#g witch episode 22

[lordsmaf]

MIORINE'S MOM PUT A SECRET MESSAGE IN WHAT???

#g witch episode 22 #gwitch episode 22 #gwitch spoilers #g-witch spoilers #suletta sunday #gwitch #g-witch #g witch #wfm #twfm #screencap #suletta mercury #miorine rembran #rouji chante #secelia dote #gundam the witch from mercury #mobile suit gundam: the witch from mercury #the witch from mercury #witch from mercury #gundam witch from mercury

[adracat]

G Witch 22 thoughts

Banger episode this week! I loved every single minute. My only gripe was that it felt far too short. A pox on these weekly waits. Future binge watchers don't know how good they have it

Very much enjoyed the doubling down on QZ's destructive power and complete supremacy. No matter how many weapons/ships you have it doesn't matter because Aerial can just override them. It's a good establisher of stakes.

Mio burrito spotted. She is looking so rough here. Completely unsurprising she won't acknowledge Guel though. He had no sway on her even on her best days. Sorry, my guy. You lack Suletta's magic touch. Only she can play the Mio whisperer now

DEMI BARDING!! Big fan of that chonky suit after Asticassia ep so glad it's getting more use. I don't even care that I'm being manipulated into buying another kit. Secilia is a real one, glad she sat her butt down so the world didn't implode

This was a nice moment and gave Suletta closure on 4lan. He was someone she cared for, no matter how brief. That revelation about her list being Prospera's idea was a bit of a shocker tbh. I just thought she constructed it from the media she watched/read. The truth is way worse lmao. I guess it was meant to acclimate her to the school and therefore the dueling games for Aerial? Little did Prospera know that Suletta's dork charm would snare the heart of Delling's daughter immediately.

This was sudden but a joy to watch. I suppose Guel was tired of being Mio's ineffective secretary lol. But in all seriousness, this was sweet of him to arrange a duel so the lovebirds could be reunited. You've become a solid bro, Guel. Hope nothing dire happens to you.

Btw, I fully expect some fanfic authors to leap on a fencing au now. Pretty please?

This entire scene was so Utena I couldn't believe it. Well, actually the entire episode was littered with Utena but still. The baring of their mistakes. The acceptance of their faults. GOD this was so amazing.

I love how far Suletta has come in her development. Such an excellent change of mindset from viewing her time at Asticassia as a mistake to fully believing meeting Miorine was a blessing. She's so confident in her feelings

THEY'RE SOMEDAY TOGETHERINGGGG I see you Okouchi, giving us rabid Utena fans the good shit. This show is such a great homage in so many ways but this episode takes the cake! (Bit concerned that Suletta didn't verbally promise anything, just smiled fondly. Perhaps wistfully?)

This gave me such an unpleasant jumpscare though. The deliberate framing with Mio's bare legs followed by catastrophic bedhead freaked me out. I could have done without the Anthy reminder, thank you. Made such a sweet moment feel a bit horrific. I envy those who are oblivious to what I'm talking about

But this was so very sweet. I was getting misty-eyed. These babies have been through so much yet the truest thing is their love for each other. Their relationship remains the emotional core. Side note: Mio why are you the size of a housecat? Just how small was Notrette even

I'm glad I was correct in my read that Earth House doesn't truly blame Mio for Earth, only her staunch refusal to seek help. This was a nice little moment as was her brief words to Delling. Sleeping beauty certainly took his sweet time. I do wonder what he makes of this chaos?

Guel's reservation about Suletta heading to QZ is understandable but as she says, it's her choice. And Mio won't let anyone else decide Suletta's fate as she did before. Her quick death glare at Guel was so funny. Mans can only slap himself into complaince. Even when not engaged to Mio, he still obeys like a loyal sidekick lmao

Didn't expect this quick Shaddiq convo. I like how he recognizes instantly that Mio is better because of Suletta. It's very in character for him to accept Suletta's importance in Mio's life without resentment. I am wondering at the deal Mio makes with him. What could he possibly do for her? Perhaps it's Earth-related

At first I thought this was the sweetest thing. I still think it's sweet, but I also find the phrasing incredibly... weird. Not 'I'll always love you?' 'Always be with you'? Instead 'I will always be attached to you'. Could be nothing but it still sounds vaguely ominous. And it's coded in the genetic sequence of her tomatoes all things. The hell were you doing Notrette? Nice nod to mythology here though. Anesidora is an epithet for Demeter, an agricultural goddess, and Pandora. And like Pandora, Notrette unwittingly released evil in the form of QZ and possibly collaborated with Prospera to upload Ericht's biometric signature.

Aww farmer wives on Earth please! Still don't like Suletta only smiles when Mio declares anything future related. I get the rudest feeling she's not making hard promises because she's too aware of the peril. They look so happy here, so imma ignore the danger signs and just bask in their affection.

Mio forcing aside her own fear to support Suletta was so good. She was so relieved when Suletta broke Permet 5 alive, bursting into tears afterward. It was rough for me to hear Suletta gasping in pain, so I can't imagine how Mio must've felt. I don't ever want to see people claim she doesn't love Suletta ever again

I have thoughts on Calibarn's design (Utena spoilers) and place in the plot, but for this review I'll just say it looks neat. I wish it was a bit more unique, but it makes sense they need it to resemble its sibling plus its obvious Vanadis roots. That boom broomstick is super cool though!

I enjoyed Prospera's muted reaction here. She's surprised by Calibarn but not intimidated or angry. I'm sure she has complete faith in Eri's ability to handle this hurdle and her daughter's commitment to the plan. She must know Eri loves Suletta, but assumes it ultimately won't change a thing. For now, at least.

You know, I expected Lauda to lose it but I didn't expect him to be this stupid lol. You can't even use the damn GUND format idiot, you really think you'll beat your brother? I can't believe I gave him even the slightest bit of credit. Easily the worst character in the show. I hope Guel crushes him (and he doesn't get Guel killed in the process)

Petra deserves better 2023!

Ah and Eri peeks her GUND ghost form out to say hello before clashing with Suletta. This is an incredible shot, love the visuals as always. If it goes full Utena as I suspect, we'll see Eri break/override Calibarn. The name of a holy sword bashing at the Gwitch Rose Gate doesn't bode well. What that means for Suletta is anyone's guess, but I have faith she'll live. I fully expect her to get assistance of some kind. After all, the show has been telling us all along that working together is far better than struggling alone!

#BLESSED DAY #THE GIRLS ARE BACK #g witch #g witch spoilers #suletta mercury #miorine rembran #gundam witch from mercury #sulemio #guel jeturk #lauda neill #earth house #calibarn #g witch episode 22

[tiredfloridianbutverygay]

"A ray of hope we can see! Gundarm Inc, Gundarm Inc forward into the future! She's safe and strong reliable and cool. She can fly and dance she's Calibarn!” This witch... flies a Gundam!

#G Witch episode 22 #gundam suisei no majo #Mobile Suit Gundam: The Witch From Mercury #gwitch spoilers #gundam calibarn #suletta mercury #g-witch #g-witch spoilers #gundam the witch from mercury spoilers #gundam the witch from mercury

[the-eeveekins]

Midnight at the Sulemio Household

#they're perfect for each other #i made this meme after episode 22 #g witch #sulemio

[leminoh]

Not Sunrise giving us a fencing duel between Guel and Suletta that's so out of place and goofy to animation flex but also shoehorn her back into being the holder just because they can.

I should hate it, but I can't.

Guel and Suletta are both dorks and I can totally see them having a dance battle to figure out who gets to play first on the playstation in another universe.

#g witch #suletta mercury #guel jeturk #gwitch spoilers #gwitch episode 22

[lemonlilypufftangerine]

#I had to do it to em #Everyone should watch Gundam G Witch #I've never watched a gundam before and that makes me no less of a valid watcher #Came for the wlw stayed for a very engaging story #But for real episode 19 really cements Lady Prospera/Elnora as a villain for how many Earthians she absolutely killed #Still love her tho as a villain #g witch #Mobile suit gundam the witch from mercury #prospera mercury #ericht samaya #Vanadis crew #suletta mercury #Love you Suletta #Ep 22 mostly had her accept all her closest family are space war criminals #Meme #Gundam spoilers #Gif

[loreofthejungle]

Packing all that in a single episode was certainly a choice someone made...

#g witch #g witch spoilers #gwitch episode 22 #im kinda worried they're being rushed

[pencil-peach]

G Witch Onscreen Text: Episode 22

Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.

<< If you forgot, Episode 21 will remind you of What You Can Do Now Or you can go to the Masterpost.

It's the dawn of a New World.

After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.

TEXT: (Lefthand side) - Link Strength with Aerial currently

(Middle) System Report -Permet Inversion Reactor STATUS:

Permet fluctuation reduced to [???]

Topological heat exchange catalyst replenished

Permet inversion reactor output decreased to 61%

Permet field stabilization in progress

(Righthand side) - Link Strength with Gundnodes currently

Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...

I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.

It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....

The news report Rouji presents is from PNB, and the headline is:

Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero - Assembly League fleet devastated, evacuation warnings issued over wide area. - Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."

It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.

The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).

We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.

Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force. In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.

I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.

Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.

But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.

And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).

On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.

Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)

Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.

Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.

In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.

At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.

Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.

In the end, it's not violence that allows Suletta to rescue Miorine. It's love.

And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.

When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.

Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.

And sometimes, he's still your dad.

Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.

It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...

It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.

Rolls up my sleeves

(Left, Top to Bottom) Quiet Zero - Current status summary

MOBILITY - After restart, movement velocity of enemy basepoint is predicted to increase - Velocity of each enemy MS also predicted to increase by average of 37% - Evasive Maneuvers of main unit will be complex

DEFENSIVE FUNCTIONS - Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach - Defense barrier strength 67942049 - Very difficult to invade domain while mutual defenses of basepoint and MS are linked

(Right, Top to Bottom)

WIDE-AREA DATA STORM CONTROL FUNCTIONS - Expands data storm domain and stabilizes it over a wide area - Domain is predicted to expand further in future

DATA STORM DOMAIN - 60%

PERMET DISPERSAL SYSTEMS - Permet dispersal index exceeds 200 - Permet density x 27.1 - Density increase is accelerating

REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES - Increases interconnectedness of overall enemy - Each MS appears to become a sub basepoint - Basepoint and all Gundnodes are linked - Link multiplexing confirmed, jamming impossible

A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.

In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links

(Baori Pack) - Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions. - Can also be separated from the main unit...

The 'Daedalus' multi tool system...interessante...

In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).

When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.

If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.

I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.

Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!

Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions

I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.

The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.

If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.

In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.

'CGG' functions as a blank space between words.

So, for example, if you wanted to write, "I love you, Suletta." The code would be:

GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT

In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)

I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.

You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.

But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice. (The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)

Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.

Sibling fights....

It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...

To find out, Click here to go to Episode 23 >> Or maybe the Masterpost could remind you.

#g witch #gundam the witch from mercury

[knackeredforever]

What I expected in g witch episode 22: More Gundam warcrimes

What we got: EN GARDE MOTHERFUCKER

#g witch spoilers #g witch #Gundam #mobile suit gundam the witch from mercury

[animefeminist]

Chatty AF 179: Mobile Suit Gundam: The Witch from Mercury Part 1 Retrospective

Vrai calls in Gundam experts Maddie and Megan to discuss the very ambitious and very queer first cour of Mobile Suit Gundam: The Witch from Mercury!

Episode Information

Date Recorded: February 1, 2022 Hosts: Vrai Guests: Maddie, Megan

Episode Breakdown

0:00:00 Intros 0:01:35 Background 0:04:19 The Gundam franchise and Universal Century 0:10:15 Gundam: The Origin 0:10:58 Suletta as Gundam’s first female pilot protagonist 0:13:37 The novelty of a two cour anime 0:15:19 Wow cool robot 0:18:22 Military appropriation of medical tech and portrayal of disability 0:23:41 It’s gay too 0:27:11 Reading Suletta as autistic 0:35:24 Guel 0:38:59 These KIDS (GUND-ARM Inc) 0:41:21 Miorine 0:42:51 Prospera 0:47:25 Aerial’s short story 0:48:20 The Manchurian Candidate 0:52:13 Part 2 theories 0:55:41 Gundam recs for G Witch fans 0:58:39 Outro

#mobile suit gundam witch from mercury #gwitch #the witch from mercury #suletta mercury #miorine rembran #sulemio #prospera mercury #guel jeturk #podcast #chatty af #UC gundam #SoundCloud

[mayhem-ensues]

A little negative here, but after reflecting on it, I'm in a weird postion after G-Witch episode 23, in that I really enjoyed the episode itself, but like, after watching it I'm now worried about the finale in ways that I wasn't before I watched the episode.

I really would have preferred for the last episode to put a nice bow on all the characters and relationships they've established in this show. Particularly Sulemio and Suletta and Prospera of course. But the last-minute introduction of the giant space laser and the Space League/Peil stepping in to be the final villains of the show means the last episode is gonna be much more plots driven than character driven, which is the last thing I want right now. Especially since the SAL/Peil plot is much less compelling than the Quiet Zero plot, and they haven't really established a proper villain for this conflict. Like, how we going to go from Prospera and Eri as the biggest threats in Episode 23 to like, fucking Elan Prime or some nameless Space Assembly members for the finale? Cannot think of a bigger downgrade right now.

And like, with only 22 minutes to sort out everything the show has set up, I really think some characters and subplots are going to miss out, and I just really hope that they make the right choices about which characters and relationships need to be prioritized here.

And the thing is, I personally think this is something they've struggled with in the 2nd Cour. Like, I'm not going to name names, but there are times when the show put focus on secondary characters and subplots when that time could have been better spent on the main characters.

Like, I cannot explain how dissapointed I'll be if we're robbed of a satisfying conclusion to Sulemio or Prospera because the show decided the last episode needed to be about a conflict with less compelling characters and thematic weight then the stuff we've already dealt with.

#sulemio #suletta mercury #miorine rembran #prospera mercury #gundam witch from mercury #g witch #g witch spoilers

[lordsmaf]

THE CALIBARN HAS A BROOM AS A WEAPON

BECAUSE OF COURSE IT DOES

BECAUSE SHE'S A WITCH

FROM MERCURY

#g witch episode 22 #gwitch episode 22 #gwitch spoilers #g-witch spoilers #suletta sunday #gwitch #g-witch #g witch #wfm #twfm #screencap #gundam calibarn #calibarn #suletta mercury #gundam the witch from mercury #mobile suit gundam: the witch from mercury #the witch from mercury #witch from mercury #gundam witch from mercury

[tiredfloridianbutverygay]

Okay but like Guel totally threw this fight right? Like he knew the only one Miorine might be willing to open up to was Suletta, her former bride. Because that’s what it came down to in the end, doesn’t it? Protecting Suletta, even when the plan totally backfired and Prospera out-maneuvered Miorine, that had been the only thought on Miorine’s mind. Protecting Suletta and getting her away from her crazy-ass mother.

#Guel Jeturk #G-witch episode 22 #gundam suisei no majo #mobile suit gundam the witch from mercury #g-witch spoilers #suletta x miorine #suletta mercury #miorine rembran

[the-eeveekins]

The true G-Witch moment that's "up to interpretation" is what Suletta and Miorine did in Mio's room after holding hands in episode 22.

👀🤭

#they did it #the cool and hots positioning? #suletta ate well #sulemio #g witch #the witch from mercury #gundam the witch from mercury #suletta mercury #miorine rembran

[sunnydaleherald]

The Sunnydale Herald Newsletter, Monday, April 22 - Tuesday, April 23 Part I

KENNEDY: And this is gonna help us how? DAWN: The sand forms a circle. The circle acts as a barrier. And the barrier contains the portal. KENNEDY: Now what? We hold hands and chant kumbaya or something? WILLOW: Maybe. 'Til we get the magicks up and running, I'm kinda working on my best guess here. XANDER: Will, maybe we should wait. KENNEDY: For what? XANDER: Spike - to see if he can bring back that demon. WILLOW: No, I don't think we should wait right now. Opening a portal this size could take days. KENNEDY: Better get started. WILLOW: I think I might pee my pants. KENNEDY: You can do it - the magicks, not the pants thing.

~~Buffy Season 7 Episode #137: "Get It Done"~~

[Drabbles & Short Fiction]

Who’s Boss (Buffy/Spike, T) by veronyxk84

Tiefling Xander (Ensemble, T) by Baldur

When the Morning Comes (Buffy/Riley, T) by MadeInGold

Cleanup on Aisle Five (Buffy/Spike, M) by Soulburnt

[Chaptered Fiction]

Hand in Flightless Hand Ch. 3/9 (Buffy/Spike, E) by tragicbynight

Love Bites Ch. 4 (Buffy/Spike, E) by cawthraven

A Different Path Ch. 9 (Buffy/Faith, M) by Anaxilea

In the Company of Witches and Slayers: Ch. 15/200 (Willow/Tara, E) by VladimirHarkonnen (TheLightdancer)

I Don't Want to Be the One Ch. 11/40 (Buffy/Spike, T) by pommedapi

Never Let Me Down Again Ch. 8 (Buffy/Angel, M) by BuildMeUpButtercup_x

Kiss Me Twice Ch. 1 (Buffy/Spike, E) by Geliot99

Goodbye to Everything That I Knew Ch/ 30/30 COMPLETE (Buffy/Spike, M) by My_Barbaric_Yawp

Angel Doesn’t Know Ch. 3 (Buffy/Spike, Angel/Cordelia, E) by My_Barbaric_Yawp

What the Poets Don’t Tell You Ch. 1 (Buffy/Spike, unrated) by norkadearest

The Boring Stuff: Reptile Boy Ch. 5 (Buffy/Angel, M) by missfiggy

You’re my always Ch. 7/7 COMPLETE (Willow/Tara, T) by Shipper_wlw

Omission Ch. 10 (Riley/Spike, E) by toutes_les_routes

Keep Your Enemies Closer, Chapter 9 (Buffy/Spike, T) by disco-tea

A Ripple In Time, Chapter 2-5 (Buffy/Spike, E) by CheekyKitten

Saving You, Chapter 1 (Buffy/Spike, E) by Spikelover4ever

A Second Chance- Their Story, Chapter 9 (Buffy/Spike, E) by Loup Noir

Kiss Me Twice, Chapter 1 (Buffy/Spike, E) by Geliot99

Spike Has A Girlfriend, Chapter 5 (Buffy/Spike, E) by Spikelover4ever

Haunted Hearse, Chapter 1 (Buffy/Spike, E) by simmony

Love Lives Here, Chapter 52 (Buffy/Spike, E) by Passion4Spike

Lil' Ripper Makes a Friend, Chapter 41 (Buffy/Spike, E) by Soulburnt

Maclay Down, Chapter 1 (Buffy/Spike, E) by Soulburnt

Early One Morning , Chapter 35 (Buffy/Spike, E) by all choseny

The Neighbor's Point of View, Chapter 100 (Buffy/Spike, G) by the_big_bad

Hello Cutie, Chapter 6 (Buffy/Spike, E) by CheekyKitten

Centerfold, Chapter 3 (Buffy/Spike, E) by Passion4Spike, Passion4Spike, MissLuci

So It Goes..., Chapter 1 (Buffy/Spike, E) by scratchmeout

Title For Sale, Chapter 1 (Buffy/Spike, T) by Desicat

Love Lives Here, Chapter 52 (Buffy/Spike, E) by Passion4Spike

Lie to Me, Chapter 25 (Buffy/Spike, E) by In Mortal

Bathroom Wall, Chapter 3 (Buffy/Spike, G) by hulettwyo

Sculpture of Dance , Chapter 13 (Buffy/Spike, M) by Desicat

Hi Granny!, Chapter 2 (Buffy/Spike, G) by Desicat

Conflict Management Ch. 1 (Buffy, E, SPN xover) by holetoledo

[Images, Audio & Video]

Manip: Photoshoot (Buffy/Spike) by disco-tea

Manip: Spike in Barbieland by disco-tea

Artwork:Decided to celebrate my love of Buffy with a new tattoo by LittleRhodey

Artwork:Episode Poster: ATS 218. Dead End () by tmcarlee

Artwork:Spike () by isevery0nehereverystoned

Manip:BtVS Season 7 headers () by onegirlinallthewrld

[Reviews & Recaps]

BTVS/Angel Rewatch Chronicles: Seasons 6/3, Part One by QualifiedApathetic

Mothman’s Buffy Rewatch, Season 3, episode 3, “Faith, Hope, and Trick” by mothmans-wedding-photographer

Season 5 episode 6: family by mybuffysittersavampireslayer

Various thoughts on Buffy s7 e21+22 by pinksparkl

PODCAST: Episode 25 - Hang on to Your Ovipositor! (Bad Eggs) by The Sunnydale Diaries

PODCAST: ATS 214 - The Thin Dead Line by Another Buffy Podcast

[Community Announcements]

Tuesday Prompt: Spring by comment-fic

#btvs #buffy the vampire slayer #angel the series #fan art #fan fiction #meta

[creepypastakork]

G Witch Episode 22

New change in the OP this episode, I hope they add Calibarn in the next episode's OP as well.

I have a headcanon that Godoy and all the other people helping Prospera make Quiet Zero are all relatives or friends of people who got killed in the Vanadis incident, and that's why they're going so far to help her.

Surprise MVP of the episode, Rouji.

Goofy little callback to Ep. 1 with Felsi hiding behind Suletta this time.

It makes sense that Guel feels bad over their previous duel not just because he let Miorine break Suletta's heart, but also because he didn't win through a fair fight. It's great seeing him make up for both of those here. I like to think he wasn't holding back because he knew she was fully capable of beating him in a fair fight.

It's never been more miover -> WE'VE NEVER BEEN MORE BACK

We might never be able to perfectly replicate the good times we had, nor can we go back and fix the mistakes we made. However, we can't let that hold us back. In order to find out what life has in store for us, for good or for bad, we'll keep moving forward.

Delling woke up! If he does indeed act kinder towards Miorine in the future, then I'll grant him a belated happy father's day.

Mr. Hotz and Mr Cool together again during the tomato scene...

So Calibarn's data storms are more brutal by default, but in exchange, it's permet use potential is higher than other gundams. Actually, its black headpiece reminds me of Barbatos from IBO. And its weapon is... a witch's broom, of course! Though I thought it was a mace at first... I guess it could still be used as one?

Imagine Lauda prematurely stops his rampage because he sees Quiet Zero and is like "the hell is that. Quiet what???" Also, I named it Schwarzette Schunday after you, but you only showed up near the end! I would have tried something with Calibarn, but that name doesn't play as nice with a Sunday pun.

Hoping we get to see Eri comes clean with Suletta next episode regarding her feelings and why she's helping Prospera to this extent.

The next episodes are still looking a bit menacing with the scale of their threats, but this episode gave me the hope I needed to see them through myself!

#me posts #g witch #g witch spoilers #gundam the witch from mercury #So much this episode that this isn't all of my thoughts on it #Loved the SuleMio reunion just didn't say too much on it here cuz the scene's strong enough to speak for itself I think #and this ended up long enough as is