equipment, in a desperate bid to pry a basement door open. This aspect of her character hasn't been explored in a lot of detail yet, but it's something that might prove interesting later. Speaking of Brynmor! I could and probably will make a whole post of its own just to ramble about the two's dynamic. Seriously. Solo moments of note include stealing the mask of one of the dining room mannequins, and then a session later punching said mannequin to the ground. Also, the entire mini-saga of double nat-1'ing on trying to open the basement door. Fun fact: They're not only a magician, but also able to draw and play multiple musical instruments well. A performer of many trades! I have a hunch that they might be multiclassed into bard at some point later down the line. Potential dreadful curses, at least at the moment, are more so in line with her patron than anything else. This isn't to say The Carnival doesn't have anything in store, but the most obvious of the warlock business will likely come first. At the moment we're at in the campaign, Azalin Rex isn't actually aware of the fact that he's got an unaccounted-for warlock running around with an object he had intended for someone else to have. This is the lord of Darkon we're talking about though, and he'll have some sort of scheme in mind for her in no time. Whether or not Nocturna actually cooperates is yet to be seen, and the king isn't in much of a position to seek aid elsewhere.

Brynmor: Going in I had little to no expectations for what Brynmor was going to be like. To my absolute delight he has very quickly become a wonderful piece of characterization from his player and an absolute treat to behold. Dragonborn ranger born in Barovia to a mother known in the village of Krezk as a defender and protector against that which lurks in the night, Brynmor has made it his goal to follow in his mother's footsteps and face monstrous threats with strength and courage. He is also an absolute dork and very afraid of the possibility of actually stumbling across something that could harm him or those he intends to help; qualities which are very understandable for an ambitious 18 year-old who's never really left home until now. This guy left Krezk and immediately climbed the goddamn Balinok Mountains in the middle of fucking winter and now he'll never live decision down and I love him for it. In stark contrast to Nocturna, Brynmor has taken every step of the party's exploration of The House incredibly seriously: arguably, depending on your own view, too seriously. He's extremely fearful about whatever it is that must have brought them all to the house, and especially paranoid about it being in the house with them. Incredibly cautious and equally as concerned for the well-being of his newly-found compatriots, but still trying to lead the charge. He's no leader, though, especially not where he's at now. He's reached beyond his means, and I'm excited to see where his ambition might lead him; for better or for worst. Our boy here has had a few good solo moments, of note being his realization that the strange set of stairs at the back half of the house lead nowhere and make absolutely no sense physically, and the absolute terror that realization caused him. Also, just, the way his dialogue is phrased a lot of the time is really fun. Final fun fact: One of the times in Brynmor's inventory is a old, worn book of nursery rhymes (via the horror trinkets table in the 5e VRG). The player and I have decided that this was a book that his mother would had read to him often as a child, and that he brought it along on his journey up the mountain as a keepsake. Dreadful curses is the name of the game when it comes to the mists and for Brynmor this is no different. Knowledge of undead creatures and sinister forces has been passed down through his family and onto him: one such piece of knowledge being the true scope of Strahd von Zarovich's status and power as a vampire. What Brynmor doesn't know is that his family has been a mild thorn in the lord of Barovia's side for some time, his grandparents having been the sole surviving members of an adventuring party pulled into Barovia by forces unseen many years before the beginning of the campaign.

Aaand that's it that's the whole post-

#dm thoughts #ravenloft #I'M SO SORRY CHURCH I AM MAKING YOU READ AN ESSAY'S-WORTH OF TEXT #What's worse is that this isn't all of my thoughts I STILL have to finish the session summaries #As you can tell the brainrot has set in fully; we're in the thick of it #I'm being consumed by it as I type #also of note #character tag: Kestrel #character tag: Nocturna #character tag: Brynmor #FINALLY #PLAYER CHARACTER TAGS #LET'S GO #I might do them differently later but whatever

[kaequeerlit]

Close Reading Essay

I really enjoyed writing the Close Reading essay. I chose to write about the Biblical story of David and Jonathan. The topic was particularly interesting for me because I was heavily involved in a more conservative denomination while also being incredibly outspoken about LGBTQIA+ rights (and somewhat publicly out of the closet) through my teen years. This was the first essay I wrote in a few months, so it was a reintroduction and a reminder of my strengths and weaknesses. One thing I learned was that interpretations of "holy" literature that are outside of the religious norm should be accepted and even encouraged. I'm really proud of how well I expanded on my essay, as I selected a relatively short passage. I also thought that I did a good job comparing the chosen text to a different one that is well known. So, if someone was not familiar with the original story, they have one that they can connect with.

By Rembrandt

“After David had finished talking with Saul, Jonathan became one in spirit with David, and he loved him as himself. From that day Saul kept David with him and did not let him return home to his family. And Jonathan made a covenant with David because he loved him as himself. Jonathan took off the robe he was wearing and gave it to David, along with his tunic, and even his sword, his bow and his belt.” (1 Samuel‬ ‭18‬:‭1‬-‭4‬ ‭NIV‬‬)

David and Jonathan: Queer Before Queer

This passage briefly discusses the relationship between David and Jonathan. Saul was king at the time, as well as Jonathan’s father. David was a well known member of Saul’s army who impressively defeated very intense foes. He also became king later on, but that isn’t that important to this interpretation. Jonathan and David were in love, feeling intense care for each other that goes well beyond the bounds of friendship.

This section is set in between David killing Goliath, head of the enemy army, with only a slingshot, and Saul attempting to murder David. Jonathan gets close to David, even warning him about Saul’s plots to kill him which could lead to his own demise. Their relationship is concreted, setting up deeper actions in future chapters of 1 Samuel and the first chapter of 2 Samuel.  

One word that really sticks out in the passage is covenant. “Covenant” is used heavily in the bible, typically referring to a promise made by a human and God. It’s also used between people to form a heavily weighted promise between each party. A covenant is not casual, and someone would not use it to discuss a simple and/or small promise. The term covenant is also brought up in the context of marriage, which is also described as the combining of souls in the christian community. 

A frequently repeated phrase in these chapters is “loved him as himself”. It is used three times: twice in the selected passage and once in chapter 20, “And Jonathan had David reaffirm his oath out of love for him, because he loved him as he loved himself” (1 Samuel 20:17 NIV). The third time is right before Jonathan sends David away as a precaution so that his father does not kill him. Later on in the same chapter, Jonathan questions why David deserves to die, getting a spear thrown at him with intent to kill him (1 Samuel 20:32-33 NIV). He almost died for defending David’s right to live. Loving someone as yourself, and potentially sacrificing yourself, are such passionate feelings. This phrase is also reminiscent of marriage vows, loving someone so fervently.

Jonathan giving David not only his robe, but his tunic, sword, bow, and belt says a lot about the intensity of care Jonathan has for David. Giving only his robe would have been plenty, especially for a friend. Jonathan went so above and beyond the typical response in a way that someone would only do for a lover. Or, if you were the physical manifestation of God, and since Jonathan is merely human, it shows fierce love for David. 

David returned Jonathan’s feelings, and that is shown so well in the mourning of Jonathan’s death. “I grieve for you, Jonathan my brother; you were very dear to me. Your love was wonderful, more wonderful than that of women” (2 Samuel 1:26 NIV). Although the text says brother, it’s important to remember that this version of the bible was published in 1973, a time in which queerness was not accepted by mainstream society, and almost three decades after the word “homosexual” first appeared in the bible. David describes Jonathan’s love as more wonderful than that of women, expressing the intensity of love, and expresses that Jonathan was very dear to him. Queerness is a spectrum, meaning that David could have had romances with women while still being deeply in love with Jonathan. In fact, the only time we see him do anything that could be perceived as doing something for a woman was when he killed hundreds of Philistines to fulfill Saul’s wishes in order for David to marry one of his daughters. David did not complete the mission out of love, he did it for political and societal gain (1 Samuel 18:22-30). 

Jonathan and David’s story shares similarities to one written by another probably not heterosexual historical figure: Romeo and Juliet by William Shakespeare. A common way of looking into potential queerness in writings is either replacing one love interest with someone of another sex and/or thinking about heterosexual couples that share similar story arcs. Romeo and Juliet’s story and David and Jonathan’s include some of the same plot elements, when you pull them apart. Some similarities include familial disdain, attempted murder, passion for each other, and intense grieving. In Romeo and Juliet, their respective families are none too pleased with their mutual romantic interest. In the biblical passage, we do not see the perspective from David’s family, but Saul’s jealousy turned hatred of David is made obvious to readers. Murder (or attempted murder) is discussed in both stories: Tybalt killing Mercutio, and the many murder attempts made by Saul directly or indirectly.

Their relationship can never be defined for certain: they may have just been best friends, found family, or something much much more. The best friends to brothers to lovers pipeline might be in effect here, but it might not. We can all agree that they loved each other with such passion. What kind of love is a query for the ages.

[thisisyouridol]

tell me about your aitsf au im so curious whats the deal…

anon i wanna make out with you sloopy style

i love talking about the name origin so ill explain that really quickly: eudaimonia is a greek word that basically means “division by good means” or a “great (as in positive) divide”. i called it this because i consider this au like an other side of the coin type deal, in ai1 saito briefly considers the fact of what would have happened to all of them if he had never killed manaka, this au is like, my take on that.

ah i dont wanna just have a block of text click the thingy you sexy thing you

yeah this is a manaka lives au. saito still goes on to become the other half of the cyclops killers, but he gets much less enjoyment out of it because his assiociation with killing is not as important and does it mainly at rohans behest. his relationship with his father is better / worse also because him sabotaging the plant never happened here either. points of the main plot still happen like the second psync machine, hayato and saito’s psync, but because there IS no hit on iris and hitomi theres a lot of stuff i move around (like the hayato rohan psync, how hayato comes to find out whos the cyclops killers, etc etc) and i decide to do some hand wavy magic, the hayato and saito psync goes weird—because they both have the capability to psync. they both kind of get kicked out of somnium.

in my au psyncers are a much rarer commodity, and i only have plans to include saito, hayato, mizuki (no bibi here srry), + ryuki as psyncers. being a psyncer in this au means that unless you are compatible with that other psyncer, you cant psync with them. so, mizuki can psync with ryuki because they get along and emotionally are connected, whereas saito and hayato hate each other.

back to what i was saying. anyways the plot is a little spotty here bc this au is actually like a sitcom to me but ultimately boss finds out that saito can psync, blackmails so sejima with his murders, and lets rohan take the fall for all of it. she basically comes to “own” saito and they take a lot of measures to control him. he changes the way he looks (see ponytail) and has a plate enforced in his head (the thing that looks like a eyepatch), and changes his last name. hes forced to live with hayato who looks over him and makes sure basically he doesnt kill anyone while working as special agent / himself because hes on like five different medications to make him normal-core.

for hayato he still left hitomi (who co-parents iris with manaka) because of his sordid evil past or whatever. he comes to reconnect with them when iris is like 14-15 and saito is like jesus fucking christ [realizes everything is connected.] mizuki also lives with saito and hayato but not like consistently she just stays over a lot, renju has a very faint idea of who saito is bc hes smart like that but lowkey he doesnt gaf bc hes also neglectful like that. hes like hayato my drinking buddy can you and your murderer boyfriend watch my kid for a week thanks love you ❤️ legally they cant talk ab what saito did, his father, you get what im saying here.

saito, like date, is given aiba after a year of being with abis, she’s meant to be a companion but also takes the role of keeping him in check so hayato can take a back seat regarding that. she shocks him all the time mainly for fun. saito also doesnt have the authorization from boss to use weaponry so hayato tends to hav tag along with him, saito is not allowed to kill because boss considers it an “addiction”, hayato does it for him basically so he can stay “clean”.

hayato is also considered a consultant for abis rather than being a official member because he doesn’t have a ai-ball partner, he’s given tama about two years after saito is given aiba. if you’re wondering where that leaves ryuki and mizuki, ryuki gets maruko and mizuki and saito share aiba.

the plot of ai1 doesnt happen here (so a lot of characters stay alive and they never learn certain things ahh!!) but im working on a murder mystery plot based on ai2, it’ll have to do with ryuki and his family mainly. ill be honest and say i dont really like aini but i love some characters so theyll be here too!!

theres a 100 things i could say but im trying not to infodump lol if you want to know more ab a specific character pls shoot me another ask ill tell you everything ily .

heres some old fic stuff as a treat from me to you

#content (of mine) #ai: the somnium files #au: my very happy divide / eudaimonia #this is your idol speaking #manaka and saito have a very complicated relationship i didnt get into it here but they talk. and its weird #its a lot and i already said a lot id need like another post for all of that #but saito is in a position where he sees iris a lot and iris is much much weirder in this au she has something going on there

[futarinokinenbi]

From 2002:

M→S

About Sho-chan~, he's in a drama that's been airing since January, he's having a big break. The extent of this big break is that there's a big director from the US who watched Kizarasu Cat's Eye and said, "Amazing!" promoting Sho-kun specially.

It's like Sho-kun has debuted in Hollywood (laughs). There's an intense love scene in that movie, something we haven't seen before. So, to succeed you have to shed off old skin even in acting (laughs).

And then, having to repeat a year because of doing activities like that... Saying that is bad luck, so because he's so busy with these activities, Sho-kun's college life also receives attention. Please do your best, even more than before!

S→M

About Matsumoto-san, this time he has something like a special episode as Kindaichi Kosuke! Kindaichi Hajime is of course Kindaichi Kosuke's grandchild (laughs). It's not like that, you understand, right? (Laughs) Middle-aged Kindaichi's Case Files... That-that's stupid.

{Note: The original series is Kindaichi Shounen Jikenbo, in other words, Young Kindaichi's Case Files. He changed it to Chuunen}

And I would like to see Matsujun's short hair. That guy, his forehead's hairline is becoming like a Saiyan's. That's why if his hair is spiked up he will really become a Saiyan.

I will keep praising him, "Short hair looks better, you know~" so that he'll go with short hair. Somehow, if everyone keeps praising you like that, you'll sort of think, "Eh, is that right?" and go for it, right? (laughs)

#sakumoto #2002 #source: magazine #the other day i watched vs damashii which nino hosted #it made me emo #as usual japanese text on blogspot and it has other members as well #nino is talking about aiba changing la tormenta lyrics #or how he doesn't actually speak japanese #aiba says that sho keeps repeating his jokes so he's tired of them #aiba wants a foreigner gf lol #ohno is not nii-san yet he's satossan #he's determined to change himself and yet jun and aiba don't think that he will #the original text has each member talking about the other members + himself #not sure what the main topic is maybe something like expectations and hopes