jcrmhscasereports

[jcrmhscasereports]

Retinal and choroidal vascular drop out in a case of severe phenotype of Flammer Syndrome. Rescue of the ischemic-preconditioning mimicking action of endogenous Erythropoietin (EPO) by off-label intra vitreal injection of recombinant human EPO (rhEPO) by Claude Boscher in Journal of Clinical Case Reports Medical Images and Health Sciences

Journal of Clinical Case Reports Medical Images and Health Sciences

ABSTRACT

Background: Erythropoietin (EPO) is a pleiotropic anti-apoptotic, neurotrophic, anti-inflammatory, and pro-angiogenic endogenous agent, in addition to its effect on erythropoiesis. Exogenous EPO is currently used notably in human spinal cord trauma, and pilot studies in ocular diseases have been reported. Its action has been shown in all (neurons, glia, retinal pigment epithelium, and endothelial) retinal cells. Patients affected by the Flammer Syndrome (FS) (secondary to Endothelin (ET)-related endothelial dysfunction) are exposed to ischemic accidents in the microcirculation, notably the retina and optic nerve.

Case Presentation: A 54 years old female patient with a diagnosis of venous occlusion OR since three weeks presented on March 3, 2019. A severe Flammer phenotype and underlying non arteritic ischemic optic neuropathy; retinal and choroidal drop-out were obviated. Investigation and follow-up were performed for 36 months with Retinal Multimodal Imaging (Visual field, SD-OCT, OCT- Angiography, Indo Cyanin Green Cine-Video Angiography). Recombinant human EPO (rhEPO)(EPREX®)(2000 units, 0.05 cc) off-label intravitreal injection was performed twice at one month interval. Visual acuity rapidly improved from 20/200 to 20/63 with disparition of the initial altitudinal scotoma after the first rhEPO injection, to 20/40 after the second injection, and gradually up to 20/32, by month 5 to month 36. Secondary cystoid macular edema developed ten days after the first injection, that was not treated via anti-VEGF therapy, and resolved after the second rhEPO injection. PR1 layer integrity, as well as protective macular gliosis were fully restored. Some level of ischemia persisted in the deep capillary plexus and at the optic disc.

Conclusion: Patients with FS are submitted to chronic ischemia and paroxystic ischemia/reperfusion injury that drive survival physiological adaptations via  the hypoxic-preconditioning mimicking effect of endogenous EPO, that becomes overwhelmed in case of acute hypoxic stress threshold above resilience limits. Intra vitreal exogenous rhEPO injection restores retinal hypoxic-preconditioning adaptation capacity, provided it is timely administrated. Intra vitreal rhEPO might be beneficial in other retinal diseases of ischemic and inflammatory nature.

Key words : Erythropoietin, retinal vein occlusion, anterior ischemic optic neuropathy, Flammer syndrome, Primary Vascular Dysfunction, anti-VEGF therapy, Endothelin, microcirculation, off-label therapy.

INTRODUCTION

Retinal Venous Occlusion (RVO) treatment still carries insufficiencies and contradictions (1) due to the incomplete deciphering of the pathophysiology and of its complex multifactorial nature, with overlooking of factors other than VEGF up-regulation, notably the roles of  retinal venous tone and Endothelin-1 (ET) (2-5), and of endothelial caspase-9 activation (6). Flammer Syndrome (FS)( (Primary Vascular Dysfunction) is related to a non atherosclerotic ET-related endothelial dysfunction in a context of frequent hypotension and increased oxidative stress (OS), that alienates organs perfusion, with notably changeable functional altered regulation of blood flow (7-9), but the pathophysiology remains uncompletely  elucidated (8). FS is more frequent in females, and does not seem to be expressed among outdoors workers, implying an influence of sex hormons and light (7)(9). ET is the most potent pro-proliferative, pro-fibrotic, pro-oxidative and pro-inflammatory vasoconstrictor, currently considered involved in many diseases other than cardio-vascular ones, and is notably an inducer of neuronal apoptosis (10). It is produced by endothelial (EC), smooth vascular muscles (SVMC) and kidney medullar cells,  and binds the surface Receptors  ET-A on SVMC and ET-B on EC,  in an autocrine and paracrine fashion. Schematically, binding on SVMC Receptors (i.e. through local diffusion in fenestrated capillaries or dysfunctioning EC) and on EC ones (i.e. by circulating ET) induce respectively arterial and venous vasoconstriction, and vasodilation, the latter via Nitrite oxide (NO) synthesis. ET production is stimulated notably by Angiotensin 2, insulin, cortisol, hypoxia, and antagonized by endothelial gaseous NO, itself induced by flow shear stress. Schematically but not exclusively, vascular tone is maintained by a complex regulation of ET-NO balance (8) (10-11).  Both decrease of NO and increase of ET production are both a cause and consequence of inflammation, OS  and endothelial dysfunction, that accordingly favour vasoconstriction; in addition ET competes for L-arginine substrate with NO synthase, thereby reducing NO bioavailability, a mechanism obviated notably in carotid plaques and amaurosis fugax (reviewed in 11).

Severe FS phenotypes are rare. Within the eye, circulating ET reaches retinal VSMC in case of Blood-Retinal-Barrier (BRB) rupture and diffuses freely via the fenestrated choroidal circulation, notably around the optic nerve (ON) head behind the lamina cribrosa, and may induce all pathologies related to acute ocular blood flow decrease (2-3)(5)(7-9). We previously reported two severe cases with rapid onset of monocular cecity and low vision, of respectively RVO in altitude and non arteritic  ischemic optic neuropathy (NAION) (Boscher et al, Société Francaise d'Ophtalmologie and Retina Society, 2015 annual meetings).

Exogenous Recombinant human EPO (rhEPO) has been shown  effective in humans for spinal cord injury (12), neurodegenerative and chronic kidney diseases (CKD) (reviewed in 13). Endogenous EPO is released physiologically in the circulation by the kidney and liver; it may be secreted in addition by all cells in response to hypoxic stress, and it is the prevailing pathway induced via genes up-regulation by the transcription factor Hypoxia Inducible Factor 1 alpha, among angiogenesis (VEGF pathway), vasomotor regulation (inducible NO synthase), antioxidation, and energy metabolism (14). EPO Receptor signaling induces cell proliferation, survival and differentiation (reviewed in 13), and targets multiple non hematopoietic pathways as well as the long-known effect on erythropoiesis (reviewed in 15). Of particular interest here, are its synergistic anti-inflammatory, neural antiapoptotic (16) pro-survival and  pro-regenerative (17) actions upon hypoxic injury, that were long-suggested to be also indirect, via blockade of ET release by astrocytes, and assimilated to ET-A blockers action (18). Quite interestingly, endogenous EPO’s pleiotropic effects were long-summarized (back to 2002), as “mimicking hypoxic-preconditioning” by Dawson (19), a concept applied to the retina (20). EPO Receptors are present in all retinal cells and their rescue activation targets all retinal cells, i.e. retinal EC, neurons (photoreceptors (PR), ganglion (RGG) and  bipolar cells), retinal pigment epithelium (RPE) osmotic function through restoration of the BRB, and  glial cells (reviewed in 21), and the optic nerve (reviewed in 22).  RhEPO has been tested experimentally in animal models of glaucoma, retinal ischemia-reperfusion (I/R) and light phototoxicity, via multiple routes (systemic, subconjunctival, retrobulbar and intravitreal injection (IVI) (reviewed in 23), and used successfully via IVI in human pilot studies, notably first in diabetic macular edema (24) (reviewed in 25 and 26). It failed to improve neuroprotection in association to corticosteroids in optic neuritis, likely for bias reasons (reviewed in 22). Of specific relation to the current case, it has been reported in NAION (27) (reviewed in 28) and traumatic ON injury (29 Rashad), and in one case of acute severe central RVO (CRVO) (Luscan and Roche, Société Francaise d’Ophtalmologie 2017 annual meeting). In addition EPO RPE gene therapy was recently suggested to prevent retinal degeneration induced by OS in a rodent model of dry Age Macular Degeneration (AMD) (30).

CASE REPORT PRESENTATION

This 54 years female patient was first visited on March 2019 4th, seeking for second opinion for ongoing vision deterioration OR on a daily basis, since around 3 weeks. Sub-central RVO (CRVO) OR had been diagnosed on February 27th; available SD-OCT macular volume was increased with  epiretinal marked hyperreflectivity, one available Fluorescein angiography picture showed a non-filled superior CRVO, and a vast central ischemia involving the macular and paraoptic territories. Of note there was ON edema with a para-papillary hemorrage nasal to the disc on the available colour fundus picture.

At presentation on March 4, Best Corrected Visual Acuity (BCVA) was reduced at 20/100 OR (20/25 OS). The patient described periods of acutely excruciating retro-orbital pain in the OR. Intraocular pressure was normal, at 12 OR and 18 OS (pachymetry was at 490 microns in both eyes). The dilated fundus examination was similar to the previous color picture and  did not disclose peripheral hemorrages recalling extended peripheral retinal ischemia. Humphrey Visual Field disclosed an altitudinal inferior scotoma and a peripheral inferior scotoma OR and was in the normal range OS, i.e. did not recall normal tension glaucoma OS (Fig. 1). There were no papillary drusen on the autofluorescence picture, ON volume was increased  (11.77 mm3 OR versus 5.75 OS) on SD-OCT (Heidelberg Engineering®) OR,  Retinal Nerve Fiber (RNFL) and RGC layers thicknesses were normal (Fig. 2). Marked epimacular hypereflectivity OR with foveolar depression inversion, moderately increased total volume and central foveolar thickness (CFT) (428 microns versus 328 OS), and a whitish aspect of the supero-temporal internal retinal layers recalling ischemic edema, were present (video 1). EDI CFT was incresead at 315 microns (versus 273 microns OS), with focal pachyvessels on the video mapping (video 1). OCT-Angiography disclosed focal perfusion defects in both the retinal and chorio-capillaris circulations (Fig. 3), and central alterations of the PR1 layer on en-face OCT(Fig. 4).

Altogether the clinical picture evoked a NAION with venous sub-occlusion, recalling Fraenkel’s et al early hypothesis of an ET interstitial diffusion-related venous vasoconstriction behind the lamina cribrosa (2), as much as a rupture of the BRB was present in the optic nerve area (hemorrage along the optic disc). Choroidal vascular drop-out was suggested by the severity and rapidity of the VF impairment (31). The extremely rapid development of a significant “epiretinal membrane”, that we interpreted as a reactive - and protective, in absence of cystoid macular edema (CME) - ET 2-induced astrocytic proliferation (reviewed in 32), was as an additional  sign of severe ischemia.

The mention of the retro-orbital pain evoking a “ciliary angor”, the absence of any inflammatory syndrome and of the usual metabolic syndrome in the emergency blood test, oriented the etiology towards a FS. And indeed anamnesis collected many features of the FS, i.e. hypotension (“non dipper” profile with one symptomatic nocturnal episode of hypotension on the MAPA), migrains, hypersensitivity to cold, stress, noise, smells, and medicines, history of a spontaneously resolutive hydrops six months earlier, and of paroxystic episods of vertigo (which had driven a prior negative brain RMI investigation for Multiple Sclerosis, a frequent record among FS patients (33) and of paroxystic visual field alterations (7)(9), that were actually recorded several times along the follow-up.

The diagnosis of FS was eventually confirmed in the Ophthalmology Department in Basel University on April 10th, with elevated retinal venous pressure (20 to 25mmHg versus 10-15 OS) (4)(7)(9), reduced perfusion in the central retinal artery and veins on ocular Doppler (respectively 8.3 cm/second OR velocity versus 14.1 mmHg OS, and 3.1/second OR versus 5.9 cm OS), and impaired vasodilation upon flicker light-dependant shear stress on the Dynamic Vessel Analyser testing (7-9). In addition atherosclerotic plaques were absent on carotid Doppler.

On March 4th, the patient was at length informed about the FS, a possible off label rhEPO IVI, and a related written informed consent on the ratio risk-benefits was delivered.

By March 7th, she returned on an emergency basis because of vision worsening OR. VA was unchanged, intraocular pressure was at 13, but Visual Field showed a worsening of the central and inferior scotomas with a decreased foveolar threshold, from 33 to 29 decibels. SD-OCT showed a 10% increase in the CFT volume.

On the very same day, an off label rhEPO IVI OR (EPREX® 2000 units, 0,05 cc in a pre-filled syringe) was performed in the operating theater, i.e. the dose reported  by Modarres et al (27), and twenty times inferior to the usual weekly intravenous dose for treatment of chronic anemia secondary to CKD. Intra venous acetazolamide (500 milligrams) was performed prior to the injection, to prevent any increase in intra-ocular pressure. The patient was discharged with a prescription of chlorydrate betaxolol (Betoptic® 0.5 %) two drops a day, and high dose daily magnesium supplementation (600 mgr).

Incidentally the patient developed bradycardia the day after, after altogether instillation of 4 drops of betaxolol only, that was replaced by acetazolamide drops, i.e. a typical hypersensitivity reaction to medications in the FS (7)(9).

Subjective vision improvement was recorded as early as D1 after injection. By March 18 th, eleven days post rhEPO IVI, BCVA was improved at 20/63, the altitudinal scotoma had resolved (Fig. 5), Posterior Vitreous Detachment had developed with a disturbing marked Weiss ring, optic disc swelling had decreased; vasculogenesis within the retinal plexi and some regression of PR1 alterations  were visible on OCT-en face. Indeed by 11 days post EPO significant functional, neuronal and vascular rescue were observed, while the natural evolution had been seriously vision threatening.

However cystoid ME (CME) had developed (video 2). Indo Cyanin Green-Cine Video Angiography (ICG-CVA) OR, performed on March 23, i.e. 16 days after the rhEPO IVI, showed a persistent drop in ocular perfusion: ciliary and central retinal artery perfusion timings were dramatically delayed at respectively 21 and 25 seconds, central retinal vein perfusion initiated by 35 seconds, was pulsatile, and completed by 50 seconds only (video 3). Choroidal pachyveins matching the ones on SD-OCT video mapping were present in the temporal superior and inferior fields, and crossed the macula; capillary exclusion territories were present in the macula and around the optic disc.

By April 1, 23 days after the rhEPO injection, VA was unchanged, but CME and perfusion voids in the superficial deep capillary plexi and choriocapillaris were worsened, and optic disc swelling had recurred back to baseline, in a context of repeated episodes of systemic hypotension; and actually Nifepidin-Ratiopharm® oral drops (34), that had been delivered via a Temporary Use Authorization from the central Pharmacology Department in Assistance Publique Hopitaux de Paris, had had to be stopped because of hypersensitivity.

A second off label rhEPO IVI was performed in the same conditions on April 3, i.e. approximately one month after the first one.

Evolution was favourable as early as the day after EPO injection 2: VA was improved at 20/40, CME was reduced, and perfusion improved in the superficial retinal plexus as well as in the choriocapillaris. By week 4 after EPO injection 2, CME was much decreased, i.e. without anti VEGF injection. On august 19th, by week 18 after EPO 2, perfusion on ICG-CVA was greatly improved , with ciliary timing at 18 seconds, central retinal artery at 20 seconds and venous return from 23 to 36 seconds, still pulsatile. Capillary exclusion territories were visible in the macula and temporal to the macula after the capillary flood time that went on by 20.5 until 22.5 seconds (video 4); they  were no longer persistent at intermediate and late timings.

Last complete follow-up was recorded on January 7, 2021, at 22 months from EPO injection 2. BCVA was at 20/40, ON volume had dropped at 7.46 mm3, a sequaelar superior deficit was present in the RNFL (Fig. 2) with some  corresponding residual defects on the inferior para central Visual Field (Fig. 5), CFT was at 384 mm3 with an epimacular hyperreflectivity without ME, EDI CFT was dropped at 230 microns. Perfusion on ICG-CVA was not normalized, but even more improved, with ciliary timing at 15 seconds, central retinal artery at 16 seconds and venous return from 22 to 31 seconds, still pulsatile (video 5), indicating that VP was still above IOP. OCT-A showed persisting perfusion voids, especially at  the optic disc and within the deep retinal capillary plexus. The latter were present at some degree in the OS as well (Fig. 6). Choriocapillaris and PR1 layer were dramatically improved.

Last recorded BCVA was at 20/32 by February 14, 2022, at 34 months from EPO 2. SD-OCT showed stable gliosis hypertrophy and mild alterations of the external layers (video 6).

Figure 1: Humphrey visual field at baseline on March 7th 2019, showing an altitudinal central scotoma, an inferior peripheral scotoma with a normal and symmetrical foveolar sensitivity threshold, and a normal visual field OS

Figure 2: Retinal Nerve Fiber (RNFL ) evolution from normal at baseline on March 2019 7th, to development of a superior sequellar deficit that remained stable on last follow-up.

Figure 3: OCT-Angiography at baseline on March 7th 2019, showing perfusion voids OR in the superior superficial retinal plexus and in the choriocapillaris.

Figure 4: OCT en face at baseline on March 7th 2019, showing PR1 layer deficits OR (artefacts in the superior half) compared to OS.

Figure 5: Humphrey visual field follow-ups : at follow-up 1 eleven days after rhEPO intra vitreal injection showing resolution of the altitudinal central scotoma and decrease of the inferior scotoma, and at last visual field follow-up on January 20th 2021, showing residual defects corresponding to the RNFL ones on Figure 2.

Figure 6: OCT Angiography performed on January 7th 2021, at 22 months from EPO injection 2, showing persisting perfusion voids, especially at the optic disc, and within the deep retinal capillary plexus, that were present at some degree in the OS as well.

Video 1 : SD-OCT video mapping  OR at baseline on March 7th 2019, showing epiretinal hyperreflectivity and epiretinal membrane with foveolar depression inversion, ischemic edema in the internal and temporal to the disc superior retinal layers, and focal choroidal Haller pachyvessels with reduction in chorio-capillaris/Sattler layers.

Vedio: https://jmedcasereportsimages.org/articles/JCRMHS_1231_Vedio_1.mov

Video 2: SD-OCT video mapping OR at follow-up  1 eleven days after rhEPO intra vitreal injection on March 18th, showing epiretinal hyperreflectivity and epiretinal membrane with foveolar depression inversion, ischemic edema in the internal and temporal to the disc superior retinal layers, and development of central cystoid macular edema.

Vedio: https://jmedcasereportsimages.org/articles/JCRMHS_1231_Vedio_2.mov

Video 3 : Indo Cyanin Green-Cine Video Angiography OR, performed on March 23, i.e. 16 days after the rhEPO IVI, showing a persistent drop in ocular perfusion: ciliary and central retinal artery perfusion timings  were dramatically delayed at respectively 21 and 25 seconds, central retinal vein perfusion initiated by 35 seconds, was pulsatile, and completed by 50 seconds only.

Vedio: https://jmedcasereportsimages.org/articles/JCRMHS_1231_Vedio_3.mov

Video 4 : Indo Cyanin Green-Cine Video Angiography OR, performed on August 19, i.e. by week 18 after EPO 2, showing greatly improved perfusion, with ciliary timing at 18 seconds, central retinal artery at 20 seconds and venous return from 23 to 36 seconds, still pulsatile. Capillary exclusion territories were visible in the macula and temporal to the macula after the capillary flood time that went on by 20.5 until 22.5 seconds.

Vedio: https://jmedcasereportsimages.org/articles/JCRMHS_1231_Vedio_4.mov

Video 5: Indo Cyanin Green-Cine Video Angiography OR, performed on January 7th, 2021, at 22 months from EPO injection 2: perfusion was not normalized, but even more improved, with ciliary timing at 15 seconds, central retinal artery at 16 seconds and venous return from 22 to 31 seconds, still pulsatile.

Vedio: https://jmedcasereportsimages.org/articles/JCRMHS_1231_Vedio_5.avi

Video 6 : SD-OCT video mapping  at 34 months from EPO 2,  showing stable gliosis hypertrophy and mild alterations of the external layers.

Vedio: https://jmedcasereportsimages.org/articles/JCRMHS_1231_Vedio_6.avi

DISCUSSION

What was striking in the initial clinical phenotype of CRVO  was  the contrast between the moderate venous dilation,  and the intensity of ischemia, that were illustrating the pioneer hypothesis of Professor Flammer‘s team regarding the pivotal role of ET in VO (2), recently confirmed (3)(35), i.e. the local venous constriction backwards the lamina cribrosa, induced by diffusion of ET-1 within the vascular interstitium, in reaction to hypoxia. NAION was actually the primary and prevailing alteration, and ocular hypoperfusion was confirmed via ICG-CVA, as well as by the ocular Doppler performed in Basel. ICG-CVA confirmed the choroidal drop-out suggested by the severity of the VF impairment (31) and by OCT-A in the choriocapillaris. Venous pressure measurement, which instrumentation is now available (8), should become part of routine eye examination in case of RVO, as it is key to guide cases analysis and personalized therapeutical options.

Indeed, the endogenous EPO pathway is the dominant one activated by hypoxia and is synergetic with the VEGF pathway, and coherently it is expressed along to VEGF in the vitreous in human RVO (36). Diseases develop when the individual limiting  stress threshold for efficient adaptative reactive capacity gets overwhelmed. In this case by Week 3 after symtoms onset,  neuronal and vascular resilience mechanisms were no longer operative, but the BRB, compromised at the ON, was still maintained in the retina.

As mentioned in the introduction, the scientific rationale for the use of EPO was well demonstrated by that time, as well as the capacities of exogenous EPO to mimic endogenous EPO vasculogenesis, neurogenesis and  synaptogenesis, restoration of  the balance between ET-1 and NO. Improvement of chorioretinal blood flow was actually illustrated by the evolution of the choriocapillaris perfusion on repeated OCT-A and ICG-CVA. The anti-apoptotic effect of EPO (16) seems as much appropriate in case of RVO as the caspase-9 activation is possibly another overlooked co-factor (6).

All the conditions for translation into off label clinical use were present: severe vision loss with daily worsening and  unlikely spontaneous favourable  evolution, absence of toxicity in the human pilot studies, of contradictory comorbidities and co-medications, and of context of intraocular neovascularization that might be exacerbated by EPO (37).

Why didn’t we treat the onset of CME by March 18th, i.e. eleven days after EPO IVI 1, by anti-VEGF therapy, the “standard-of-care” in CME for RVO ?

In addition to the context of functional, neuronal and vascular improvements obviated by rhEPO IVI by that timing in the present case, actually anti VEGF therapy does not address the underlying causative pathology. Coherently, anti-VEGF IVI :  1) may not be efficient in improving vision in RVO, despite its efficiency in resolving/improving CME (usually requiring repeated injections), as shown in the Retain study (56% of eyes with resolved ME continued to loose vision)(quoted in (1) 2) eventually may be followed by serum ET-1 levels increase and VA reduction (in 25% of cases in a series of twenty eyes with BRVO) (38) and by increased areas of non perfusion in OCT-A (39). Rather did we perform a second hrEPO IVI, and actually we consider open the question whether the perfusion improvement, that was progressive, might have been accelerated/improved via repeated rhEPO IVI, on a three to four weeks basis.

The development of CME itself, involving a breakdown of the BRB, i.e. of part of the complex  retinal armentorium resilience to hypoxia, was somewhat paradoxical in the context of improvement after the first EPO injection, as EPO restores the BRB (24), and as much as it was suggested that EPO inhibits glial osmotic swelling, one cause of ME, via VEGF induction (40). Possible explanations were: 1) the vascular hyperpermeability induced by the up-regulation of VEGF gene expression via EPO (41) 2) the ongoing causative disease, of chronic nature, that was obviated by the ICG-CVA and the Basel investigation, responsible for overwhelming the gliosis-dependant capacity of resilience to hypoxia 3) a combination of both. I/R seemed excluded: EPO precisely mimics hypoxic reconditioning as shown in over ten years publications, including in the retina (20), and as EPO therapy is part of the current strategy for stabilization of the endothelial glycocalix against I/R injury (42-43). An additional and not exclusive possible explanation was the potential antagonist action of EPO on GFAP astrocytes proliferation, as mentioned in the introduction (18), that might have counteracted the reactive protective hypertrophic gliosis, still fully operative prior to EPO injection, and that was eventually restored during the follow-up, where epiretinal hyperreflectivity without ME and ongoing chronic ischemia do coincide (Fig. 6 and video 6), as much as it is unlikely that EPO’s effect would exceed one month (cf infra). Inhibition of gliosis by EPO IVI might have been also part of the mechanism of rescue of RGG, compromised by gliosis in hypoxic conditions (44). Whatever the complex balance initially reached, then overwhelmed after EPO IVI 1, the challenge was rapidly overcome by the second EPO IVI without anti-VEGF injection, likely because the former was powerful enough to restore the threshold limit for resilience to hypoxia, that seemed no longer reached again during the relapse-free follow-up. Of note, this “epiretinal membrane “, which association to good vision is a proof of concept of its protective effect, must not be removed surgically, as it would suppress one of the mecanisms of resilience to hypoxia.

To our best knowledge, ICG-CVA was never reported in FS; it allows real time evaluation of the ocular perfusion and illustration of the universal rheological laws that control choroidal blood flow as well. Pachyveins recall a “reverse” veno-arteriolar reflex in the choroidal circulation, that is NO and autonomous nervous system-dependant, and that we suggested to be an adaptative choroidal microcirculation process to hypoxia (45).  Their persistence during follow-up accounts for a persisting state of chronic ischemia.

The optimal timing for reperfusion via rhEPO in a non resolved issue:

in the case reported by Luscan and Roche, rhEPO IVI was performed on the very same day of disease onset, where it induced complete recovery from VA reduced at counting fingers at 1 meter, within 48 hours. This clinical human finding is on line with a recent rodent stroke study that established the timings for non lethal versus lethal ischemia of the neural and vascular lineages, and the optimized ones for beneficial reperfusion: the acute phase - from Day 1 where endothelial and neural cells are still preserved,  to Day 7 where proliferation of pericytes and Progenitor Stem Cells are obtainable - and the chronic stage, up to Day 56, where vasculogenesis, neurogenesis and functional recovery are still possible, but with uncertain efficiency (46). In our particular case, PR rescue after rhEPO IVI 1 indicated that Week 3 was still timely. RhEPO IVI  efficacy was shown to last between one (restoration of the BRB)  and four weeks (antiapoptotic effect) in diabetic rats (24). The relapse after Week 3 post IVI 1 might indicate that it might be  approximately the interval to be followed, should repeated injections be necessary.

The bilateral chronic perfusion defects on OCT-A at last follow-up indicate that both eyes remain in a condition of chronic ischemia and I/R, where endogenous EPO provides efficient ischemic pre-conditioning, but is potentially susceptible to be challenged during episodes of acute hypoxia that overwhelm the resilience threshold.

CONCLUSION

The present case advocates for individualized medicine with careful recording of the medical history, investigation of the systemic context, and exploiting of the available retinal multimodal imaging for accurate analytical interpretation of retinal diseases and their complex pathophysiology. The Flammer Syndrome is unfortunately overlooked in case of RVO; it should be suspected clinically in case of absence of the usual vascular and metabolic context, and in case  of elevated RVP. RhEPO therapy is able to restore the beneficial endogenous EPO ischemic pre-conditioning in eyes submitted to challenging acute hypoxia episodes in addition to chronic ischemic stress, as in the Flammer Syndrome and fluctuating ocular blood flow, when it becomes compromised by the overwhelming of the hypoxic stress resilience threshold. The latter physiopathological explanation illuminates the cases of RVO where anti-VEGF therapy proved functionally inefficient, and/or worsened retinal ischemia. RhEPO therapy might be applied to other chronic ischemia and I/R conditions, as non neo-vascular Age Macular Degeneration (AMD), and actually EPO was listed in 2020 among the nineteen promising molecules in AMD in a pooling of four thousands (47).

For more information regarding our Journal: https://jmedcasereportsimages.org/about-us/

For more artices: https://jmedcasereportsimages.org/archive/

#Case reports #Clinical Images #JCRMHS #Case Studies #High IF Journals

[jcrmhscasereports]

Prevalence of Hepatitis b and c viral infections among human immunodeficiency virus (HIV) infected patients on highly active anti-retroviral therapy (haart) in the university of port harcourt teaching hospital By Abel Charles In Journal of Clinical Case Reports Medical Images and Health Sciences 

ABSTRACT

Introduction: This study determined the prevalence of hepatitis B and C viral infections among human immunodeficiency virus (HIV) infected patients on highly active anti-retroviral therapy (HAART) in the University of Port Harcourt Teaching Hospital.

Methodology: It was a purposive, cross-sectional study that was conducted in the Anti-retroviral clinic of the facility and a sample size of 38.33 (increased to 100, due to perceived small size), using a prevalence of 2.56% from a previous study by Nnakenyi et al. (2019).

Results: There was more female participation, 77.0%, majority had secondary school education, 59.0%, mostly Civil servants, 43.0%, Christians, 87.0% and mainly of Ijaw ethnicity, 39.0%. Majority had heard of HBV and HCV, 84.0%, mainly in the hospital, 36.9%, with the least from friends/family members, 6.0%, 98.0% had not been infected by any of the hepatic viruses, all of them affirmed that the viruses can be treated, 100.0%, while 72.0% confirmed the efficacy of medical treatment for the viruses and 46.0% had been vaccinated against the viruses. Also, majority opined that sexual intercourse is the main route for transmission of the hepatic viruses, 51.0%, followed by blood transfusion, 37.0% and lifestyle is the most common risk factor to contract the viruses, 71.0%. The prevalence of HBV, HCV and VDRL among HIV-infected patients on HAART was 96.0%, 98.0% and 99.0% respectively. Similarly, we observed statistical significance of HBV (0.042) and HCV (0.021), as well as, venereal diseases (0.028).

Conclusion: There is low prevalence of the hepatic viruses among HIV infected persons in the study population, while the existence of a venereal disease is a risk factor to contracting the hepatic viruses, owing to similar pathways of transmission, thus, rigorous efforts at educating the populace about the risk factors and common routes of transmission of these viruses is required.

Keywords: Hepatitis, venereal disease, HIV, HAART, infection.

INTRODUCTION

Human immunodeficiency virus (HIV) is a retrovirus that infects humans and other mammals. Infection by the virus is a huge public health problem, with African being one of the most affected by the pandemic globally resulting in an estimated 25.7 million human infections worldwide (World Health Organization [WHO], 2019).

Viral hepatitis is also a global health challenge of public concern worldwide (Ndifontiayong, Ali, Sokoudjou, Ndimumeh & Tume, 2021). Some of the features associated with the micro-organisms are high prevalence, high mortality and morbidity, poor diagnostic tools, leading to sub-optimal diagnosis and poor management approaches, especially, in developing countries (Naghavi, Wang, Lozano, Davis, Liang, Zhou, Vollset, Ozgoren, Abdalla & Abd-Allah, 2015; Mokdad, Lopez, Shahraz, Lozano, Mokdad, Stanaway, Murray & Naghavi, 2014).

Hepatitis B virus (HBV) alters the liver architecture and may progress to chronic, life-threatening conditions, such as liver cirrhosis and hepatocellular carcinoma or otherwise mild case, known as hepatitis (Nnakenyi, Uchehukwu & Nto-ezimah, 2020). The global prevalence of HBV is estimated as 0.1%-20% (McMahon, 2005; Custer, Sullivan, Hazlet, Lloeje, Veenstra & Kowdley, 2004) and its diagnosis is made by detection from blood and body fluids, such as semen, saliva and nasopharyngeal secretion, while the main routes of transmission are sexual intercourse, mother to child transmission in pregnancy, delivery and breastfeeding, blood contact and sharing of infected materials (WHO, 2011).

In 2017, the World Health Organization (WHO) reported that the global prevalence of hepatitis B surface antigen (HBsAg) in the African region was 60 million, with an estimated prevalence of 6.1% (4.6% - 8.5%) and accounting for an estimated 87,890 annual deaths in sub-Saharan African region alone. Both HIV and HBV infections pose a reciprocal effect on the progression of both diseases in regards to the impact on the morbidity and mortality of the diseases, with co-infection being a serious challenge in resource-constrained settings (Xie, Han, Qiu, Li, Li, Song, Wang, Thio & Li, 2016; Milazzo & Antinori, 2014). In the western countries, complications arising from HBV and HCV and the infections itself are rare, but common in Asia and Africa, where the chronic infection is common and usually acquired through the parenteral route or in adulthood (Lavanchy, 2004).

Hepatitis C virus (HCV) is also a major cause of hepatitis, like HBV, with a chronic potential (Nnakenyi et al., 2020). The transmission of HCV is similar to HBV. There are scanty prevalence data for HCV, especially, in sub-Saharan African region, but approximately 30 million people are reported to be infected by the virus (Matthews, Geretti, Goulder & Klenerman, 2014). HCV also leads to chronic liver diseases like hepatocellular carcinoma, (Ndifontiayong et al., 2021). Both HBV and HCV are very prevalent in patients infected by HIV and those with the disease condition of HIV, AIDS, leading to an increased morbidity and mortality (Spearman, Afihene, Ally, Apica, Awuku & Cunha, 2017). The co-infection of HIV with either HBV, HCV is associated with poor survival, rapid progression to liver diseases and high potential for hepatotoxicity, arising from the anti-retroviral therapy administered (WHO, 2013; Highleyman, 2010).

Globally, an estimated 550 million people are infected by either HBV or HCV, about 9% of the world population, with the former estimated as 350-400 million, while the latter is estimated as 170-180 million (WHO, 2013; Lavanchy, 2011). Also, the three viruses; HIV, HBV and HCV dominant infections in sub-Saharan African, with 2.6 million HBV infections in HIV-infected people and approximately 2.3 million HCV in HIV-infected people (Kourtis, Bulterys, Hu & Jamieson, 2012).

Highly active anti-retroviral therapy, HAART, is a current, commonly implemented regimen for managing HIV infection. It is an innovation in HIV management and effectively reduces the viral load, as well as, increases the CD4 cell count.

Human Immunodeficiency Virus (HIV) infection, in itself, poses enormous burden on the health care system of many countries. However, the condition of infected individuals is worsened in the existence of co-infection, such as the hepatitis virus, causing poor prognosis and potentially shortens life span (Nnakenyi et al., 2020). It rapidly depletes the immune function of the host, as well as, other vital systems of the affected individual. Evidence suggests that HIV infection progresses faster, even to AIDS-defining illnesses, when there is a co-infection with hepatitis viruses (Greub, Ledergerber, Battegay, Grob, Perrin & Furrer, 2000).

Owing to this co-infection, it is advised that when treating HIV patients, their status of HBV and HCV is ascertained, if the patient is actually co-infected by any of the hepatitis viruses. This is important because a report by the WHO global hepatitis strategy for the elimination of viral hepatitis stipulates that by the year 2030, hepatitis disease will assume a huge public health propensity, thus, 80% of individuals eligible for HBV or HCV treatment should be availed the treatment (WHO, 2016). Despite this, in most developing countries, such as Nigeria, the screening for the hepatitis viruses is still a challenge, due to the cost of investigation or vaccination, unlike in HIV (Diwe, Okwara, Enwere, Azike & Nwaimo, 2013).

Prevalence studies abound in Nigeria regarding co-infection of HIV with either hepatitis B or C viruses, employing different settings and population sizes (Hamza et al., 2013; Idoko, Meloni, Muazu, Nimzing, Badung & Hawkins, 2009; Otegbayo, Taiwo, Akingbola, Odaibo, Adedapo & Penugonda, 2008; Ejele, Nwauche & Erhabor, 2004), with diverse but similar results.

In Nigeria, the national guideline for the prevention, treatment and care for HIV-infected patients does not recommend the screening for HBV, but hepatitis B surface antigen, HBsAg, and HCV commonly done as baseline test for the pre-treatment of HIV-infected patients (National Guidelines for HIV Prevention, Treatment and Care, 2016).

In a study conducted in Enugu state, Nigeria, among 1328 HIV-infected patients on HAART, Nnakenyi et al. (2020) reported that the prevalence of hepatitis B virus infection was 7.8%. Another study conducted among 1779 HIV-infected patients in a different geo-political region in Nigeria, reported HBV prevalence of 11.9% (Otegbayo et al., 2008), while other independent, but similar studies employing smaller sample sizes compared to the those earlier described, ranged from 9.7% to 25.0% (Idoko et al., 2009; Uneke, Ogbu, Inyama, Anyanwu, Njoku & Idoko, 2005; Ejele, Nwauche & Erhabor, 2004).

Regarding the co-infection of HIV and HCV, several studies documented distinct findings, majority of which suggest population size and diagnostic equipment and technique plays crucial roles in the prevalence. In some studies conducted in Nigeria, by Nnekanyi et al. (2020), Diwe et al. (2013) and Adewole, Anteyi, Ajuwon, Wada, Elegba and Ahmed (2013), prevalence values of 4.7%, 0.7% and 2.3% respectively were reported respectively.

Similarly, Nnekanyi et al. (2020) and Adewole et al. (2013) reported that HBV is more prevalent and the situation may be similar for other studies both within and outside Nigeria. Observations show that the varying sample sizes of the populations in the respective studies accounted for the differences reported in their prevalence, while positing that although, the three viruses are transmitted through similar routes, their rates of transmission could be dissimilar. For instance, HIV transmission, historically, is most common through the parenteral route, such as multiple blood transfusions and intravenous drug use, in addition to sexual transmission, but the sexual transmission route is less common for HCV (Tedaldi, Hullsiek, Malvestutto, Arduino, Fisher & Gaglio, 2003).

Yet another finding on the co-infection between HIV and either HBV or HCV also reported gender bias against the transmission, especially, HBV. The study reported that HIV/HBV co-infection is more common among men that have sex with men, as against men that have sex with women or women that have sex with women, the transmission being almost inefficient in the latter category, while it is also commoner in heterosexual individuals with multiple sexual partners and contacts with commercial sex workers (Alter, 2006).

Triple infection of the three viruses; HIV, HBV and HCV have been observed in certain circumstances. In three individual groups of study conducted in the southeast, north-central and a sub-urban part of Nigeria by Nnakenyi et al. (2020), Adewole et al. (2009) and Diwe et al. (2013), they reported the prevalence of triple infection as 0.58%, 1.5% and 0% respectively. In response to the varying findings in the respective studies, Nnakenyi and colleagues posited that at this point, it will be difficult to discern if residing in the city poses more risk to contracting triple infection and whether social lifestyle in the urban regions is implicated in the observed prevalence, which is absent in the sub-urban region.

Opaleye, Oluremi, Ogbolu, Babalola, Shittu and Adesiyan (2014) also investigate the prevalence of HBV among HIV-infected patients HAART regimen and reported more male co-infection, while the age group of 30-49 years were more predominantly co-infected.

In a study in Burkina Faso among 11,592 blood donors, with sero-positive HIV blood, 1.13% prevalence of HBV co-morbidity with HIV was reported, while the prevalence of HCV among the HIV sero-positive patients was 0.14% (Tounkara, Sarro, Kristensen, Dao, Diallo & Diarra, 2009). This is a clear contrast from the studies documented from the different geo-political regions in Nigeria and may differ from what is tenable in other climes. A review of comparative studies on the prevalence of HBV among HIV-infected patients in four continents; Asia, Africa, America and Europe, reported higher prevalence of co-infection among patients in the developed continents of America and Europe, as against those in the developing continents of Africa and Asia (Askari, Hakimi, Nasiri, Hassanshahi & Kazemi, 2014). The higher prevalence in the patients of developed continents was attributed to better diagnostic equipment and lower sensitivities available in these continents, as against the developing continents.

The treatment of co-infection with HIV and any of HBV or HCV is another area of interest that have elicited several research discourses. At the moment, HAART is the mainstay for individuals with HIV infection and the combination of HAART regimen for the different co-infection varies. This regimen, HAART, comprises of five main drugs that include; tenofovir, Ribavirin, sofosbuvir and emtricitabine. Studies have reported that in cases of HIV/HBV co-infection, tenofovir and emtricitabine should be employed, since these drugs are effective for the two viruses and reduces the likelihood of HBV developing resistance for any of the drugs, while in co-infection of HIV/HCV, ribavirin and sofosbuvir should be used, just as HBV vaccine can be administered in situations of HIV/HBV co-infection (National Guidelines for Human Immunodeficiency Virus Prevention, Treatment and Care, 2016).

While several studies have been conducted both within and outside Nigeria to ascertain the prevalence of HBV or HCV co-infection among HIV patients on HAART, there is scanty data regarding this in the study area, thus necessitating this study, hoping that it will not only serve as reference, but also avail clinicians and scientists the required information for prompt decisions when attending to these category of patients.

METHODOLOGY

This purposive, cross-sectional study was conducted at the Anti-retroviral clinic and Pathology laboratory of the University of Port Harcourt Teaching Hospital (UPTH), Nigeria, a tertiary healthcare facility located in the southern region of the country and caters for the training of medical students and other allied medical professions, medical and epidemiologic research, as well as, treatment and counseling of medical conditions. A minimum sample size of 38.33 was obtained for the study, using a prevalence of 2.56% (being the average for 4.7%, 0.7% and 2.3% reported for HIV, HBV and HCV respectively) as reported by Nnekanyi et al. (2020), Diwe et al. (2013) and Adewole et al.  (2013). However, owing to the small nature of the calculated minimum sample size, it was increased to 100, to make it significant.

5ml venous blood sample was obtained from each participant in the study using an ethylene diamine tetra acetic acid (EDTA) bottle, after they consented to participate and this analyzed by the aid of an auto-analyzer and the result entered into statistical package for social sciences (SPSS) version 22, where both descriptive and inferential analysis were performed. The socio-demographic parameters of the respondents were obtained using a structured questionnaire and also analyzed. Ethical approval for this study was obtained from the Research Ethics Committee of the University of Port Harcourt Teaching Hospital.

RESULTS

This study had more females, 77.0%, they mostly had secondary school education, 59.0%, with the least having primary school education, 18.0%, and were mostly civil servants, 43.0%, while 27.0% were traders and 17.0% were schooling. Also, majority, 87.0% were Christians, but 6.0% were Muslims and they were mostly Ijaws by ethnicity, 39.0%, followed by Igbos, 35.0%, while the least were Hausas, 4.0%.

In table 2 above, it was observed that most of the respondents have heard about the HBV and HCV, 84.0%, with most of them hearing about it in the hospital, 36.9%, followed by school, 32.1%, while the least heard from friends/family members, 6.0%. However, 98.0% had not been infected by any of the hepatic viruses, with all of them affirming that the viruses can be treated, 100.0%, while 68.0% responded that it can affect anybody, while only 1.0% mentioned it can affect children. Similarly, 72.0% of the respondents agreed that the viruses can be treated medically, but 1.0% person mentioned its treatment by fasting/prayer, with less than half, 46.0% taken vaccination against the viruses and those that have not been vaccinated was mostly due to the cost, 88.9%, while the least was due to attitude of health personnel, 1.9%.

The factors that influence the transmission of hepatitis B and C viruses, according to the respondents in this study, is presented in table 3 above. It shows majority of them responding to sex, 51.0%, followed by blood transfusion or blood products, 37.0%, while lifestyle is the most reported risk factor for contracting the viruses, 71.0%, followed by smoking, 13.0%, and the least being canned foods, 1.0%.

DISCUSSIONS

This study recorded more female participation, 77.0%, majority had secondary school education, 59.0%, mostly Civil servants, 43.0%, mostly Christians, 87.0% and mostly Ijaw by ethnic inclination, 39.0%. The finding about more female participation in this study is not surprising, due to the known fact that the female reproductive tract is more receptive and bound to be more impact in infections contracted through sexual intercourse, such as HIV, HBV and HCV. Apart from this, females tend to be more pursuant to seek healthcare than their male counterparts, except the health condition has truly impacted the males, before they reluctantly seek health care. This is in confirmation by the WHO (2019) that women tend to seek help more for their health needs, as well as, being more infected with venereal diseases that are usually, long-standing, owing to the long duration associated with it before clinical symptoms begin to manifest, sometimes, years.

This study also observed that majority of the respondents have heard of HBV and HCV, 84.0%, with many hearing of it in the hospital, 36.9% and the least heard from friends/family members, 6.0%. HIV, like HBV (usually commonly known as hepatitis), are widespread disease conditions, especially, the former, and majority of the populace are aware of it, due to the fact the fact that information about them are ubiquitous. The findings of HIV and HBV in this study are in tandem with those of Ndifontiayong et al. (2021) and Naghavi et al. (2015) respectively. It was also observed in this study that 98.0% of the respondents had not been infected by any of the hepatic viruses, with all of them affirming that the viruses can be treated, 100.0%, with only 1.0% indicating infection in children, while 72.0% confirmed the efficacy of medical treatment for the viruses and 46.0% had been vaccinated against the viruses. This agrees with the report by Highleyman (2010) that although HBV and HCV are in existence and widespread, their prevalence is considerably low in the general population (McMahon, 2005).

We also observed that shows majority of our study participants responded to sexual intercourse being the main route for transmission of the hepatic viruses, 51.0%, followed by blood transfusion or blood products, 37.0% and lifestyle is the most common risk factor for contracting the viruses, 71.0%.  The findings of this study disagrees with that of Liaw et al. (2010), which reported that the parenteral route is the most dominant route of transmission of HBV, HCV and HIV globally, especially, through mother to child transmission during delivery and breastfeeding, while other routes, like sexual intercourse, are also common. The prevalence of HBV, HCV and VDRL among HIV-infected patients on HAART in this study was 96.0%, 98.0% and 99.0%. This is an attestation of the finding by McMahon (2005) that the global prevalence of the hepatic viruses was low in the general population. Similarly, we observed statistical significance of HBV (0.042) and HCV (0.021) venereal diseases, such as HIV. This, we believe to be a common trend, since they mostly share common routes of transmission. However, it confirms the reports by Xie et al. (2016), Milazzo and Antinori (2014), and Lavanchy (2004).

CONCLUSIONS

There seems to be low prevalence of the hepatic viruses, even among HIV infected persons in the general population, while the existence of a venereal disease may encourage or serve as risk factor for contracting the hepatic viruses, since they share similar routes of transmission. This, calls for more concerted efforts at educating the populace about the risk factors and common routes of transmission of these viruses.

Conflict of Interest

None.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#Hepatitis #venereal disease #HIV #HAART #infection #Shahraz #Mokdad #HBV #Akingbola #Odaibo #emtricitabine #socio-demographic #Abel Charles #jcrmhs

[jcrmhscasereports]

Primary Breast Angiosarcoma: A case report and literature review  BY  Athanasios Armakolas IN Journal of Clinical Case Reports Medical Images and Health Sciences

ABSTRACT

Breast angiosarcomas are a specific subgroup of sarcomas classified as primary or secondary, the latter being related with radiotherapy following breast conserving surgery and the presence of chronic lymphedema. Primary breast angiosarcomas predominantly occur in younger females usually with non-specific clinical and imaging features. Surgery is the treatment of choice. Standard guidelines are not available in the absence of consensus on the effectiveness of chemotherapy. Adjuvant radiotherapy has been used for local control. We present a case of a primary breast angiosarcoma on the grounds of a previously excised benign lesion and review the literature on these aggressive tumours.

Keywords: Angiosarcoma, breast, primary, case report.

CASE REPORT

A 55-year-old postmenopausal, otherwise fit and healthy female, presented to our breast clinic with a few months history of a developing localized soft swelling and fullness in the upper inner quadrant of her left breast. She had a family history of two second degree relatives with breast cancer. Four years earlier she had an open biopsy of a reportedly palpable mass of the upper half of the same breast.  Histology of that specimen demonstrated a benign complex sclerosing lesion with negative CK 5/6 and P63 immunostaining assay.

On clinical examination a mild diffuse swelling was observed.There was no tenderness, skin discoloration, nipple discharge or retraction. The patient was referred for diagnostic work up including mammogram, ultrasound and breast MRI. Digital mammography with 3D tomosynthesis demonstrated the presence of heterogeneously dense breast tissue (ACR C) with no suspicious findings, asymmetry and discrete mass or suspicious calcification. The ultrasonographic evaluation revealed a diffuse ill-defined area of increased echotexture containing multiple hypoechoic non-vascular lesions with a maximum diameter of about 4cm.  MRI demonstrated a 6cmarea, exhibiting persisting and plateau enhancement kinetics and a heterogeneous signal intensity on T1 and T2 weighted sequences, reflecting the presence of glandular and adipose tissue components. A hamartoma was reported in the differential diagnosis of the MRI report. There were no clinical or imaging signs of lymphadenopathy. The lesion was assigned a BI-RADS category IV (fig. 1a and b)

Figure 1: Mammogram, ultrasound and breast MRI: A. Spot compression mammogram with non-specific findings. B. Determination of a diffuse area of increased echo texture by ultrasonographic imaging. C. MRI indicates the presence of a large lesion of the superior inner quadrant of the left breast exhibiting persisting and plateau enhancement kinetics.

A second look US scan with multiple guided core needle biopsies was performed (fig. 1c). Pathology described a highly vascular tissue sample, vascular endothelial cells with mild cellular atypia, presence of hob nail like cells, and a Ki-67 of 20-30%. Immunostaining assay for vascular endothelial marker CD31 and markers FLI1 and ERG was markedly positive. A diagnosis of a low to intermediate grade angiosarcoma was concluded. Due to the discordance of the radiology and pathology reports, the sample was referred to a second pathologist who confirmed the diagnosis of well differentiated PBAS.  Staging with abdominal, chest and head CT scans did not reveal distant metastases (fig. 2a and b).

Figure 2: Surgical procedure: A. Surgical planning and mastectomy with partial excision of the pectoralis major muscle. B. Cross section of the resected breast showing a poorly circumscribed tumour that extends to the overlying skin.

Following a detailed discussion, the patient was submitted to a right mastectomy and sentinel lymph node biopsy. A superficial layer of pectoralis major fibers underlying the area of concern was removed en block with the breast. Gross examination of the specimen confirmed the presence of a 5,8cm tumor with irregular margins within the breast parenchyma. On cut section the mass had a dark brown to pink color and soft consistency. Microscopically, the tumor was composed of an intricate anastomotic network of vascular channels, with papillary formations, mild to moderate cellular atypia and a mitotic index of 8/mm². Necrosis was absent. The closest radial margin was > 15mm, while the posterior margin though close was negative and there was no infiltration towards the muscle fibers. The 2 sentinel lymph nodes were also negative. The final diagnosis was low/intermediate grade breast angiosarcoma (T3 N0M0) (fig. 3a, b).

Figure 3: Immunohistochemical analysis of the tunour: A. H& E staining. The tumour consisted of anastomosing vascular spaces, lined by cells with mild to moderate atypia. In the absence of high grade features elsewhere, this growth patern may mimic a benign vascular lesion. B. Neoplastic vascular spaces infiltrating a breast lobule. 

The oncology board suggested adjuvant radiotherapy only which the patient received in 30 cycles. At 15 months postoperatively the patient remains disease free.

DISCUSSION

Breast sarcomas account for less than 5% of soft tissue sarcomas and less than 1% of all breast malignancies, with angiosarcomas representing the predominant histological subtype. Breast angiosarcomas (BAS) have a vascular origin and based on etiology, are divided in two clinically distinct entities,primary and secondary(1). Primary breast angiosarcomas (PBAS) represent 0.04-0.05% of all malignant breast tumors. Approximately 20% of BAS are primary with an incidence of about 17 new cases per million women(2).  PBAS have no established risk factors. Even though the pathophysiological pathway underlying angiosarcomas formation remains unclarified, recent studies have defined risk factors including UV radiation, chronic lympoedema, occupational exposure to vinyl chloride and certain familial syndromes, with radiotherapy acknowledged as the predominant risk factor for secondary BAS (3). PBAS usually develop during the third and fourth decade of life (median age 35 years) (1,4) and are often associated with pregnancy as 6-12% of  PBAS cases occur in gestating women, suggesting involvement of hormonal mechanisms.  Hormonal dependency of PBAS is not supported by the fact that estrogen receptor positivity is uncommon. Moreover, cases of PBAS in post-menopausal women have been reported (5).

PBAS clinical manifestations vary. They may present with a sense of fullness of the breast, an evolving asymmetry or a rapidly growing painless palpable mass. The subcutaneous tissue and overlying skin are rarely involved. When the tumour is superficial skin thickening and purple/bluish skin discoloration or even ulceration may be apparent (6, 7). Nipple discharge and retraction has also been described (7).

The imaging diagnosis of PBAS is challenging especially in younger patients with dense breasts and low grade tumors. Mammography may demonstrate asymmetrical density or the impression of an ill-defined mass with irregular shape and circumscribed or indistinct margins. The presence of coarse calcificationsand skin thickening, have also been reported. Mammograms appear normal in one third of the cases (8,9,10). Ultrasonographic features are also non-specific and may include a hypoechoic or hyperechoic mass, diffuse ill-defined regions of mixed echo texture or even irregular anechoic cystic portions.Color Doppler may demonstrate hypervascularity (11,12). MRI is the imaging modality of choice for the characterization and diagnosis of BAS. In most cases MRI allows the assessment of the regional extent of the tumor and its vascular properties. Common findings include a heterogeneous mass with hypointensity on T1-wighted and hyperintensity on T2-weighted images, with washout kinetics being dependent on the grade of the tumor (2,13). PET -CT has been proposed for further investigation, with the lesions usually exhibiting diffuse FDG uptake(14).

Preoperative histological diagnosis by fine-needle aspiration or preferably tru-cutbiopsy,  can be challenging due to the highly vascular nature of these tumors and their resemblance to other breast abnormalities. A false negative rate of up to 37% has been reported for FNAC, however core biopsy specimens and full thickness incisional biopsies are considered conclusive (15,16).

Donnell et al have stratified breast angiosarcomas into three grades: 1)Group I (low grade) comprising of anastomotic vascular channels coursing through surrounding breast tissue, 2) Group II: (intermediate grade) with  increased mitotic rate, papillary formation with or without solid or spindle cell foci and 3) Group III (high grade) with prominent sarcomatous areas, solid and spindle cell foci with numerous mitosis, areas of necrosis, hemorrhage and infraction (17).  Characteristics of any of the above groups can co-exist in the same tumor, while the less well-differentiated features of groups II and III tend to be located in the tumor center rather than the periphery, thus explaining the large number of false negative FNAC exams and the need for thorough histopathological evaluation (7,17).

Various immunohistochemical stains are used to differentiate BAS from other types of invasive carcinomas. The presence of endothelial markers CD31 (the most specific marker), CD34 (the most sensitive marker) and factor VIII (von Willebrand factor) confirm the diagnosis. Ki-67 rates are exhibited indicating the invasive tendency of sarcomas. However, misdiagnosis is fairly common with up to 37% of cases being initiallyreported as benign (18,19,20). The differential diagnosis includes hemangioma, angiolipoma, pseudoangiomatous stromal hyperplasia, fibroadenoma, benign spindle cell proliferative lesion, mastitis, invasive carcinoma, squamous cell carcinoma with sarcomatoid features, myoepithelioma, fibromatosis, sarcoma-like liposrarcoma and malignant phyllodes tumor(21,22).

Staging is based on AJCC guidelines in accordance with other soft tissue sarcomas. Tumor grade and size, nodal involvement the presence or absence of distant metastasis are incorporated and evaluated (1 ). BAS show a propensity towards hematogenous rather than lymphogenous spread and aggressively procure metastases to the lungs, skin, liver, bones, central nervous system, spleen, ovary, lymph nodes and heart (23,24). Very rarely BAS can manifest bilaterally (7).

Surgery represents the curative modality of choice for BAS. Complete resection with optimal margins is the mainstay of treatment since positive margins are significantly associated with higher risk of local failure (8,25,26). Due to the rarity of the tumor, therapeutic recommendation between breast conserving treatment and total mastectomy is not yet definite, the former usually employed in small tumors where adequate margins can be ensured. Mastectomy is generally performed in larger or ill-defined masses.

Since BAS metastasize hematogenously axillary surgery isperformed in cases of clinically positive nodes, histologically proven isolated nodal disease or enlarged palpable nodes as intra-operative findings (15,27). There is no international consensus on adjuvant chemotherapy for operable or inoperable BAS orsubsequent metastatic disease. Adjuvant paclitaxel as first line treatment for unresectable BAS has been reported with promising results. Second line treatment options(pazopanib, bevacizumab, eribulin mesylate)have also been reportedrecently  (28,29). Given the benefits of chemotherapy in metastatic and unresectable BAS it is arguable that adjuvant chemotherapy should be advocated for patients with high risk localized disease.

Radiotherapy may be beneficiary, however, the validity of the studies is questionable due to the small number of cases. Previous studies supported adjuvant radiotherapy particularly in cases of incomplete surgical resection with positive margins (30). Radiotherapy is sometimes proposed for locoregional control and reportedly has a favorable outcome for patients with tumorslarger than 5cm who are at higher risk for local recurrence (31).

Several studies have classified BAS as an aggressive malignancy with a poor overall prognosis, compared with other breast malignancies. Grade and tumor size at diagnosis are considered to be the most consistent prognostic factors. Low grade tumors are associated with significantly higher survival rates, and according to some studies, with clinical presentation and overall prognosis (32,33). Although it is suggested that tumor size is an important prognostic factor and some studies have related larger tumors with decreased OS and increased risk of LR, however, these results are not reproduced in other studies depicting the need for a larger sample size (32,34,35). Positive margins are associated with worse prognosis (27). BAS median DFS and OS times are 2,26 years and 2,96 respectively, while the 5-year OS rate of localized PBAS is 50-60%(37). Case reports also suggest that PBAS may also rarely present as a multifocal tumor (38). A cohort study of 103 breast sarcoma cases 41% of which angiosarcomas, showed a statistically significant correlation between residual tumor and/or close margins (of less than 10mm) and poor survival rate (39). Several studies have illustrated the importance of tumor size as a prognostic factor revealing an increased risk of local recurrence and decreased overall survivor with large tumor size (40, 41). It has been reported that lymph node metastases may occur among high grade sarcomas in 3-25% of cases predominantly regional metastatic diffusion from epithelioid subtype sarcomas (42). Despite the hematogenous metastatic route attributed to angiosarcomas, lymph node metastasis has also been reported (38, 43). Therefore, sentinel node biopsy appears an acceptable choice, especially when the total mastectomy approach is preferred, potentially protecting the patient from a second surgery, in case the pathology report reveals the co-existence of synchronous invasive breast cancer. A case of concurrent breast stroma sarcoma and breast carcinoma has been reported in literature (44)

CONCLUSION

Primary breast angiosarcomas are rare and aggressive mesenchymal malignant tumors characterized by unusual clinical and radiological characteristics, rapid growth and high hematogenous metastatic potential. Our case illustrates their clinical, imaging and histopathological diagnostic challenges. Core needle biopsy is useful for initial diagnosis and Immunohistochemistry is mandatory since microscopic findings may be misinterpreted as benign. Complete resection with wide margins is the main surgical treatment goal. Axillary surgery should be tailored to clinical findings and surgery type. Chemotherapy may be beneficial in cases of high-grade and metastatic lesions. Despite the concern about the radiation related etiology of secondary breast angiosarcomas, it may reduce local recurrence rates following surgery for primary breast angiosarcomas.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#Angiosarcoma #breast #primary #case report #predominantly #chemotherapy #lymphedema #immunostaining assay #suspicious #heterogeneous #radiotherapy #PBAS #hemangioma #angiolipoma #pseudoangiomatous #Athanasios Armakolas #JCRMHS

[jcrmhscasereports]

Diuretics use in patients with Acute Renal Failure and Septic Shock by Dr Dale Ventour in Journal of Clinical Case Reports Medical Images and Health Sciences 

ABSTRACTS

Loop diuretics should be administered in the ‘de-resuscitative’ of sepsis, this occurs after the initial resuscitative period during sepsis. The dose of diuretic should be monitored and a continuous infusion of furosemide, which is the most prescribed diuretic, should be no greater than 4mg/min.

There needs to be caution with co-administered nephrotoxic agents such as aminoglycosides, other diuretics, NSAIDS as these increase the toxicity profile. Despite the popular use of loop diuretics in critical care, loop diuretic use in sepsis has not been shown to decrease patients’ mortality.

This manuscript aims to discuss the use of diuretics in patients with septic shock exploring the evidence and consensus about the use of this therapy in critically unwell patients.

KEYWORDS: loop diuretics, septic shock, oliguria, ototoxicity, renal failure, critical care.

INTRODUCTION

Loop diuretics can be used in critical care to manipulate urine output in patients with hypoperfusion. Loop diuretics benefit the renal medulla during hypoxia by decreasing the tubular energy requirements(1, 2), which makes it a very attractive addition for patients with septic hypoperfusion. A Meta-analysis by K M Ho et al 2006 did not find in reduction in in-hospital mortality, requirement for dialysis, length of stay or number of patients remaining oliguric(3). A positive diuretic response to furosemide may indicate that the patient is in the ‘de-resuscitative’ phase of sepsis and that renal impairment is less severe. It is also appreciated that patients with non-oliguric renal failure have a lower mortality than patients with oliguric renal failure(4). The timing, duration, and dosing of diuretic therapy, plays a significant role in the morbidity associated with diuretic therapy in sepsis.

Diuretics in critical care; is used as a prophylactic measure that is, to prevent the onset of renal failure; to alleviate renal impairment in patients with established renal compromise or to convert oligo uric to non-oligo uric renal failure. There was no evidence in the meta-analysis by Ho et al 2006 that there was any benefit in the above listed uses of diuretics(3).  There was great heterogeneity between groups in this analysis and most patients had existing renal impairment so that extrapolation to critical care patients with sepsis is problematic.

The goal of transitioning a septic patient from oligemic to non-oligemic renal failure is associated with a decreased mortality trend and diuretic therapy might aid patients with regard to normalizing positive fluid balances (5) but this intervention has associated risks and complications.

Diuretic therapy should be initiated not based on urine output but when the patient has transitioned from the early resuscitative phase to the “de-resuscitative” phase of septic shock. The transit point is determined clinically as the patient is no longer fluid responsive as per passive leg raises or with static/dynamic cardiac output monitoring, is less academic and inotropic support has stabilized or decreased.

Why does this matter?

There are associated side effects when initiating diuretic therapy in critically unwell patients such as ototoxicity, hypernatremia, hypotension and worsening renal function.

OTOTOXICITY

There is changes in the endolymph ionic concentration and fluid composition secondary to the inhibition of the Na-K-2Cl transporter within the stria vascularis of the inner ear(6). Aminoglycoside antibiotics potentiate furosemide ototoxicity, but noise trauma apparently does not. Methods of avoiding ototoxicity are suggested including slow continuous infusion rather than bolus injection, use of divided oral dose regimens, and the measurement of blood levels to avoid exceeding 50 mcg/ml of furosemide(6).

In heart failure patients as outlined by Salvador et al 2005(7), continuous infusions of furosemide resulted in a lower incidence of ototoxicity and fewer side effects. Continuous infusions resulted more than 30% increase in sodium excretion than bolus administration.

The ototoxicity induced by furosemide can be reversible although permanent deafness has been reported. The complication is related to both the peak serum drug concentration  and the accumulated dose from continuous infusion and is aggravated with the concurrent use of aminoglycosides or Non-Steroid Anti-Inflammatory Drugs. The maximum recommended infusion dose is 4 mg/min (8).

HYPERNATREMIA

Hypernatremia as outlined by Hai-bin Ni et al 2016(9) was associated with increased mortality whether or not it was associated with diuretic use, this is a common side-effect with liberal diuretic use within the Intensive Care.

Hypernatremia as an independent predictor of mortality regardless of aetiology, speciality and across patients with different ages and co-morbidities (10-14). Risk factors include advancing age, co-existent renal impairment, associated use of nephrotoxic drugs. The phenomenon is poorly understood but correction is based on balancing renal water loss with overcorrection with isotonic solutions versus hypotonic water correction.

It necessities the use of Nasogastric water, naturetics, 5% Dextrose administration, low sodium enteral feeds and re-constituting drugs with 5% Dextrose rather than saline to correct this electrolyte imbalance. These interventions further complicates the management of the critically unwell patient, prevention is of tantamount importance.

WORSENING RENAL FUNCTION

Numerous studies have indicated that there is no benefit in the use of diuretic therapy to improve outcomes in patients with established acute renal failure in Intensive Care (15, 16). Maeder et al 2012, indicated a trend toward worsening renal function in elderly patients with chronic renal failure within a medical Intensive Care(17). His definition of chronic renal failure was >0.5 mg/dl increase in baseline creatinine over the 6 months follow up, again the findings not only supported renal failure as an independent predictor of mortality, but it was also aggravated by escalating the loop diuretic dose [17].

HOW DO WE ADMINISTER LOOP DIURETICS?

Meta-analyses support the administration of loop diuretics as continuous infusions versus boluses as there is better diuresis at a lower cumulative dose(18), this will inevitably lead to fewer side effects and more efficient fluid balance.

It has been suggested that the infusion dose be limited to 4mg/min to minimize the side effect profile as the loop diuretic has a ceiling effect around this dose [9]. It is also proposed by this author that the diuretic be administered in the ‘de-resuscitative’ phase of sepsis to manage the patient’s overall fluid balance.

The use of diuretics should be for the shortest time possible as there are considerations for electrolyte abnormalities and ototoxicity with a clear focus on serum sodium to gauge the amount of free water loss. While I am not against the administration of loop diuretics in septic patients with acute renal failure the timing of administration of the drug class with the “de-resuscitative phase of sepsis” is vitally important.

DISCUSSION

There is a paucity of evidence supporting the use of loop diuretics in septic critically unwell patients with acute renal failure leading to improved mortality(19, 20). These studies have highlighted increased risk of complications such as electrolyte disturbance without reducing the need for continuous renal replacement therapy or the duration of renal replacement.

Ototoxicity remains an underreported complication as there can be other contributing factors for altered hearing after the critical care episode. This complication will contribute to a patient’s post critical care morbidity affecting patient and patient’s family quality of life.

The is wide variation with the timing, dose, and indication for diuretic therapy in critical care. Bolus administration, low-dose continuous infusions (20) or high dose titrated to urine output or daily fluid balance are all methods used to administer diuretics. Liborio et al in his observational study of over 14,000 patients found no decreased mortality in critically ill patients with over 60% of these patient experiencing sepsis with a dose of furosemide up to 80 mg/day(21)

CONCLUSION

The indication and use of diuretics in septic patients with oliguric acute renal failure is varied and confounded by timing and effective dosage. However, there are significant complications associate with the use of diuretics in the critical care population and need serious considerations prior initiation of this therapy as there is no mortality benefit in septic patients with acute kidney injury.

Acknowledgement: No acknowledgement

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#loop diuretics #septic shock #oliguria #ototoxicity #renal failure #critical care #NSAIDS #hypoperfusion #heterogeneity #hypotonic water #Dr Dale Ventour #jcrmhs

[jcrmhscasereports]

 Psychosocial Dynamism of Public Mass Shooting: A Reevaluation by Saeed Shoja Shafti MD in Journal of Clinical Case Reports Medical Images and Health Sciences

explicit societal requirements (Table 3).

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#mass shooting #multi-victim gun homicides #firearm homicides #shooting massacres #gun violence #unlawful death #forensic psychology #forensic psychiatry #criminology #Saeed Shoja Shafti MD #jcrmhs

[jcrmhscasereports]

 HEREDITARY FORM OF EPILEPSY ASSOCIATED WITH PYRIDOXAMINE 5'-PHOSPHATE OXIDASE DEFICIENCY IN A CHILD by Plotnikova I.A in Journal of Clinical Case Reports Medical Images and Health Sciences

SUMMARY

The article presents a clinical case of focal epilepsy with a status course of seizures associated with a genetic mutation in exon 1 of the PNPO gene, which led to pyridoxamine-5'-phosphate oxidase deficiency. The diagnosis was made late due to the misinterpretation of symptoms, which complicated the course of the disease. Despite the fact that the first symptoms in the form of seizures appeared at the age of 1 month, only at the age of 5 the diagnosis was verified by doing targeted DNA sequencing. At the moment, the patient is receiving substitution therapy in the form of pyridoxal phosphate 300 mg/day, which enabled unstable clinical remission. Right now, it is impossible to achieve complete control over the convulsive syndrome without a strict diet: dairy-free, meat-free, egg-free and low-protein fat-free food. Currently, further search for treatment methods continues to improve the patient's quality of life and ensure stable remission. A detailed analysis was given for further genetic verification based on the amino acid profile of the patient, and the rehabilitation potential was determined based on topical neuropsychological diagnostics performed on a non-verbal child.

Key words: focal epilepsy; Pyridoxal 5′-phosphate; vitamin B6; PNPO; vitamin B6-dependent epilepsy, neuropsychological diagnostics.

INTRODUCTION

Vitamin B6-dependent epilepsies are aheterogeneous group of autosomal recessive diseases that are caused by mutations of five different genes involved in vitamin B6 metabolism [1]. Vitamin B6 is present in many forms in the human diet, but only pyridoxal-5 -phosphate (PLP) plays a vital role in the metabolism of a number of neurotransmitters, especially the inhibitory mediator gamma-aminobutyric acid. Code errors leading to a lack of pyridoxal-5'-phosphate manifest as B6-dependent epilepsy, including pyridoxamine-5-phosphate oxidase (PNPO) deficiency, which affects the synthesis and recycling of pyridoxal-5'-phosphate [2,3]. Neonatal manifestation in the form of acute encephalopathy with biphasic epileptic seizures (or status epilepticus) is the main symptom of the disease. The first phase (early attacks) is accompanied by fever and a temporary recovery of consciousness and the development; the second phase is a global cognitive dysfunction (late attacks).

Resistance to traditional antiepileptic therapy requires patient's lifelong treatment by pharmacological doses of vitamin B6 in the form of pyridoxine (PN) or a biologically active form of pyridoxal-5’-phosphate [1,4].

Case reports of PLP deficiency, verified not only clinically, but also by exome sequencing, are quite rare as well as the methods for studying molecular markers of alpha-aminoadipic semialdehyde and pipecolic acid in body fluids [5–7]. The complexity of diagnosis is caused by multiple disorders in newborns, especially in case of a slow and incomplete response to pyridoxine [8].

Recent studies have shown that the main enzyme defect in pyridoxine-dependent epilepsy is caused by alpha-aminoadipic acid semialdehyde dehydrogenase in the pathway of cerebral lysine degradation. The accumulating compound, alpha-aminoadipine semialdehyde (alpha-AASA), is in equilibrium with delta-1-piperidine-6-carboxylate (P6C). P6C inactivates pyridoxal-5’-phosphate, causing severe cerebral insufficiency. Although treatment of pyridoxal 5'-phosphate deficiency can successfully control seizures, most patients develop some degree of disability, regardless of early diagnosis and treatment. Very few patients with normal intelligence have been reported [7].

Objective: to analyze the course of epilepsy with pyridoxamin-5’-phosphate oxidase deficiency in an 8-year-old patient with diagnosis verification by clinical exome sequencing.

MATERIALS AND METHODS OF RESEARCH.

The analysis of primary medical documentation from 2013 to 2021 of a patient born in 2013 was performed. We reviewed the materials on the topic using PubMed search engines for the period 2014-2021, correlation of literature data with a specific clinical case.

RESEARCH RESULTS AND THEIR DISCUSSION.

A clinical case

Girl, 8 years old, was born from IV pregnancy of a woman with a burdened obstetric history. At the age of 1 month, tonic-clonic convulsions were first noted during sleep: gaze adversion to the left, lasting 30 seconds - 1 minute; afterwards there was up to 4 seizures per day, daily. At the age of 1 year, she was hospitalized 4 times on an emergency basis for convulsive seizures. The child was observed by a neurologist-epileptologist with a diagnosis of perinatal damage to the central nervous system, recovery period. Valproic acid was prescribed at a dosage of 50 mg/kg per day, oxcarbazepine 300 mg/day, without an effect of therapy. At the age of 2 years, she was hospitalized three times in the intensive care unit due to the status course of an epileptic seizure with a rise in temperature to febrile numbers. Neurological diagnosis at that time was: symptomatic epilepsy with complex partial seizures, status course of generalized convulsive seizures. On electroencephalography (EEG): moderate diffuse changes in the bioelectric activity (BEA) of the brain in a disorganized type. The patient's condition worsened. At the age of 3 years, she was observed in the State Autonomous Healthcare Institution of the Sverdlovsk Region "Children's City Clinical Hospital No. 9, Yekaterinburg" with the same diagnosis; the dose of oxcarbazepine was increased to 500 mg/day, valproic acid to 300 mg/day with no significant clinical effect. At the age of 4 years, she was hospitalized three times in the intensive care unit about epileptic seizures, without the effect of anticonvulsant therapy. Concomitant diseases at age 4 were: severe osteoporosis of the visible parts of the skeleton; pathological compression fracture of the body Th11; hepatomegaly; moderate expansion of the common hepatic, common bile ducts; enlargement of the gallbladder; a pronounced increase in the size of the kidneys, pancreas; diffuse changes in the parenchyma of the kidneys, a single cyst of the right kidney; unspecified form of caries; chronic gingivitis. Computed tomography of the abdominal aorta and its branches showed no evidence of hepatic artery stenosis. Autonomic dysfunction of the sinus node was noted: sinus arrhythmia with episodes of bradycardia. There were also small anomalies in the development of the heart: a functioning foramen ovale, additional chords of the cavity of the left ventricle.

DNA sequencing was carried out in 2017. Genetic mutations that were identified are described in patients with epilepsy associated with pyridoxamine 5'-phosphate oxidase deficiency and, based on the totality of information, regarded as pathogenic - a mutation in exon 1 of the PNPO gene (chr17: 46019139A> T, rs370243877), leading to amino acid replacement at position 33 of the protein (p.Asp33Val, NM-018129.3, mutation frequency in the ExAC control sample 0.0235%); as probably pathogenic - a previously undescribed heterozygous mutation in intron 3 of the PNPO gene (chr17:46022086G>A, rs766037058), leading to disruption of the splicing site and synthesis of the full-length protein (c.363+5G>A, NM_018129.3, OMIM: 610090, the value of the algorithm for predicting its influence on the function of AdaBoost splicing sites is 1.000).

A heterozygous mutation was also found in exon 4 of the EARS2 gene (chr16:23546678A>T), leading to a premature translation termination site at codon 163 (p.Tyr163Ter, NM_001083614.1). Such mutations have been described in patients with combined oxidative phosphorylation deficiency type 12 (OMIM: 614924). In this case (when no second mutation in the gene is detected), the result is regarded as an option with uncertain clinical significance, however, the mutation may be related to the phenotype. The parents did not undergo a genetic examination.

Prescribed treatment was: pyridoxine hydrochloride intramuscularly, then - pyridoxal phosphate at the rate of 10-50 mg / kg /day. On the 7th day after the start of treatment, the patient's consciousness was assessed as clear, she was able to sit up independently and stand with support. Her seizures stopped, appetite improved, during rehabilitation positive dynamics in neuropsychic development was noted with an expansion of the range of motor activity, the appearance of gaming activity, emotions and attempts to pronounce individual sounds.

At the age of 5 years 1 month there was a new epileptic seizure. The dose of pyridoxal phosphate was increased to 600 mg/day, convulsive attacks stopped. Concomitant diseases at age 5 were perianal dermatitis, vulvitis, continuously recurrent leukocyturia. Subsequent courses of medical rehabilitation was prescribed with positive dynamics.

In 2019, hyperkinesis (blinking), tremor, restlessness reappeared; in the summer were tonic-clonic seizures with vocalization, lasting 15-20 minutes and the status course of an attack, operculations, loss of appetite. By the end of the year, there was constant nausea and a gag reflex at the sight of food, vomiting with yellow mucus and a sour smell once every 5-7 days, accompanied by febrile fever, the smell of "rotten cheese" from the scalp and excrements during attacks. Motor clonic seizures appeared with a frequency of once every 1-2 months, symmetrical chill-like tremor - up to 3-5 times a day. Periodic episodes of psychomotor agitation, stereotyped movements were also noted.

Neurological status. There are bradypsychia, delayed psycho-motor development, coordination disorder. Patient does not pronounce words, speech is active only during the game-vocalisms, self-service skills are not formed. Autism spectrum disorders with general speech underdevelopment of level 1, psychomotor alalia were noted. Cerebral, meningeal symptoms are negative. The gait is uncertain. Cerebellar tests are negative. Cranial nerves: palpebral fissures D=S, pupils D=S, pupil reaction to light: direct D=S, consensual D=S. The volume of movement of the eyeballs is complete D=S, there is no nystagmus. The face is symmetrical D=S. There is no language deviation. Swallowing, phonation are not disturbed. Muscle tone: arms - reduced D=S, legs - normal D=S. Tendon reflexes: from the arms and legs increased D=S. There are no pathological foot signs, pelvic functions are preserved. Patient shows signs of slightly asymmetrical (with an accent on the left) motor awkwardness, reduced nutrition (Body weight 21,5 kg).

Results of instrumental and laboratory studies. The following disorders were detected on the EEG prior to the start of etiological therapy: Epileptiform activity in the form of "peak-wave" complexes in the frontal and central-temporal leads, more on the right; slowing down of activity in the temporal zone.

In the biochemical analysis of blood the level of amino acids (µmol/l) is low: alanine 119.30; glutamic acid 72.00; glycine 86.50; ornithine 22.10; proline 87.00. Activity of alanine aminotransferase is 24.9 U/l (reference values 0-29 U/l), aspartate aminotransferase - 26.4 U/l (reference values 0-48 U/l).

 Control visit. After the diagnosis was verified by exome sequencing, the patient was prescribed etiotropic therapy: pyridoxal phosphate 300 mg/day. The pre-elevated (1070 nmol/l) plasma concentration of vitamin B6 (pyridoxal-5-phosphate) normalized. EEG data - video monitoring showed moderately severe violations of BEA of the brain; the main rhythm is formed by age; registered regional slowing of the rhythm in the right central-parietal region. Epileptiform activity, clinical paroxysms, EEG patterns of epileptic seizures were not registered.

Final diagnosis: Genetic focal epilepsy due to a mutation in the PNPO gene (chr17: 46019139A> T, rs370243877). The type of attack is focal with impaired consciousness. PNPO developmental and epileptic encephalopathy. Cognitive impairment. Alalia. Motor awkwardness.

Psychological status. Diagnostics of cognitive activity showed that the girl is accessible to contact; she does not speak and comprehension of the speech is shown only in the form of understanding simple commands and simple instructions for the task. The child's object-sensory activity is carried out 100% through visual perception and shape perception, the perception of size is developed by 50%, spatial perception - 12%, color perception is completely absent. The insufficiency of these afferentations is a consequence of the decrease in the “zone of actual development”, which may be attributed to pedagogical neglect. In the motor sphere, gross motor skills are fully formed, fine motor skills are developed by 54%, objective activity is formed by 9%, taking into account the skills of game and constructive praxis, speech function is developed by 25%, self-service skills - by 60%, socialization – by 40%. Psychological diagnostics of the state of higher mental functions was carried out by depicting the structural and functional features of the brain, as a result of which topical insufficiency of brain areas was revealed. Figure 1 shows the level of formation of brain zones.

Figure 1: The degree of formation of brain departments that implement sensory and motor skills.

Despite the pronounced cognitive deficit in the child, the implementation of the program of psychological rehabilitation may expand the "zone of actual development" in the structure of the sensory, subject and pedagogical profile (since there are preserved components of cognitive activity)

DISCUSSION

Patient’s clinical diagnosis was established only at the age of 5 years, based on clinical manifestations and exome sequencing. The primal reduction of the dose of pyridoxal-5'-phosphate provoked a relapse of status epilepticus and a regression of acquired cognitive skills. A subsequent increase of treatment in combination with dietary therapy provided an unstable clinical remission without further improvement in the patient's condition. Such a response to the therapy has also been demonstrated in other studies [6,7].

Although in patients with a typical course of the disease, there is a several-fold increase in the level of glycine and glutamic acid in the blood plasma [1,5–7,9], in our case there is a decrease in glycine to 86,50 µmol/l (norm: 100-400 µmol /l) and other amino acids. Hypoglycinemia is an extremely rare condition, it occurs only in severe hereditary aminoacidopathy, but in our patient, tandem mass spectrometry was performed twice (including against the background of an attack) in 2016 and did not show any data of hereditary aminoacidopathy, organic aciduria, defects β-oxidation of fatty acids. The girl has a positive reaction to the oral intake of amino acid complexes and glycine separately, therefore, additional genetic analysis can be performed for 3-phosphoglycerate dehydrogenase deficiency, the clinical manifestations of which may be encephalopathy and seizures unresponsive to anticonvulsants [10]. Symptoms of this disease can be stopped by joint intake of serine and glycine so this diet may be developed for our patient. The study of vitamin B6 metabolites in de novo serine biosynthesis by Ramos et al (2017) had one group of rats which received a pyridoxine-deficient diet, while the diet of the control group of rats contained a normal amount of pyridoxine. This study has demonstrated a decrease in serine biosynthesis in Neuro-2a cells in vitamin B6 deficient rats. The pyridoxal-5'-phosphate-dependent enzyme phosphoserine aminotransferase (PSAT, EC 2.6.1.52) cannot function fully in conditions of vitamin B6 deficiency, and likely reduces the synthesis of phosphoserine and serine in animals on a pyridoxine-deficient diet. The production of glycine depends on the availability of serine and on the pyridoxal-5'-phosphate-dependent enzyme SHMT, which catalyzes part of the transformation of glycine, and the simultaneous deficiency of serine and pyridoxal-5'-phosphate can reduce its activity and lead to a decrease in the content of glycine in blood plasma [9].

Some authors reported EEG changes in patients with pyridoxine-dependent epilepsy [11]. In our patient, no clear epileptiform activity was registered either before or after the start of treatment with pyridoxal-5'-phosphate; this variant of EEG was also described by other researchers [5,6]. Changes in the brain during magnetic resonance imaging in patients with pyridoxine-dependent epilepsy may vary from normal to diffuse atrophy of the gray and white matter of the hemispheres [2]; in our case no changes were detected.

According to Plecko B. Et al., with late diagnosis stable remission after the appointment of pyridoxal-5'-phosphate is observed only in a few patients [1]. Early treatment is critical to prevent irreversible damage to the central nervous system and shows positive results [1,5,6]. Patients with pyridoxine-dependent epilepsy require lifelong supplementation with pyridoxal-5'-phosphate. Therapeutic doses of the drug vary from 15 to 30 mg/kg/day [1]. The daily requirement for vitamin B6 in infancy is 0.1–0.3 mg. Pyridoxal-5'-phosphate doses up to 500 mg/day are considered safe in children with classical vitamin B6 deficiency, but higher doses may cause reversible sensory and rare motor neuropathy [1], so total daily doses of pyridoxal-5'-phosphate, should not exceed 200-300 mg. There are no data on the optimal dose of the vitamin for long-term treatment. In experimental animals, doses of pyridoxal 5'-phosphate >50mg/kg/d induce ataxia, peripheral neuropathy, and muscle weakness; histological examination demonstrates neuronal damage with loss of myelin and degeneration of sensory fibers in peripheral nerves, dorsal columns of the spinal cord, and descending tract of the trigeminal nerve. In most cases of peripheral neuropathy, the total dose of pyridoxal 5'-phosphate is >1000 mg/day. Some children who take high concentrations of pyridoxal-5'-phosphate develop a persistent increase in transaminases with progression to cirrhosis and hepatocellular carcinoma [3]. To avoid side effects, a fixed effective dose should be used. However, studies showed that daily doses up to 1100 mg/day and 50 mg/kg/day to achieve a state without epileptic seizures did not cause any side effects when they were divided into 4–5 doses per day [12]. In our case the doses of pyridoxal-5'-phosphate less than 600 mg/day induces epileptic seizures and cognitive disfunction. Some mutations in the genes encoding of pyridoxamine-5-phosphate oxidase may require the combined treatment with pyridoxal-5'-phosphate and pyridoxine [12,13]. It is possible that such treatment will have a positive response in our patient as well.

Another interesting feature of this clinical case is an intolerance of the patient to many products: remission occurs only on a low-protein, low-fat diet with the exclusion of dairy, meat products and eggs. Similar dietary restrictions are observed in ALDH7A1 deficiency (antiquitin deficiency), which often accompanies PNPO gene mutation. In our case ALDH7A1 deficiency was excluded by exome sequencing [13,14]. However, a lysine-restricted diet can also be effective for homozygous mutations in the PNPO gene in some patients [14]. As an example of a diet, the recommendations of Koelker and Ross on glutaric aciduria type I can be used [15].

The patient also has a high content of vitamin B6 in plasma (775.0 nmol/l), which is typical response to an intake of pyridoxal-5'-phosphate (described levels of vitamin B6 in plasma: 400 nmol/l, 1060 nmol /l and 624 nmol/l) [12,18]. It is not known why some patients continue to have seizures even when taking high doses of pyridoxal-5'-phosphate, while others grow almost normally [1,7,19]. The long-term prognosis for this patient remains unclear. For our patient a clarifying genetic study with modification of pharmacological treatment and diet is required, considering that the girl does not tolerate protein hydrolysates and an unstable clinical remission only on a low-protein low-fat diet with the exclusion of dairy, meat products and eggs.

CONCLUSIONS

DNA diagnostics using the method of sequencing of exome regions of the genome is a key method for early verification of the diagnosis of epilepsy in newborns and young children, which in combination with the therapy can improve the prognosis.

The presence of heterozygous mutations in this clinical case suggests other metabolic deficits, which complicates the selection of treatment and requires additional examination of the exome.

To ensure stable remission, nutritional correction is required to compensate for deficient conditions during severe elimination measures, as well as the selection of the minimum sufficient dosage of pyridoxal-5'-phosphate in combination with pyridoxine hydrochloride.

Topical neuropsychological diagnostics and psychological correction based on intact higher mental functions makes the recovery of the patient possible.

Conflict of Interest: The authors of this article have confirmed that there are no conflicts of interest or financial support to report.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#focal epilepsy #Pyridoxal 5 #phosphate #vitamin B6 #PNPO #vitamin B6-dependent epilepsy #neuropsychological diagnostics #DNA #aheterogeneous #alpha-aminoadipine #semialdehyde #Plotnikova I.A #jcrmhs

[jcrmhscasereports]

Case of Necrotizing Pancreatitis following COVID-19 Infection by Faezeh Sehatpour in Journal of Clinical Case Reports Medical Images and Health Sciences  

ABSTRACT

New aspects of COVID-19 are increasingly being recognized. Although the virus is mainly known to affect the lungs, involvement of other organs including the heart, liver, gastrointestinal, renal and pancreas is also detected. Acute pancreatitis is detected as one of both the early and late presentations of COVID -19. Cytokine storm or the presence of angiotensin-converting enzyme 2 (ACE2) receptor in pancreatic cells, are both two causes of pancreatic injury in COVID-19 infection. In this study, we reported a 25-year-old man admitted to our department with the impression of necrotizing pancreatitis concomitant with COVID-19 infection. Patient's lab data, imaging and outcomes were documented in full detail.

Abbreviations:

WBC, white blood cell;HB, hemoglobin; MCV, mean corpuscular volume; PLT, platelet; BUN, blood urea nitrogen; Na, sodium; K, potassium; ; AST, aspartate aminotransferase; ALT, alanine aminotransferase; ALK.P, alkaline phosphatase; ALB, albumin; LDH, Lactate dehydrogenase ; CPK, creatine phosphokinase; CRP,c-reactive protein; AFP,alpha-fetoprotein; CEA,carcinoembryonic antigen; CA19-9,cancer antigen 19-9; Immunoglobulin G4.

INTRODUCTION

The Covid-19 pandemic is an ongoing pandemic that started in December 2019 and spread rapidly around the word. COVID-19 was caused by severe acute respiratory syndrome corona virus 2 (SARS-CoV-2), first identified in Wuhan, China. So far, more than 200 countries have been affected by the pandemic. (1)

New aspects of COVID-19 are increasingly being recognized. Although the virus is mainly known to affect the lungs, involvement of other organs including the heart, liver, gastrointestinal, renal and pancreas is increasingly being reported. (2)

The involvement of the gastrointestinal system is maybe due to the expression of the angiotensin-converting enzyme2 (ACE2) on the hepatocyte, cholangiocyte and  other parts of the GI tract. (3) In a recent survey, acute pancreatitis was detected as one of both early and late presentations of COVID -19. (4-6) However, it is still unclear whether SARS-COV-2 directly affects pancreatic cells because of ACE2, if it is a cytokine storm which causes pancreatic injury. (7)

We reported a case of COVID-19 with subsequent acute necrotizing pancreatitis.

CASE REPORT

A 25-year-old man without any known medical disease presented to our emergency department with progressive epigastric pain, nausea and vomiting and anorexia one week prior to admission. He has no history of alcohol consumption. He also had a history of admission to another hospital about two weeks ago with a diagnosis of COVID-19 pneumonia. On admission, he has a blood pressure of 115/75 mm HG, a heart rate of 100 beats per minute, a temperature of 37.1 ⁰C and oxygen saturation of 95% while the patient is breathing in the room air. Primary investigations summarized in Table-1. Amylase and lipase were 146 IU/L and 82 IU/L respectively. Nasal swab test for COVID-19 (RT-PCR for SARS-CoV-2) was positive. Abdominal sonography showed markedly prominent pancreas with in homogeneous parenchymal echogenicity and large cystic lesion arising from the pancreas, in favor of acute complicated pancreatitis with pseudo cyst. The gall bladder has a normal size and wall thickness without any gall stones. The pancreatic duct was not dilated.  Due to the finding of abdominal ultra sound, CT scan of abdomen was done on him which revealed an enlarged pancreas with necrosis of the main portion of pancreatic parenchyma. Large cystic lesion measuring 15×7×11 cm in size arising from the pancreatic neck with extension to the right and left side of the abdomen suggestive of large pancreatic pseudo cyst (figure1).  Lung HRCT (low dose) also showed bilateral peripheral ground glass opacities in favor of COVID-19 pneumonia (figure2). According to the findings of a physical exam, laboratory data and clues in imaging immediate management of acute necrotizing pancreatitis (invasive intravenous hydration and pain control) was started for him. He was finally discharged from the hospital with a full recovery.

Table 1: laboratory data

Figure 1: Abdominal CT scan:  large loculated pseudo cystic structure measuring about 158mm*100mm in lesser sac due to post pancreatitis pseudo cyst formation.

Figure 2: lung HRCT: multiple ground glass and bilateral pleural effusion

DISCUSSION

Acute pancreatitis is an acute inflammation of the pancreas characterized by abdominal pain, nausea, vomiting and elevated exocrine pancreatic enzymes; amylase and lipase. Gallstones and chronic alcohol abuse are the most common causes of acute pancreatitis. Viruses are uncommon causes of acute pancreatitis. Pancreatitis has been reported with several viruses, including mumps, coxsackievirus, hepatitis A and B virus, cytomegalovirus, varicella-zoster, herpes simplex and human immunodeficiency virus. (8)

Although we have not conclusively proven the presence of the virus in the pancreas, the causes of COVID-19 and acute pancreatitis and the lack of other clear causes for pancreatitis strengthen the relationship between the two diseases.  In this study, the patient presented with necrotizing COVID-19in 19 in the early post period of COVID-19 infection.

In Fan Wang and colleagues' survey, 52 COVID-19 cases followed and showed that 17% of COVID-19 patients developed pancreatic injury and presented with mild elevated pancreatic enzymes; serum amylase and lipase without clinically severe pancreatitis. The possibility of drug induced acute pancreatitis in patients who have received medication due to COVID-19 is also expressed as one of the reasons for acute pancreatitis in COVID-for19 infection. (9) Saffa Saeed Al Mazrouei and his teammates reported a 24-year-old patient with acute non-necrotizing pancreatitis with concurrent COVID-19. No evidence of pseudo cyst or abscess was detected in his imaging. (10)

Pancreatic damage can be due to the direct effect of the virus on pancreatic cells or indirectly secondary to the immune system. In another study in Wuhan, it showed that ACE2 was expressed in the pancreas higher than the lung in the normal population, indicating that SARS-CoV-2 can bind to ACE2 in the pancreas and cause pancreatic cell damage. (7, 11)

Acute pancreatitis is one of the presentations or complications of COVID-19 infection. Further investigation with samples is needed to reveal the pathophysiology, presentation, treatment and prognosis of acute pancreatitis in COVID-19 infection.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#COVID-19 #Cytokine storm #blood cell;HB #aminotransferase #CRP #c-reactive protein #carcinoembryonic antigen #alpha-fetoprotein #anorexia #RT-PCR for SARS-CoV-2 #HRCT #Faezeh Sehatpour #jcrmhs

[jcrmhscasereports]

 Morning Glory Syndrome by Mohamed Adbellahi Cheikh Ahmed in Journal of Clinical Case Reports Medical Images and Health Sciences

ABSTRACT

Morning glory syndrome is a birth defect that affects the optic nerve of the eye. The morning glory syndrome (MGS) or morning glory disc anomaly was named by Kindler in 1970 because of its resemblance to the morning glory flower. Morning glory syndrome can be associated with midline cranial defects and abnormal carotid circulation. We report the case of a 10-year-old adolescent, who was brought by his parents for a profound bilateral visual acuity decrease since birth. Ophthalmic examination revealed bilateral morning glory syndrome.

Keywords: Morning glory syndrome, morning glory disc anomaly, congenital optic nerve dysplasia, embryology

Morning glory syndrome is a birth defect that affects the optic nerve of the eye. The morning glory syndrome (MGS) or morning glory disc anomaly was named by Kindler in 1970 because of its resemblance to the morning glory flower.1 It is a congenital, funnel-shaped excavation of the posterior fundus that incorporates the optic disc, with a white tuft of glial tissue overlying the central portion of the disc and the increased number of blood vessels arising from the periphery of the disc. Morning glory syndrome can be associated with midline cranial defects and abnormal carotid circulation, such as carotid stenosis/aplasia or progressive vascular obstruction with collateralization

We report the case of a 10-year-old adolescent, who was brought to a consultation by his parents for a profound bilateral visual acuity loss since birth. The patient had no notable pathological history. His Visual acuity was limited to light perception. On examination, the anterior segment and tone was normal. On the fundus, we noted in both eyes an image of morning glory around the widened papilla with vessels in the radius of a wheel and a pigmented halo within an atrophic territory. There were no associated congenital anomalies and monitoring was instituted.

Conflict of interest: The authors declare no conflict of interest.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#Morning glory syndrome #morning glory disc anomaly #congenital optic nerve dysplasia #embryology #Ophthalmic #adolescent #abnormal #Mohamed Adbellahi Cheikh Ahmed #jcrmhs

[jcrmhscasereports]

A Rare cause of Troponin elevation: Focal Takotsubo Cardiomyopathy by Arzu Canan in Journal of Clinical Case Reports Medical Images and Health Sciences

CASE PRESENTATION

A 61-year-old woman with acute encephalopathy and acute cholecystitis, was found to have elevated troponin (high-sensitive troponin: 978 ng/L; >52 ng/L: abnormal), regional wall motion abnormality of mid anterior and septal segments and 50% LVEF on transthoracic echocardiography (Movie 1), without EKG changes. Patient denied chest pain, shortness of breath or palpitation.  Subsequent CTA demonstrated no coronary artery disease. ​

Cardiac MRI revealed LVEF 45%, focal akinesis of mid anterior and septal segments (Movie 2), and mild native T1 and T2 elevation without late gadolinium enhancement (Figure 1). Considering the concomitant medical stress and spontaneous troponin down titration (978 à 764 à711 ng/L), the patient was diagnosed with focal Takotsubo cardiomyopathy. Follow-up echocardiogram two weeks later demonstrated full recovery of wall motion abnormalities and 59% LVEF (Movie 3).

Takotsubo cardiomyopathy is usually associated with physical-emotional trigger and characterized by a variety of wall-motion abnormalities and transient LV dysfunction. Neurological disorders is a well-known trigger of Takotsubo cardiomyopathy and is more compared to patients with acute coronary syndromes. Although common presentation is acute chest pain, incidental troponin elevation or EKG changes can be the only finding. The most common type is the apical involvement resulting in apical ballooning. Isolated mid ventricular or basal involvement can also be seen. ​Focal anterior wall involvement is the rarest form and may mimic acute myocardial stunning or focal myocarditis. Small group of patient can have abnormal LGE while the majority of cases do not demonstrate any abnormal enhancement which can be helpful in distinguishing from other entities in addition to clinical and other ancillary findings.

Figure 1:

(a) 2-chamber steady state free precession still image in diastolic phase demonstrates minimal wall thinning of the mid anterior segment.

(b) 2-chamber steady state free precession still image in systolic phase shows focal akinesia of mid anterior segment resulting in focal bulging (arrow). Note the normal contraction at the basal and apical segments.

(c) 2-chamber phase sensitive inversion recovery (PSIR) image shows no late gadolinium enhancement.

Movie Legends:

Movie 1: Parasternal long axis view from the initial transthoracic echocardiography demonstrates the focal wall motion abnormality in the mid septal segment.

Movie 2: 2-chamber (a) and 3-chamber (b) steady state free precession cine clips from cardiac MRI demonstrates the mid anterior and septal wall motion abnormality.

Movie 3: Parasternal long axis view from the follow-up transthoracic echocardiography demonstrates the resolution of previously identified wall motion abnormality in the mid septal segment. Also note that, overall LV function has improved.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#echocardiography #encephalopathy #CTA #abnormality #transthoracic #Neurological #cardiomyopathy #EKG #LGE #phase sensitive inversion recovery #Arzu Canan #jcrmhs

[jcrmhscasereports]

Tardive Dyskinesia and the concept of dopamine supersensitivity Psychosis in a patient with Schizoaffective disorder after withdrawal of an atypical Antipsychotic drug by Autumn Loichle in Journal of Clinical Case Reports Medical Images and Health Sciences 

ABSTRACT

Antipsychotics are the first-line treatment for psychotic disorders, which have antagonistic effects on the D2 dopamine-receptor, reducing dopamine mediated transmission. Long-term use of antipsychotics can potentially lead to a likely irreversible disorder called tardive dyskinesia (TD). The Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM V) defines tardive dyskinesia as a medication-induced movement disorder that persists despite discontinuation or change of the medications.[1] While it is typical to see the development of TD with long-term use of antipsychotics, there are few reported cases reports of the development of TD with the withdrawal of antipsychotics. The development of TD symptoms with withdrawal of antipsychotics leads to the discussion of a phenomenon known as supersensitivity psychosis (SP). Supersensitivity psychosis was first defined as the emergence of psychotic symptoms with TD following the discontinuation of certain medications, typically antipsychotics. The following article presents the case of a patient diagnosed with schizoaffective disorder who developed TD after withdrawal of long standing administration of a second-generation antipsychotic, risperidone, whose symptoms began to improve after introduction and increased titration of clozapine. Furthermore, the following article summarizes the literature on supersensitivity psychosis in patients who were discontinued on antipsychotics and current practices for the treatment of SP.

INTRODUCTION

Antipsychotics are the first-line treatment for psychotic disorders, which have antagonistic effects on the D2 dopamine-receptor, reducing dopamine mediated transmission. Over time, however, the antagonistic effects of antipsychotics can lead to an upregulation of the D2 receptors to produce receptor supersensitivity in the striatum. The enhanced affinity of dopamine for its receptors is thought to contribute to the phenomenon of dopamine supersensitivity psychosis (SP). In patients with schizophrenia and other psychotic disorders, these neuroadaptations could lead to a compromise in treatment efficacy, promote a relapse to psychosis, and trigger movement disorders, such as tardive dyskinesia. These effects have been seen in patients treated with either first-generation antipsychotics (FGAs) or second-generation antipsychotics (SGAs), with a prevalence of 30% in schizophrenia and 70% in treatment resistant schizophrenia in patients treated with SGAs.[1] The following case report presents a patient with a diagnosis of schizoaffective disorder who develops supersensitivity psychosis symptoms after changes in her antipsychotic regimen and summarizes the literature on management for SP.

CASE DESCRIPTION

We present the case of  a 60 year-old female  with a medical history of generalized anxiety disorder, schizoaffective disorder – bipolar type, hypertension, hyperlipidemia, chronic kidney disease and congestive heart failure who was admitted under involuntary status for delusions and psychosis that began a few days prior to admission. Collateral information obtained from the patient’s husband revealed that the patient had been “manic” as demonstrated by a decreased need for sleep. He also states that the patient seemed to be mentally decompensating as demonstrated by displaying disorganized behaviors and speech including finding the patient standing on a stool in the closet staring at the ceiling and trying to turn on a television using a keychain. He reported the patient also had delusions that the world is ending, that she died and is currently in heaven, and that everyone around her is deceased. He also denied any suicidal ideation (SI) or attempts that they had observed.  The patient’s husband also reported her mentation became acutely worse over the past few days, which prompted her presentation to care. This was demonstrated by disorientation to the day and time, repeatedly asking the same questions, and forgetting her doctor’s names, whom she is usually able to identify. The patient is a poor historian as demonstrated by stating she is unsure why she is in the hospital, but believes she was admitted because of a stomach ache. She did however endorse a depressed mood, poor sleep, poor appetite, low energy, and poor concentration; she denied any guilt.

Collateral information was obtained regarding the patient’s psychiatric history up to the point of this admission.  The patient’s husband reported four months prior to this admission, the patient was expressing delusional thoughts and had auditory hallucinations. This behavior prompted admission to a behavioral health facility. While in treatment, the patient became catatonic and was transferred to a different behavioral health facility where she received eleven electroconvulsive therapy (ECT) treatments. He further stated that the patient was no longer catatonic after receiving ECT and was stable to be discharged home where the patient continued to receive ECT as an outpatient. He stated that the patient had been in her normal state of mental and physical health until development of her current symptoms a few days before this admission.

On mental status examination, the patient was calm on approach. Patient stated her mood is “fair and tired” and her affect was depressed and blunted. She was not oriented to place, time, or situation, but was oriented to self. She denied current suicidal or homicidal ideation. Her attitude was cooperative, calm, but unengaged as demonstrated by decreased eye contact and disinterest in conversation. There was no psychomotor agitation observed at that time. Speech was minimally coherent with one worded answers and low volume. Her thought process was slow and impoverished as demonstrated by increased latency of speech and looseness of association. She denied auditory, tactile, and visual hallucination to the best of her ability. She displayed overt delusions as demonstrated by stating she thought she was dead and everyone surrounding her was an angel. Memory was impaired as demonstrated by not being able to recall the events surrounding her hospital admission.

The patient’s psychiatric medications included trazodone 50 mg at bedtime (QHS), clonazepam 0.25 mg twice daily (BID), and risperidone 2 mg BID. The patient’s husband confirmed these medications and stated she had been taking them regularly for many years as prescribed. The patient’s course was complicated by progressively worsening psychosis. She became acutely agitated with disorganized behavior demonstrated by screaming in common rooms, walking around her room naked, and urinating and defecating in her bed. The internal medicine team was consulted to potentially rule out causes secondary to nonpsychotic origin. The medicine team evaluated the patient and determined her behavior and decompensating mental status was not due to any medical causes; complete blood count, comprehensive metabolic panel, and urinalysis showed no abnormalities. Neurology was also consulted and had no recommendations for changes in current management. The decision was made to begin clozapine 12.5 mg QHS for treatment resistant psychosis. After five days of administering clozapine, the patient continued to demonstrate disorganized behavior as displayed by yelling in common rooms and expressing delusions. The decision was made to taper risperidone over the next ten days and immediately increase clozapine to 25 mg QHS for treatment resistant psychosis.

The patient’s hospital stay was further complicated by extrapyramidal symptoms (EPS) witnessed by the nursing staff. Upon evaluation of the patient, she appeared to have symptoms consistent with tardive dyskinesia (TD) as demonstrated by abnormal movements of the mouth and jaw with lip smacking. It was noted by the patient’s nurse that these symptoms were not present at initial admission, but now seen for the first time. Patient also did not appear restless nor with other symptoms that would otherwise suggest akathisia at the time of exam. Tardive dyskinesia is made worse with benztropine (cogentin) and benadryl / antihistamines, and is typically treated with valbenazine or tetrabenazine, neither of which are available at the facility the patient is currently admitted to.  Of note, risperidone was recently tapered over the past ten days with the final dose being the morning of TD symptom onset. Clozapine is less likely to cause tardive dyskinesia when compared to other antipsychotics. As such, the plan was to continue with current medications, avoiding benztropine (cogentin) and benadryl / antihistamines, and re-evaluate the patient for ongoing treatment decisions. The patient was subsequently examined the next day, physical examination showed signs and symptoms of TD including irregular movement of mouth / tongue and an irregular blink. Clozapine 25 mg was increased to BID. The patient subsequently began to show improvement in signs and symptoms of TD six days after the increase of clozapine including less irregular movements of the mouth and tongue. There was no dystonia, akathisia, or EPS tremor. The patient’s TD symptoms continued to improve by evidence of less lip smacking and less irregular blinking until she was discharged with close outpatient follow up.

DISCUSSION

Antipsychotics are the first-line treatment for psychotic disorders, which have antagonistic effects on the D2 dopamine-receptor, reducing dopamine mediated transmission. The Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM V) defines tardive dyskinesia as a medication-induced movement disorder that persists despite discontinuation or change of the medications.[1] The disordered movements seen in tardive dyskinesia (TD) are thought to be caused by the blockade of D2 dopamine-receptors. The movement disorders include akathisia, dystonia, buccolingual stereotypy, chorea, tics, and other abnormal involuntary movements of the face, mouth, jaw, and extremities.[2] Most often, these dyskinetic disorders precipitate following chronic antipsychotic administration, however, there are reported cases of patients developing symptoms consistent with TD after withdrawal of antipsychotic medications.[3]

Supersensitivity psychosis (SP) was first defined as the emergence of psychotic symptoms with tardive dyskinesia and a decrease in prolactin levels following the discontinuation of certain medications. In the context of antipsychotics, there are four main clinical characteristics used to define medication-induced SP, including: 1) rapid relapse of symptoms following the discontinuation, dosing change, or a change in antipsychotic medication; 2) new onset tolerance after previously having therapeutic effects; 3) presence of TD; and 4) psychotic exacerbations due to life stressors. Additionally, in order to diagnose SP, a patient must also have been taking an antipsychotic for 3 months. It is hypothesized that what was previously described as “treatment resistant schizophrenia” is in fact SP, with SP being observed in 70% of treatment-resistant schizophrenic patients versus 30% in non-treatment resistant patients.[4]

Second-generation antipsychotics (SGAs) are widely used to treat a variety of psychotic symptoms, having largely replaced first-generation antipsychotics (FGAs) due to their more favorable side effect profile. Psychosis is believed to be due to excess dopamine signaling in the striatum, therefore both FGA and SGA work by blocking dopamine transmission in the striatum via the dopamine D2 receptors.[5] The D2 receptor is important with its involvement in SP, as antipsychotics are antagonists of this receptor postsynaptically.[6] It has been shown that the D2 receptor is prone to plasticity and remodeling. The effect of prolonged antipsychotic use on the intracellular system leads to an increased number of postsynaptic D2 receptors within the striatum, leading to hypersensitivity over time.[4]Our patient had been receiving chronic antipsychotic treatment for schizoaffective disorder for several years prior to her admission to the hospital. Therefore, it can be postulated that at this time she would have had an increased density of dopamine receptors in her striatum, which would have put her at increased risk for SP.  Shortly after a change to her medications, she developed TD symptoms such as lip-smacking, which was not experienced previously. This illustrates the possibility that our patient was experiencing SP due to prolonged use of her antipsychotics, which led to negative symptom development when her mediations were adjusted. As studies have demonstrated previously, as patients continue to take antipsychotics, the density of these receptors increase causing the need for increased levels of antipsychotics in order to control the increased dopamine levels to maintain symptom control.[7] This further perpetuates tolerance and increases the risk for SP.[4]

Similar to our case, another case report described a female patient who experienced TD after being abruptly withdrawn from risperidone, with resolution of symptoms occurring after starting a new antipsychotic medication. While TD can occur in all ages, it has been shown to be most common in elderly patients, particularly elderly female patients.[8] The patient we presented in this case was an elderly female, and given the previous findings of high-risk of TD and SP in this age group, greater care and monitoring should be taken when adjusting antipsychotic medications.

Due to the risk of severe psychosis and TD, it has been proposed that intermittent dosing, use of long-acting antipsychotics, and controlled tapering can help prevent SP. Furthermore, it is widely accepted that SGAs are less likely to invoke supersensitivity and drug-induced movement disorders when compared to FGAs, and therefore are the preferred first choice of medication when treating psychosis.[4] With this being said, many studies suggest the use of long-acting injectables, such as risperidone to prevent and reduce the incidence of SP.[4,9] A 12-month study evaluating treatment resistant patients (TRP) and dopamine supersensitivity patients (DSP) found that DSP had a significant improvement of symptoms while on long-acting risperidone, when compared to TRP. DSP patients at baseline had more severe extrapyramidal symptoms, however they had a 62% higher response rate to long-acting risperidone compared to 21% of non-DSP patients.[9] The long-acting and high-potency injectables have shown to stabilize the receptors and minimize fluctuations of dopamine, thereby decreasing the incidence of SP.[4]

When considering treatment for the symptoms of SP, medications should aim to reduce the increase in D2 receptor density.  One study suggests the use of anti-seizure medications such as valproate, carbamazepine, or phenytoin. The early addition of these medications with an antipsychotic has shown to potentiate the effects of the antipsychotic, thereby reducing the need for increased doses, and decreasing the likelihood of the patient developing SP.[10] Electroconvulsive (ECT) therapy has also illustrated the ability to normalize the density of D2 receptors, which was also found with our patient who had resolution of her catatonia after eleven ECT treatments.[4]

Another possible treatment option is the use of clozapine for SP symptoms. A study of 15 patients experiencing SP symptoms found that 13 of the 15 patients experienced no further SP symptoms after the initiation of clozapine for the duration of the 2.65 year follow-up.[11] The efficacy of clozapine on SP symptoms has been thought to be due to its role on GABAergic neurons and its potency on D2 receptors, however, this has not been clearly defined. Initially, our patient had no symptom relief upon starting Clozapine 25 mg once daily, but upon increasing the dose to twice daily dosing and tapering down off risperidone, her TD symptoms improved within six days. While our patient did not have complete resolution of her TD symptoms, she did experience symptomatic improvement. It is shown that only 33% of patients will have complete resolution of TD symptoms within two years, so it was not expected for her to have had complete resolution of the symptoms during our time frame of care for her.[3]

CONCLUSION

This case report highlights the importance of close medication follow-up and management with patients on long-term antipsychotics. The abrupt cessation or change of such medications can have deleterious consequences, with the most dangerous being tardive dyskinesia (TD). Therefore, it is important when considering medical management for patients with antipsychotics that consideration be placed into long-term injectables, such as risperidone, along with use of a second generation antipsychotics over first generation antipsychotics in order to prevent TD and supersensitivity psychosis (SP) from occurring. This is especially important in patients who need long-term management with antipsychotics. In addition, if a patient needs to be switched to another antipsychotic, slow tapering and close management is important in order to quickly identify TD symptoms and prevent the occurrence of SP. Finally, SP should be considered in patients who appear to be treatment resistant, as increasing doses of antipsychotics in this case can have continued damaging effects due to tolerance and hypersensitivity to the medications. The use of antipsychotics has been demonstrated to cause supersensitivity psychosis, with the most extreme form being tardive dyskinesia as highlighted in this case report. It is therefore important to carefully monitor patients when adjusting or tapering off any antipsychotics, especially those at higher risk, in order to prevent supersensitivity psychosis symptoms. It is recommended to use long-acting injectables, such as risperidone, as previous studies have shown it to reduce the risk of this phenomenon.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#Antipsychotics #DSM V #tardive dyskinesia #psychotic symptoms #TD #schizoaffective #electroconvulsive therapy #QHS #benztropine #EPS #Second-generation antipsychotics #TRP #SGAs #Autumn Loichle #jcrmhs

[jcrmhscasereports]

Clinical Nurses Specialist in Gastroenterology A Major Vital Role by Ahmed Lateef Alkhaqani in Journal of Clinical Case Reports Medical Images and Health Sciences 

INTRODUCTION

Nurses can be taught to perform various tasks formerly considered within the medical domain. However, the assumption that this is the end goal of the current changes is to misunderstand a fundamental issue: nursing is complementary to but different from medicine. Nurses come from different backgrounds, have different professional goals, and are trained according to a different model. They have traditionally been less focused on professional status and financial gain. These attributes may be advantageous in terms of the changing healthcare environment. One goal of nursing now is to release the potential of nurses to deliver universal health coverage, ensuring that “all individuals have access to the spectrum of health care services they need without enduring financial hardship”. The general coverage of health care applies to gastrointestinal treatment; in fact, the expansion of the role of gastroenterology nurses can enhance access to gastrointestinal treatment services. The holistic nursing concept has gradually emerged with modern medicine's continuous improvement and development. Adhering to humanity's return is the only way to achieve overall care. As a way of humanistic care, gastroenterology nursing has steadily attracted the attention of the nursing community. Gastrointestinal care refers to narrative medicine's humanistic care, respect, listening, and empathy. It is, therefore, timely to reflect on gastroenterology nursing, which has long been recognized as a specialty in high-income countries where roles and responsibilities have grown to meet the unique and changing needs of patients with gastrointestinal. Unfortunately, in today’s world, the number of treated gastrointestinal patients’ needs to increase dramatically, or we will not be able to prevent new infections or reduce the burden of gastrointestinal disease. Clearly, can no longer ignore vulnerable populations, and effective interventions must be in place to meet this challenge; the need for a multidisciplinary approach to the management of patients with gastrointestinal disease, including the potential role of community organizations and social support. Although it was not elaborated on, a team approach must incorporate the gastroenterology nurse's knowledge, skills, and expertise (1).

However, gastroenterology nursing is not a global term; global inequalities in gastroenterology nursing are widespread. Nurses caring for people at risk or with gastrointestinal provide the majority of gastroenterology services in low-income and middle-income countries, but these nurses are often the least educated in the gastroenterology team, and the gastroenterology nursing role expansion has not kept pace with its growing need. Nevertheless, gastrointestinal care principles are very similar worldwide, focusing on providing optimal care in a healthy environment. Gastroenterology is a field of medicine focusing on the digestive system’s health, including the stomach and bowels. Diseases and illnesses of the digestive tract often produce very uncomfortable symptoms and affect the body’s health as a whole. For example, some gastroenterology disorders can affect the number of nutrients the body absorbs. Gastroenterologists and gastroenterology nurses focus on treating and caring for individuals suffering from diseases and disorders of the digestive tract (2).

Gastroenterology nurses have a wide range of responsibilities and provide care for patients with gastrointestinal diseases of the stomach, esophagus, or bowel. Conditions treated may include ulcers, inflammatory bowel disease, cancer, and abdominal injuries. Gastroenterology nurses may work in various settings such as hospitals, outpatient or inpatient endoscopy suites, or doctor’s offices. These specialized nurses may do various tasks, including taking patient medical histories, telephone triage, patient education, and maintenance on procedure tools. Certified gastroenterology registered nurse works on caring for patients undergoing endoscopy or colonoscopy. These nurses assess and prepare patients for their procedures. Registered nurses in this capacity might be responsible for administering medication before the treatment and must monitor a patient’s vital signs while the physician performs the endoscopy or colonoscopy. Following the procedure, certified gastroenterology registered nurses must monitor the patient for any side effects resulting from the procedure or medication administered during it. A gastroenterology nurse will also often be responsible for collecting samples and performing other diagnostic procedures, such as x-rays, ultrasounds, and barium enemas. Endoscopy nurses will assist during or perform endoscopy procedures.

This article highlights gastroenterology nurses' contribution and impact on gastrointestinal care. Providing integrated care and optimal communication centered on people is an essential component of gastroenterology nursing care, which is often overlooked. More gastroenterology nurses who use, do, and lead research will further demonstrate the important impact of nurses on the team’s care. The influence of gastroenterology nurses on saving lives by preventing and detecting gastrointestinal is remarkable. Supportive care is a central component of gastrointestinal nursing, enabling people to manage themselves as much as possible. Globally, gastroenterology nurses make a great positive difference in gastrointestinal care worldwide; their crucial contribution throughout the care warrants the inclusion and promotion of nursing in every country’s gastrointestinal strategy (3).

Contribution of gastroenterology nursing:

Gastroenterology nurses are registered nurses who work in general, specialized, or advanced care of patients. Although gastroenterology nurses are the most visible in direct patient care, their role may include the work of multiple non-direct patient care levels. They may support the patient as a navigator during the whole of care or participate at various stages. In this fast-paced field, high-income gastroenterology nurses play various roles and responsibilities in responding to patients’ non-metastatic needs. Nurses caring for gastrointestinal patients are higher in low-income and middle-income countries and have fewer opportunities. These opportunities have progressed despite significant challenges, such as limited resources and training for the workforce. Gastroenterology nursing is a recognized specialized nursing area that focuses on promoting health, preventing illness, providing care and support for clients experiencing gastrointestinal disease, and researching. Key components include:

Promotion of health: gastroenterology nurses perform activities that include providing educational sessions for the general public, marginalized populations, and other health care professionals, as well as promoting harm-reduction initiatives such as safe needle disposal.

Prevention of illness: activities include immunization, education regarding the prevention of disease spread, and the needle exchange program.

Care, support, and treatment: nurses educate patients and their families; provide emotional support and advocacy; counsel both before, during, and after treatment on benefits, risks, side effects, coping strategies, and treatment adherence; interpret results; and liaison with the family, support groups and other health professionals (i.e., psychiatrist, ophthalmologist, social worker, etc.). Caring for and treating a gastroenterology patient is an important part of a gastroenterology nurse. As a gastroenterology nurse will often help explain the different options available to patients and the benefits and risks associated with them. May also help patients take medications and give them nutrition advice. During surgical procedures, a gastroenterology nurse may also be asked to assist. Gastroenterology nurses have the privilege of helping gastrointestinal patients navigate the emotional and physical challenges that are interrelated with gastrointestinal. Gastroenterology nurses can help relieve patients’ pain and nausea and assist with implementing the treatment plan that is best for the patient. Gastrointestinal care is tied to the value of offering personalized, holistic, and contemporary care to gastrointestinal patients and their families. In order to deliver this kind of care, gastrointestinal nurses have learned to adapt, develop, extend and expand their roles and attempted to meet the demands placed upon them by changing local, regional, national, and international healthcare needs; advances in our understanding of gastrointestinal and developments in gastrointestinal treatment. In addition to these biomedical advances, gastrointestinal care has continuously evolved in various ways and in different settings (4).

Research: nurses are active in clinical trials (industry and/or pharmaceutical), monitoring adherence to treatment, their nurse-initiated studies, and quality of life, and continually incorporate new research- and evidence-based findings into their practice.

The gastroenterology nursing roles incorporate the activities of clinical practice, education, advocacy, counselling, collaboration, community support, leadership, administration, and research. This contribution is currently extended in several directions. However, in the latter case, special needs for men and the elderly were studied through research and dealt with in practice. Gastrointestinal nurses’ commitment to exploring and facing the challenges of gastrointestinal experiences has led to numerous roles being developed. These include engaging in genetic counseling; offering support and information during screening and diagnosis, giving treatment and monitoring and managing consequential side-effects, facilitating coping and adjustment; and promoting rehabilitation and recovery. In addition, gastrointestinal nurses continue to support patients throughout the disease’s progression until death and beyond. Such care can be centered in various environments, including hospitals, community health centers, early diagnosis centers, daycare facilities, and hospital rooms.

Experience and Training:

Nursing studies have shown that people with gastrointestinal have expectations of the nurses caring for them. Competency is the most important expectation. Nurses assist patients with daily activities, administer medications and perform basic lab tests. People care that the nurse can start to provide education about medications and treatments, communicate effectively with their physician colleagues, and know how to respond to an emergency. Nurses can also develop their knowledge in subspecialties, such as radiation gastroenterology, surgical gastroenterology, medical gastroenterology, palliative (comfort) care, gastrointestinal prevention and early detection, and genetic counseling. In addition, there is specialized experience within the spectrum of gastrointestinal care settings: inpatient nursing, hospice, home care, research, ambulatory, office nursing, and managed care. Some nurses, particularly in large regional gastrointestinal centers, may develop an even more specific area of interest, such as breast, colon, prostate gastrointestinal, or pain control. Some skills, for example, patient education, systems coordination, or navigation, can cross many care areas. Gastrointestinal nurses are skilled at coordinating care with and providing referrals to physicians, social workers, psychologists, physical and occupational therapists, nutritionists, and other health care professionals and services. Nurses must also be familiar with common digestive disorders and their symptoms. This medical knowledge can help them identify patients who need to see a gastroenterologist and refer them to the right specialist (2).

Nurse-Doctor Team:

The nurses collaborate with radiation physicists, radiology technicians, social workers, psychologists, psychiatrists, physical and occupational therapists, and clinical dietitians to carry out the treatment plan prescribed by the gastrologist for each patient. Treatment and care do not take place in a vacuum. Gastrointestinal nurses are not isolated but work individually between nurses and patients they care for and cooperate with medical practitioners. No professional group can claim credit for a successful outcome; however, some might try; no matter how major and significant any contribution is, it relies on the cooperation, expertise, and commitment of other caring team members. Effective gastrointestinal treatment requires a team effort. Gastrologist (surgical and medical) are responsible for diagnosing and planning effective treatment. A professional collaboration between gastroenterology physicians and nurses continues to grow. Gastroenterology nurses make decisions on patient care within their practice areas, depending on their educational level, experience, and professional qualifications (1).

In the hospital, the staff nurses are with patients twenty-four hours a day, seven days a week. The doctor will often ask the nursing team for updates on the condition. Nurses may make “walking rounds” with the doctor to find out how they are doing and make plans for the upcoming day. The gastroenterology nurse at the hospital monitors vital signs, gives medication, assesses lab work and physical findings, evaluates needs, and calls the physician when necessary. Clinical nurse specialists are clinical leaders who work to improve nursing care. Nurse managers are the nurse leaders who work to make the unit function. The nurse will work with the patient during treatment on an outpatient basis, in the office, or in an ambulatory care setting. The doctor maps out the treatment plan; the doctor and gastroenterology nurse carry it out. Nurses may help the doctor plan and decide the most effective way to deliver chemotherapy drugs. Nurse practitioners have an independent role, which varies with the scope of practice in different states.

Communication skills:

Good communication skills are necessary for gastroenterology nurses because of the nurses’ unique and central position in patient care. They are one core means of achieving person-centered care across gastrointestinal care. Gastroenterology nurses are often directly linked to patients, families, and other multidisciplinary team members. Multidisciplinary communication is an important component of the team’s environment to achieve a truly integrated human-centred care model. Communication is often underestimated, but in fact, effective individual communication can have a direct impact on the outcome of patients. Gastrointestinal survivors reported being more satisfied with how their providers communicate with them and received more efficient care, reduced visits, and improved health outcomes. However, good communication is often defined exclusively in the dominant cultural norms. These settings are, in turn, assumed to be universally appropriate without recognizing cultural diversity, which is crucial to effective communication (5).

Supportive care for patients and families:

The role of the gastroenterology nurse varies depending on where and what kind of care is needed at any particular moment. But improving the quality of life for people with gastrointestinal is a primary goal of gastrointestinal nursing practice. To reach that goal, the gastroenterology nurse is devoted to reducing physical discomfort and providing emotional support to patients and their families. Gastrointestinal and side effects of treatment may have symptoms that are distressing or affect day-to-day life. Healthcare teams must work together to identify and relieve these symptoms. There is now a great deal of nursing knowledge that lets the gastroenterology nurse evaluate, advise on, and effectively take the edge off symptoms like nausea and vomiting, pain, constipation, diarrhea, mouth sores, shortness of breath, loss of appetite, and emotional distress. It is important that whatever needs patients to have for emotional support be matched with the resources available in the community. These needs often change throughout an illness and may depend on individual cultural and religious differences and the availability of family, friends, and community support (6).

Nurses, social workers, psychologists, and psychiatrists in private practice have a special interest in and experience with people who have gastrointestinal. Most gastroenterology nurses and social workers will be able to give the patient information about support resources. Nurses are especially active in referrals for support services, particularly the gastrointestinal support groups that are widely available. These groups can be led or facilitated by social workers, psychologists, or psychiatrists; many are co-facilitated by nurses. Many groups are led by professionals who have been diagnosed with gastrointestinal. Long-term care after gastroenterology problems is also sometimes necessary. Gastroenterology nurses help patients prepare themselves for a life with gastrointestinal problems. They may offer advice on what to eat and what not to eat, for instance, or how to manage symptoms associated with their disorders. Empathy is the ability to understand and share the feelings of another person. A gastroenterology nurse may work with patients experiencing severe pain or discomfort. Empathy for your patients can help you better understand their needs and communicate with them in a caring and supportive manner (7).

Nursing home care:

Because outpatient treatment has become more widespread, home care is becoming an important part of gastroenterology care. There are now a variety of home care agencies for gastroenterology nurses’ staff. Many people choose this type of treatment simply because they prefer to get their chemotherapy in the privacy of their homes with family and friends close by. Generally, home nursing care varies with the intensity and duration of treatment. Chemotherapy is not the only treatment patient can get at home. Under the gastrologist direction, the gastroenterology nurse can provide the patient with wound care, central venous (CV) line care and teaching, intravenous (IV) hydration, IV antibiotics, and total IV nutrition. Evidence suggests that advanced nursing practices may influence the management of difficult gastrointestinal care problems. However, nurses must be educated appropriately in order to provide quality care for gastrointestinal patients. Following the development of a core curriculum for post-basic education for nurses in gastrointestinal care. In recent years, gastrointestinal nursing research has emphasized local and national strategies.

Organizational and Technological skills:

Gastroenterology nurses must be able to organize their time and tasks effectively. This can include prioritizing patients based on their needs and ensuring that the gastroenterology team has all the resources they need to provide care. Organizing work space and paperwork can also help be more efficient. Using technology to perform job duties is an important skill for a gastroenterology nurse, who may use technology to monitor patients’ health, track patient information and communicate with other medical professionals. Nursing interventions have also adapted to the technological advances in gastrointestinal treatment. One of the most important is related to gastrointestinal genes. Scientists have developed the boundaries of knowledge regarding genes involved in maintaining certain gastrointestinal; medical colleagues are studying the therapeutic potential of this knowledge, and, alongside this, gastrointestinal nurses are focusing on the psycho-social and decision-making issues that ensue for those individuals and families who may be, or who perceive themselves to be, at risk. While it is vital to celebrate the development, diversity, and dynamism of gastrointestinal nursing, there is also a danger of losing sight of the essential core skills and values that establish the foundation of gastrointestinal nursing. Keeping one eye over our shoulder seems important as we constantly move forward. Gastrointestinal care, including people's resources, has limited resources, and every role established by gastrointestinal nurses is at risk of abandoning another aspect of gastrointestinal care (8).

All kinds of information are powerful tools for supporting change in nurses and individual organizations. Developing so fast that nobody working alone can keep track of the necessary knowledge to give appropriate care. Nurses, doctors, and other disciplines often hold patient care conferences to discuss treatment. Nurses can point out changes in condition that doctors might not be aware of, some of which could possibly change the treatment plan. In the field of research, gastroenterology nurses may work independently or collaborate with physicians. There is a growing body of nursing research in symptom management and quality of life. The research nurse conducts clinical trials involving new therapies, collecting data, and assessing responses and side effects. There is a greater acknowledgement of collaboration as more studies are coauthored in journals. The goal is not only to secure knowledge bases but also to provide knowledge-based gastrointestinal nursing services, guiding decisions and actions based on evidence. Nurses engaged in gastrointestinal care have reached a new level of maturity, working at both an individual and collective level worldwide. The information gained through the work presented will enable frameworks to be built to advance gastrointestinal nursing practices that illustrate the environment, roles, and skills necessary to move gastrointestinal nursing forward.

Gastrointestinal care is a useful framework for illustrating the evidence-based contribution that gastroenterology nurses make to caring for people at risk or with gastrointestinal along the various stages of care in different settings. For gastroenterology nurses, people-centered approaches have become a strong point of reference and a necessity in gastrointestinal care, with patient and multidisciplinary communication a key component of relationship-based care for people affected by gastrointestinal and also for effective multidisciplinary teamwork. Coordination of patient care is essential for many gastroenterology nurses; nurse navigators not only help patients overcome health-system barriers but also can affect outcomes, e.g., and increase screening rates. Nurse researchers and clinical study nurses support an evidence-based to improving care outcomes. Gastroenterology nurses, by their actions, often being part of an intervention, have the potential to save lives through preventative measures (such as tobacco control) and to optimize the quality of life and the care experience of this population during treatment, survivorship, and palliation. Supportive care, including palliative care, is a wide range of areas that permeate all phases of care. It is an area where gastroenterology nurses excel, e.g., in effectively reducing gastrointestinal symptoms and treatment-related symptoms or rehab limitations, increasing healthy lifestyle behaviors, and addressing the psycho-social needs of people with gastrointestinal and gastrointestinal survivors.

Finally, gastrointestinal nurses need to ensure that support structures are available for the consolidation and development of the specialty in education, ethical debate, research, audit, dialogue across the world, sharing resources and information, mentorship, and clinical supervision. Gastrointestinal nurses do not work alone from the experiences of patients and families who care for them; what the nurses feel is stressful is, in a sense, rewarding and satisfying. The resource lies within each gastrointestinal nurse to be instrumental in reviewing, participating in, or leading nursing development and establishing and maintaining a working environment where gastrointestinal nurses and gastrointestinal nursing flourish.

Gastrointestinal nurses are constantly developing, and depending on the scope and level of interaction, they need different skills and knowledge to function in different environments and situations. Nurses often have a role in the organization, but such a role does not always go beyond borders and affects a wider gastrointestinal treatment plan. Aspiring leaders must be identified, supported, and developed. Senior gastrointestinal nurses are obligated to identify and then positively nurture talent, encourage and develop leadership qualities and skills and create a climate that enables future generations of leaders to challenge and take risks.

Funding: There are no sources of funding to declare.

Conflicts of interest: The author declares no conflict of interest to declare for publication

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#Nurses #Gastrointestinal #humanistic #environment #esophagus #endoscopy #ophthalmologist #personalized #psychologists #radiology #central venous #multidisciplinary #Gastrointestinal nurses #Ahmed Lateef Alkhaqani #jcrmhs

[jcrmhscasereports]

 De novo acute B-cell acute Lymphoblastic Leukemia with BCL2/IGH and BCR/ABL1 rearrangements by Pier Paolo Piccaluga in Journal of Clinical Case Reports Medical Images and Health Sciences

ABSTRACT

T(14;18)(q32,q21) and t(9;22)(q34;q11) translocations, leading to BCL2/IGH and BCR/ABL1 rearrangements, respectively, are common genetic aberrations in hematological malignancies. Particularly, t(14;18)(q32;q21) is the genetic hallmark of follicular lymphoma, while t(9;22)(q34;q11) is commonly rearranged in acute lymphoid leukemia (ALL) and chronic myeloid leukemia. Nevertheless, their association has never been described. We report the first case of acute lymphoid leukemia (ALL) in which both BCL2/IGH and BCR/ABL1 rearrangements were present. The patient presented with pre-B ALL, achieved molecular complete remission with intensified chemotherapy, then reinforced with autologous stem cell transplantation, relapsed after a few months, and unfortunately died 17 months after diagnosis. Of note, only BCL2/IGH but not BCR/ABL1 was detected at relapses.

Key words: B-acute lymphoid leukemia, BCR/ABL1, t(14;18)(q32,q21), BCL2, Philadelphia chromosome, apoptosis, Imatinib, targeted therapy

INTRODUCTION

The t(14;18)(q32;q21) translocation is the most common translocation in B-cell malignancies; in particular, it is found in about 90% of follicular lymphomas, being the chromosomal hallmark of this tumor, and in about 20-25% of diffuse large B-cell lymphomas(1–4). Only a few cases of de novo B-acute lymphoid leukemia (B-ALL) carrying t(14;18)(q32;q21) have been described(5–13). Most of these cases presented with additional chromosomal abnormalities, often involving band 8q24 and/or MYC rearrangement and had a very aggressive clinical  course(5,6,8,9,12). Central nervous system (CNS) involvement seems to be a frequent event, despite of adequate prophylaxis. The association between t(14;18)(q32;q21 ) and BCR/ABL1 rearrangement has never been described in ALL. We report on a de novo B-ALL carrying both t(14;18)(q32;q21) with  BCL2/IGH fusion and BCR/ABL1 rearrangement.

METHODS

Cytogenetics 

Short term cultures from bone marrow samples were performed at diagnosis and during the follow-up. Metaphases were analyzed after G-banding with Wright’stain. Karyotype was described according to the International System for Human Cytogenetic Nomenclature (ISCN 1995)(14–16).

FISH

FISH was performed on fixed cells. Directly labeled BCR and ABL probes (Vysis, Inc), producing a split of red signal when ABL is involved in genetic rearrangements. FISH data were collected with a fluorescence microscope (E 1000, Nikon Instruments) equipped with a CCD camera and Genikon software (Nikon Instruments). Two hundred nuclei/cells were analyzed for each experiment.

Molecular evaluation of BCL2/IGH rearrangement

Molecular evaluation was based on nested PCR(17). Mononuclear cells from BM and PB samples were obtained by Ficoll-Hypaque density gradient centrifugation. Genomic DNA was isolated from mononuclear cells using the QIAamp DNA mini kit (Qiagen, Hilden, Germany)(18). DNA integrity was assessed by amplifying a 510 bp fragment of the Beta-globin gene. Samples positive for Beta-globin were then investigated for the BCL2/IGH rearrangement using a nested PCR specific for MBR and mcr breakpoints. The first round of amplification was done using 1 microg of genomic DNA and the following primers: 5’–CAGCCTTGAAACATTGATGG–3’(forward, for MBR), 5’– CGTGCTGGTACCACTCCTG–3’ (forward, for mcr) and 5’–ACCTGAGGAGACGGTGACC–3’ (reverse, for the JH consensus region). An initial denaturation step of 5 min at 95° C was followed by amplification for 30 cycles (denaturation: 40 sec at 95° C; annealing: 40 sec at 55° C (MBR) or 58°C (mcr); extension: 50 sec at 72° C) and final extension for 7 min at 72° C. Reamplification of a 1 microL aliquot from a 1:50 dilution of the first PCR product was then performed using the internal primers: 5’–ATGGTGGTTTGACCTTTAG–3’ (forward, for MBR), 5’–GGACCTTCCTTGGTGTGTTG–3’ (forward, for mcr), 5’–ACCAGGGTCCCTTGGCCCCA–3’ (reverse, for the JH consensus region), and the following

PCR conditions: initial denaturation step of 5 min at 95° C; amplification for 35 cycles (denaturation: 40 sec at 95° C; annealing: 40 sec at 56° C (MBR) or 59°C (mcr); extension: 50 sec at 72° C); final extension for 7 min at 72° C. All PCR experiments were performed in 50 microL final volume containing 1U of Taq Gold DNA Polymerase (PE Applied Biosystems, San Francisco, USA), 10x PCR buffer, 100 mM of each dNTP, 2.5mM MgCl2, and 1 microM of each primer. Samples were tested twice, and both positive and negative controls were included in all experiments. A patient-specific positive control was also included in every follow-up experiment to compare the BCL2/IGH fragment length with the PCR product obtained at the time of diagnosis. Amplified products were visualized on a 2% agarose gel stained with ethidium bromide. The sensitivity of the assay for the detection of BCL2/IGH rearrangement was routinely =10-4.  

Molecular evaluation of BCR/ABL1 rearrangement

RNA extraction was performed by phenol/chloroform using bone marrow mononuclear cells obtained by Ficoll-Hypaque density gradient centrifugation. One microg of total RNA was reverse transcribed using random hexamer primers and MMLV reverse transcriptase; briefly, RNA was prewarmed for 10 min at 70°C and subsequently cooled for a further 10 min at 25°C. The RNA solution was then incubated for 42 min at 45°C in a 20 L reaction mixture containing 10 mM Tris

HCl (pH 8.3), 50 mM KCl, 5.5 mM MgCl2, 1 mM of each deoxyribonucleotide, 20 U of RNAsin

(Pharmacia, Upsala, Sweeden), 25 microM random hexamers (Pharmacia, Upssala, Sweeden), 10 mM of DTT (Pharmacia, Upssala, Sweeden), and 100U of MoMLV reverse transcriptase (BRL, Bethesda, MD). After incubation, cDNA solution was diluted 1:5 to 50 microL final volume. The cDNA integrity was assessed by amplifying a 296 bp fragment of the ABL1 gene. Samples positive for ABL1 were then investigated for the BCR/ABL1 rearrangement by qualitative PCR. Five microLs of cDNA were PCR-amplified using the following set of primers: EA500 5’ TGTGATTATAGCCTAAGACCCGGAG 3’, and R112 5’ TTGTCGTGTCCGAGGCCACC 3’. Thirty-five cycles of PCR were performed as follows: denaturation (30 sec at 96°C), annealing (30 sec at 60°C), and extension (30 sec at 72°C). Samples were tested twice, and both positive and negative controls were included in all experiments.

Amplified products were visualized on a 2% agarose gel stained with ethidium bromide (19).REF

Case report

In July 2020, a 40-years-old woman, presenting only with moderate fatigue, was diagnosed with pre-B ALL, L2 subtype. The peripheral blood count showed: Hb 9.3 g/dl; WBC 17x109/L; PLT 56x109/L. The bone marrow aspirate was hypocellular with 80% of lymphoid blasts. The karyotype was: 46,XX, del(6)(8q21q25), t(9;9)(p11;q22), t(14;18)(q32;q21)(10/20). The immuphenotype, assessed by flow cytometry, was: CD19+, CD22+, TdT+, CD20-, CD3-, CD10-.

The molecular analysis carried out by PCR confirmed a BCL2/IGH rearrangement (mcr breakpoint) but also unveiled a BCR/ABL1 (E1-A2 /p190) rearrangement. Thus, FISH analysis was also performed. The probe for BCR/ABL1 dual fusion gene gave two green signals and two red signals as expected from samples not carrying the ABL1 rearrangement. Molecular analysis was then repeated confirming the previous results. We administered a standard induction therapy (doxorubicine, vincristine, L-asparaginase, and prednisone plus imatinib), and an intensified consolidation therapy (idarubicine and high dose cytarabine) obtaining a molecular complete remission (CR). Particularly, neither BCL/IGH nor BCR/ABL1 rearrangements were detected. Other 2 consolidation courses were then administered (BFM-B regimen, including vincristine, ifosfamide, methothrexate, teniposide, high dose cytarabine, and dexamethasone; and BFM-A regimen, including vincristine, doxorubicine, cyclophosphamide, high dose methothrexate, and dexamethasone) associated with imatinib. Bone marrow harvest and autologous bone marrow transplantation were then performed, lacking a HLA-matched donor. Twelve months after the first documentation of CR, the patient relapsed. The bone marrow aspirate was hypercellular with 90% of leukemic cells. The karyotype was: 46 XX, t(1;5)(p32;q31), del(12)(p11;p13)(14/15); the molecular analysis conducted by PCR showed the BCL2/IGH rearrangement, whereas there was no evidence of the BCR/ABL1 fusion transcript. Salvage therapy with liposomal daunorubicin and intermediate dose cytarabine (23) was then administered, obtaining a second molecular CR (disappearance of BCL2/IGH). Two months later, a second relapse occurred. The karyotype was: 46 XX, t(1,5)(p32;q31), del(12)(p11;p13)(29/30). The molecular analysis showed again only the BCL2/IGH rearrangement, without evidence of the BCR/ABL1 fusion gene. Despite of neuro-meningeal prophylaxis, there was clinical evidence of CNS involvement. Compassionate treatment with campath-1H, 30 mg/dose, for 5 doses, was administered i. v., obtaining a peripheral blood blast clearance, but not a CR. The patients eventually died 17 months after diagnosis due to leukemic progression.

DISCUSSION

BCR/ABL1 and BCL2/IGH rearrangements are common molecular abnormalities in B-cell malignancies. In particular, the BCR/ABL1 rearrangement is the most frequent genetic aberration in adult B-ALL(20–22). On the other hand, t(14;18)(q32;q21) with BCL2/IGH rearrangement is the most common abnormality in tumors derived from peripheral B-lymphocytes, whereas it is absolutely rare in B-cell precursor malignancies (24). However, while the biological role of BCR/ABL1 in acute leukemia is at least partially well known(25), the significance of BCL2 in ALL is still largely indefinite. BCL2 overexpression, without BCL2/IGH rearrangement, is frequent in ALL, and does not seem to be associated with a poorer prognosis (26). On the contrary, t(14;18)(q32;q21) and BCL2/IGH rearrangement are a rarity in ALL, but are associated with very aggressive tumors. Morphologically, the described cases are often L3, according to their immunophenotype of mature B-ALL, with Burkitt-like features. Notably, in all cases, complex karyotypes were observed, with almost constant involvement of the 8q24 locus and MYC deregulation(5–13). Sequential emergence of molecular abnormalities has been proposed in these cases, with progression from indolent (BCL2/IGH positive) to aggressive (BCL2/IGH and MYC positive) B-cell tumors (5–13). Therefore, they most likely represented leukemic variants of high-grade B-cell lymphomas with “double hits”. On the clinical ground, most of the patients presented with rapidly worsening general condition, fever, fatigue, night sweat, and weight loss; massive bone marrow and blood involvement, nodal and extra-nodal infiltration were also present. Clinical course was aggressive, with a median overall survival usually below than 12 months(5–13).

To the best of our knowledge, the association between t(14;18)(q32;q21) and BCR/ABL1 rearrangement has not been previously described in ALL. Nevertheless, a case of co-existing

BCR/ABL1 and BCL2/IGH rearrangements was reported in a MDS case(27). Our patient presented with a pre-B ALL, L2 subtype, carrying the t(14;18)(q32;q21) and other additional chromosomal aberrations, such as del(6)(q21;q25) and t(9;9)(p11;p22) but lacking 8q24 involvement; the BCR/ABL1 rearrangement was documented only by molecular analysis. Clinical course was aggressive, with recurrent relapses, CNS involvement, and death within seventeen months. Interestingly, at relapse, the patient presented a different karyotype [t(1,5)(p32;q31), del(12)(p11;p13), quite common as secondary abnormalities], still showing the BCL2/IGH rearrangement. Furthermore, during the clinical history of the patient, other chromosomal aberrations appeared. The relationship between the molecular events, and even a possible sequential appearance cannot be established. No peculiar morphologic or immunophenotipic patterns can be identified, to be easily associated to either one translocation, and the bad prognosis could be conferred by both the main genetic alterations; however, a dominant role of BCL2/IGH should be hypothesized, since it was always present during all disease phases. In this regard, based on the lack of cytogenetic evidence of Philadelphia chromosome we cannot exclude that BCR/ABL1 rearrangement constituted a sub-clonal lesion, cleared out by the more specific targeted therapy (chemotherapy plus imatinib).

Certainly, the treatment of t(14;18)(q32;q21) positive ALL remains a major problem, as conventional therapy are scarcely effective. Probably, the highly proliferating phenotype is made highly insensitive to chemotherapy by the antiapoptotic effect of BCL2, as observed in high-grade B-cell lymphomas with double hits.

The present case, besides its unicity, also confirmed the importance of molecular testing after cytogenetic analysis in human leukemia. Future experiences and hopefully trials will be useful to improve the current treatment of t(14;18)(q32;q21) positive ALL by adopting more rationally targeted therapies such as BCL2 inhibitors (eg venetoclax), peroxisome proliferator-activated receptor-gamma ligands (28), or others.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#B-acute lymphoid leukemia #BCR/ABL1 #t(14;18)(q32 #q21) #BCL2 #Philadelphia chromosome #apoptosis #Imatinib #targeted therapy #Cytogenetic Nomenclature #Genikon #DNA #Pier Paolo Piccaluga #jcrmhs

[jcrmhscasereports]

Diagnostic value of pleural Fluid Adenosine deaminase in patients with Pleural Tuberculosis by Sina Parsay M.D in Journal of Clinical Case Reports Medical Images and Health Sciences  

ABSTRACT

Background and Objectives: Extra-pulmonary tuberculosis occurs in about 10-20% of patients with tuberculosis. It most commonly manifests as tuberculous lymphadenitis or pleural effusion. Pleural fluid Adenosine deaminase (ADA) activity considered as a useful biomarker for detecting pleural tuberculosis. The purpose of this study was to evaluate the diagnostic accuracy of pleural fluid adenosine deaminase level in patients with pleural tuberculosis.

Methods: In this study, 113 patients with exudative pleural effusion with unknown underlying diagnosis, were enrolled. Physical examination, chest CT, ADA level of pleural fluid, direct thoracoscopic examination, and biopsy of pleura were obtained for all individuals. ADA level and thoracoscipoc appearance of the lesions was then compaierd among the patients with regard to the pleural biopsy report as the diagnostic goldstandard.

Results: The diagnosis of tuberculous pleurisy was established in 40 individuals based on the pathology reports. The mean ADA level of the TB and the non-TB group was 39.90±22.93 IU/L and 30.74±38.27 IU/L, respectively (P-value=0.167). Sensitivity, specificity, positive predictive value, and negative predictive value of ADA test were 35%, 86.30%, 58.33%, and 70.79%, respectively.

Conclusion: Based insuffiecient sensitivity and specificity of ADA, in patients with unexplained exudative pleural effusion especially in those with a high suspicion of tuberculous pleurisy, despite the low level of ADA, direct thoracoscopic pleural evaluation with obtaining multiple biopsies of pleura is highly recommended.

Keyword: Pleural Effusion, Thoracoscopy, Tuberculosis, Diagnostic Accuracy, Extra-pulmonary tuberculosis, Adenosine deaminase

INTRODUCTION

Tuberculosis is a chronic bacterial infection caused by Mycobacterium tuberculosis. It remains a disease with a high rate of mortality in the world especially in developing and low-income countries 1. Extrapulmonary tuberculosis occurs in about 10% -20% of patients and the most common forms of involvement are tuberculous Lymphadenitis and tuberculous pleural effusion 2.

Pleural tuberculosis (TB) which is the topic of this study, is characterized by symptoms such as chest pain, cough, and fever. Chest Radiography of these patients shows a small to moderate unilateral pleural effusion which is lymphocyte dominant in serologic evaluations. The condition also could be bilateral within the minority of cases 1, 3. The prevalence of tuberculosis among all patients with pleural effusion is between 4-22%, and pleura is involved in 3-23% of patients with tuberculosis 4, 5.

Different diagnostic methods have been used to diagnose pleural tuberculosis, including thoracentesis, measurement of serum and pleural fluid adenosine deaminase (ADA) level, pleural biopsy, and thoracoscopy assisted pleural examination and biopsy 3.

Measuring ADA activity in pleural fluid is an easy, inexpensive, fast, and useful way for diagnosing TB in endemic areas, such as South Africa, Asia, Brazil, Spain, and Eastern Europe 6-8. Based on literature a cut-off point of 40 U/L of ADA activity in a lymphocyte dominant pleural fluid is diagnostic for pleural TB. But the validity of the test is not generally accepted by consensus 9-11

With the advancement in endoscopic techniques and video equipment, thoracoscopy has been suggested as a diagnostic and therapeutic modality in patients with pleural tuberculosis, and become more popular among the physicians. Thoracoscopic findings of these patients include caseous necrosis, miliary nodules, exudative pleural effusion, and pleural adhesion or fibrotic septa 12-14.

Considering the important role of ADA in the diagnosis of pleural tuberculosis, evaluating the correlation between pleural ADA level and thoracoscopic findings of pleural tuberculosis seems necessary

15, 16.

This study aims to determine the correlation of the pleural fluid ADA activity and its diagnostic accuracy in histologically confirmed cases of pleural tuberculosis.

MATERIALS AND METHODS

In this cross-sectional study, 113 patients from those who referred to the cardiothoracic surgery department of Tabriz University of Medical Science with unexplained exudative pleural effusion were enrolled. The study population was measured by GPOWER software with a confidence interval of 95% and a test power of 80%. All patients had a pleural effusion with unknown etiology and candidated for thoracoscopy and biopsy. Patients were excluded from the study in case of transudative pleural effusion, post-traumatic effusion, known pulmonary disorders, history of pulmonary or pleural malignancies, and history of radiotherapy on the thoracic cavity.

All patients underwent thoracoscopic study with direct evaluation of the pleural cavity. Multiple pleural biopsies and pleural fluid specimen for ADA analysis were obtained. All tissue samples were evaluated by a certain pathologist and ADA was measured using ADA Reagent Kit in an acredited laboratory of the affiliated university. The ADA level of greater than or equal to 40 U/L considered as diagnostic for TB. According to the pathologic reports, patients were divided into two TB and non-TB groups. The demographic data, examination and thoracoscopic findings, as well as ADA levels were compared between two groups.

Data were collected and analyzed by IBM SPSS statistic for windows version 23.0. (IBM Corp., Armonk, N.Y., USA). Descriptive data were reported using mean, standard deviation, relative, and absolute frequencies. Chi2, paired sample t-test, independent t-test. and repeated measure ANOVA were used for analytical comparison of the variables between the groups as needed. The p-value of less than 0.05 was considered statistically significant. Sensitivity and specificity were calculated based on patient-level analysis of gathered data using confusion matrix and relying on pathologic results as the gold standard diagnostic test.

ETHICAL CONSIDERATION

The study was approved by the ethics committee of Tabriz University of Medical Science under the approval number of 5/d/8716-94/5-6/3. All diagnostic and therapeutic interventions were performed regarding the routine management of patients; no additional intervention or cost was imposed on participants in this study. Patients’ data were recorded as encoded variables without mentioning the name of any participant. None of the patients' personal information was included in this research.

Informed consent was obtained from each participant; nevertheless, patients were excluded from the study in cases they were reluctant to participate in the study.

RESULTS

Of the total 113 patients, 73 (58.4%) were male, and 40 (32.0%) were female, and 42 (33.6%) were smokers. The mean age of the patients was 49.77 ± 18.71 years.

The diagnosis of TB was confirmed in 40 patients according to the histopathologic reports. These patients were stratiffied as the case group (known as group A), and the other 73 with a diagnosis of nontuberculous pleural effusion were considered as the control group (known as group B).

As depicted in Table-1 dyspnea, cough, and pleuritic chest pain were the dominant symptoms of patients at the time of admission with a frequency of 66.37%, 48.67%, and 40.7% respectively. The frequency of fever and weight loss were30.97%, and 28.31%, respectively among the patients. Table-1 also demonstrates demographic data of individuals separately for each study groups.

Regarding the thoracoscopic examination, pleural effusion, pleural adhesion band, miliary nodules, and caseous necrosis were found in 100%, 67.5%, 70%, and 60%, of the group A respectively (Table-2). Among the control group (group B), pleural effusions, thickening of pleura and miliary nodules were the dominant manifestations with a frequency of 100%, 46.57%, and 30.13% respectively (Table-2). The underlying cause of pleural effusion among the patients in control group was: metastasis (23.28%), mesothelioma (5.47%), inflammation (32.87%), fibrosis (36.98%), and fungal infection (1. 36%) as depicted in Table-2.

The mean ADA level was 39.90 ± 22.13 IU/L in group A and 30.74 ± 38.27 IU/L within group B individuals which did not differ statistically significantly between the two study groups (p=0.167).

As delineated in Table-3, 35% of patients in group A has ADA level of greater than 40 (as a diagnostic cut-off for TB) compared to 13.7% in group B (p>0.05). Bar chart for these amounts is also illustrated in figure-1. Sensitivity, specificity, positive predictive value, and negative predictive value of ADA test were measured 35%, 86.30%, 58.33%, and 70.79% respectively (Table-4). Figure-2 demonstrates the ROC curve of ADA test measures.

Figure 1: Chest X-ray reveals pulmonary edema after ICU admission

Figure 1: Chest X-ray reveals pulmonary edema after ICU admission

Figure 1: Chest X-ray reveals pulmonary edema after ICU admission

After 24h of fully controlled mechanical ventilation and 6800ml of diuresis the sedation medication was terminated and the patient extubated uneventfully. No further ventilation support or vasoactive medication was required. The patient recovered in the matter of 72 hours and was discharged from the hospital on the day 7 with a mild arterial hypertension, that was treated by Hydrochlorthiazide 25mg a day.

After 24h of fully controlled mechanical ventilation and 6800ml of diuresis the sedation medication was terminated and the patient extubated uneventfully. No further ventilation support or vasoactive medication was required. The patient recovered in the matter of 72 hours and was discharged from the hospital on the day 7 with a mild arterial hypertension, that was treated by Hydrochlorthiazide 25mg a day.

DISCUSSION

In this study, 113 patients (73 males and 40 females) with unexplained pleural effusion were evaluated for probable pleural tuberculosis by using thoracoscopic examination and biopsy. Meanwhile, the ADA level was measured for all individuals regardless of pathologic findings. The diagnosis of pleural TB established only in 40 individuals according to the histopathologic reports. The ADA level among these tuberculous pleurisy patients was 39.90 ± 22.13 IU/L compared to a level of 30.74 ± 38.27 IU/L in nontuberculous individuals, which was not statistically significant. Based on our results, the ADA test yield a sensitivity, specificity, positive predictive value, and negative predictive value of 35%, 86.30%, 58.33%, and 70.79% respectively.

In a study performed by Van et al., the causes of pleural effusion were evaluated among 95 patients in Netherland. According to their results, they have found tuberculous pleurisy just in five patients, among them the high ADA activity was only detected in four individuals. On the other hand, the underlying pathologies other than TB could raise the ADA activity based on their study. The authors conclude that the high ADA activity level in a country with low tuberculosis incidence is not accurate enough to establish the diagnosis of tuberculous pleurisy 17.

Tian et al. found a sensitivity and specificity of 84.4% and 91.8% for ADA in diagnosing tuberculous pleurisy by evaluating 190 patients with pleural effusion. The cause of pleural effusion was TB in 141 patients of their study population 18. The difference between the results of our study compared to the recently mentioned research is explainable by the high overall incidence of TB in the country in which Tian et al., performed their study.

Valdes et al., in their study, revealed that measuring pleural ADA level is a useful parameter for the diagnosis of tuberculous pleurisy by evaluating 405 patients with pleural effusion. All 91 cases of pleural TB in their study showed an ADA level of greater than 47 IU/L, compared to the elevation just in 5% of non-tuberculous patients 15.

Zemlin et al. demonstrated that measuring the ADA2 isoenzyme is more accurate, and it is superior to ADA in diagnosing tuberculous pleurisy by performing a study on 951 pleural fluid samples, including 387 patients with TB. They suggested that measuring ADA2 level is better to use as a routine test among patients with pleural effusion in endemic areas for TB 11.

Technically, the predictive value of an indicator such as ADA does not only depend on its sensitivity and specificity, but also the incidence of the disease in the study region is also effective 8, 9, 11, 16, 19, 20. The inconsistency between the results might have happened due to the variable prevalence of TB and different sample sizes in which the mentioned studies were performed.

The strength of this study was the use of pathlogical confirmation for the diagnosis of the underlying cause of the pleural effusion in the studied patients. The patients with the diagnosis other than pleural tuberculosis was also considered as a reliable corntol group for calculating the diagnostic accuracy of the applied method. Somehow, the shortness of the study sample size was a weakness of our study. Howere, it should be considered that the overall prevalence of the TB within the population in which the study takes place may alter the results of the study; then, it should also be considered as a limitation of the study.

By comparing our results with previous studies, it can be concluded that the sensitivity, specificity, and accuracy of this test are not suffiecient enough; so, ADA is not utterly useful in diagnosis of pleural TB. Therefore, in patients with pleural effusion with undetermined origin and in patients with a high level of suspicion of TB infection, despite the low ADA level, thoracoscopic evaluation of pleural cavity with obtaining multiple biopsies of pleura would be more appropriate.

Also, in cases with high ADA level and lack of proper response to TB treatments, for further investigation and rule out the other diagnosis, thoracoscopy and pleural biopsy could be beneficial.

However, further studies with larger sample size are suggested.

Acknowledgments: Not applicable

Source of Funding : None

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#Pleural Effusion #Thoracoscopy #Tuberculosis #Diagnostic Accuracy #Extra-pulmonary tuberculosis #Adenosine deaminase #ADA #pathology #Mycobacterium #Radiography #TB #IBM SPSS #Sina Parsay M.D #jcrmhs

[jcrmhscasereports]

Massive volume overload with severe pulmonary edema during hysteroscopy: a case report by F.Fiedler in Journal of Clinical Case Reports Medical Images and Health Sciences  

INTRODUCTION

One of the most serious problems of therapeutic hysteroscopic procedures nowadays depending on a distending media in use, remains a fluid overload with concomitant electrolyte imbalance. This rare but very life threatening condition remains of great concern and requires interdisciplinary management from experts of different fields such as anesthesiology, intensive care, cardiology and nephrology.

The irrigating media plays an essential role during hysteroscopic operations because it distends a uterine cavity and so provides a necessary visibility. There are gasous and liquid types of media. The Carbon dioxide is obsolete because it provides insufficient visibility and can lead to severe complications such as embolism or systemic accumulation due to its high solubility.

The liquid ones vary according to their osmolality, viscosity and electrolyte content, respectively an overload can cause different kinds of pathological settings.

Depending on the type of current (monopolar vs. bipolar) the irriganting fluid may or may not content electrolytes. The electrolyte-free, low-viscosity fluids, such as Mannitol/ Sorbitol mixture, Glycin 1,5%, Glucose 5%, Sorbitol 3%  are standard media in monopolar surgery. The excessive absorption can lead to a hypoosmolal  hyperhydratation (also known as transurethral resection syndrome of prostate in urology patients) resulting in severe overload and dilutional hyponatriaemia, which can be a cause of different neurological clinical sequelae such as grand-mal-seizures and cerebral edema up to a brainstem herniation.

The isotonic solutions such as NaCl 0,9% or Ringer-Lactat on the other hand, are golden standard in bipolar hysteroscopic procedures and its systemic absorption can cause an isoosmolal hyperhydratation associated with hyperchloremic acidosis and pulmonary edema up to acute respiratory distress syndrome.

In this case report we will describe a particular clinical setting of excessive fluid overload with severe pulmonary edema in a 38-years-old female after a hysteroscopy and resectoscopy.

PATIENT’S MEDICAL HISTORY

38-years-old black woman, 55kg, presented herself for a hypermenorrhea caused by multiple submucous and intramural myomas. Due to longlasting, intense bleedings she developed iron-deficiency-anemia with hemoglobin level of 8,8g/dl. The anemia has been treated with iron infusions, vitamin-B12 and folic acid. However she was well adapted and didn’t show tachycardia or any kind of anemia- related symptoms.

Further on she suffered from infertility most likely caused by Uterus myomatosus, which had been previously treated by hysteroscopic and laparoscopic myomectomy.

Further preoperative assessment revealed an occasional smoker but otherwise healthy patient and routine laboratory analysis were unremarkable except for earlier mentioned anemia. The previous general anaesthesias were uneventful and she was classified as ASA II- patient. The premedication consisted of 7,5mg Midazolam p.o.

THE PROCEDURE AND INTRAOPERATIVE SETTING

After the general anesthesia has been inducted, consisting of 200mg Propofol, 0,2mg Fentanyl and 6mg Cisatracurium, patient was intubated uneventfully. A single-shot-antibiotic with 2g Cefazolin was administered before surgical start. Further anaesthesia was maintained with Sevoflurane (endexpiratory concentration 1,2 vol%) during low-flow-volume-controlled-ventilation.

The hysteroscopy was performed with a physiological saline solution as a distending medium administered by Karl Storz Hamou Endomat pump in hysteroscopy modul within preselected pressure- (max.150mmHg) and flow- range (max.400ml/min). The resectoscope had an active suction channel and myomectomy was facilitated with bipolar current.

After a resection time of 35 minutes the operating procedure became complicated due to big intracavitary myomas, consequently a larger amount of distending media was required to keep the visibility during the hysteroscopy. The efflux of the irrigating fluid wasn’t monitored because of the high amount lost in the sterile drapes.

In the meantime the patient developed mild tachycardia with descrete ST-depressions, that disappeared after deepening the anaesthesia. Further on she developed high respiratory pressures and the accurate examination of the patient lying in Trendelenburg position and in a dark operating theatre revealed swollen face that was missinterpreted as Quincke-edema and immediately treated with 4mg Dimetinden, 50mg Ranitidin and 500mg Prednisone.

The immediate termination of the procedure revealed a general swelling of a patient especially in abdominal and facial region. The uterus perforation was denied by the gynaecologist but due to threatening abdominal compartment syndrome an urgent laparoscopy was preformed, which revealed 2,5l of intraabdominal fluid. At that point the gynaecologist declared 9l deficit between the in- and outflow of the irrigating fluid.

Meanwhile the ventilation was severly impeded by massive pulmonary edema and 1,5l clear fluid was suctioned from the endotrachal tube. The oxygen saturation dropped to 53% and the inspiratory peak pressure reached up to 60 mmHg. The diuresis was stimulated by 80mg furosemid.

Under full mechanical ventilation support with high positive endexpiratory pressure and analgosedation we transferred the patient to the ICU.

ICU-MANAGEMENT

By the admission to the ICU the arterial blood gas analysis revealed

pH 6,95

pO2 92,2 mmHg

pCO2 58 mmHg

SO2 87%

HCO3 12,7 mmHg

BE -17,8 mmHg

Hb 6,5 g/dl

K+ 2,9mmol/l

Na+ 142 mmol/l

Lactat acid 4,27 mmol/l

The combined (hyperchloremic and respiratory) acidosis reached it’s peak later, when HCO3 dropped to 6,9 mmHg and was treated aggressively by 200mg HCO3 8,4%. The potassium substitution was administered via central venous line.

Noradrenaline was used to stabilize the circulation and the volume therapy was monitored with invasive hemodynamic monitoring (PICCOR), which revealed hypovolemia (GEDI 444 ml/m2) and pulmonary edema (ELWI 13 ml/kg) despite sufficient systemic vascular resistance (SVRI 3949 dyn*s*cm-5*m2) and good pump function (Cardiac Index 3,34 l/min/m2).

The 30,6 C° body temperature was treated with an active warming system for the next 18h until the normal temperature was reached.

The intraabdominal pressure was measured by bladder pressure monitoring (14 mmHg).

The oxygenation increased with forced diuresis and positive endexpiratory pressure ventilation (12 cmH2O).

Figure 1: Chest X-ray reveals pulmonary edema after ICU admission

After 24h of fully controlled mechanical ventilation and 6800ml of diuresis the sedation medication was terminated and the patient extubated uneventfully. No further ventilation support or vasoactive medication was required. The patient recovered in the matter of 72 hours and was discharged from the hospital on the day 7 with a mild arterial hypertension, that was treated by Hydrochlorthiazide 25mg a day.

DISCUSSION

 The isoosmolar hyperhydratation due to massive absorption of irrigating fluid, also known as Operative Hysteroscopy Intravascular Absorption Syndrome (OHIA)  is a life threatening complication of the bipolar resectoscopic procedures.

There are three different manners the distending fluid can be absorbed:

the fluid instillation in peritoneal cavity via fallopian tubes causing a high amount of free abdominal fluid, which can lead up to an abdominal compartment syndrome

 the absorption via endo- and myometrium causing a massive subcutan fluid overload

the intravascular absorption due to exceed of the venous vascular pressure of  endometrium by an irrigating fluid pressure causing expansion of plasma volume and consequently intravascular fluid overload.

This case report shows a massive absorption of distending fluid mostly throughout the endometrium causing generalized and later on pulmonary edema and throughout fallopian tubes causing acute abdomen. The delayed diagnosis of this complication was due to unreported imbalance between the irrigating fluid instilled (12 litres) and the volume recovered (3 litres) from the patient. Other conditions that impeded the early diagnosis were darkened operating theatre because of the hysteroscopy and Trendelenburg position of the patient, fully covered in warm sheets in order to prevent hypothermia.

The threatening abdominal compartment was promptly treated by an urgent laparoscopy and the patient responded very well to a complex symptom-orientated intensive care therapy. A mild arterial hypertension is a residual symptom of a massive NaCl-absorption and respectively delayed sodium and water excretion and is expected to disappear within days.

The top priority is the prevention of the excessive absorption and once this complication occurred, its rapid, correct diagnosis as well as early-goal-therapy is essential. The fundamental knowledge of different distending media and its possible complications must be considered by the gynecologist and anesthesiologist. Once the distending medium has been determined, certain strategy must be applied in order to avoid the massive fluid overload. The exact amount of administered and removed irrigating fluid must be accurately monitored, which can be impeded be different factors such as spilling the media on the floor or in sterile sheets, not exact amount of media in the bag (varies up to 5%), difficult estimation of not-used fluid in the bag. The irrigation pressure limit should be lower then the mean arterial pressure whenever possible and complicated operative procedures that take longer time such as myomectomy require splitting in two sessions.

As soon as the difference of instilled and recovered amount reaches the limit, that should be set a priori or a patient starts showing symptoms, the measurement of electrolytes, osmolality and arterial blood gasses should be preformed and the procedure terminated as soon as possible.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#hysteroscopic #therapeutic #electrolyte imbalance #Carbon dioxide #monopolar vs. bipolar #urology #hypoosmolal #hyperchloremic #myomatosus #occasional #Hamou Endomat #F.Fiedler #jcrmhs

[jcrmhscasereports]

Delayed onset of intracerebral tension pneumocephalus 2 years after an anterior skull base fracture: Case report by Sokchan Sim in Journal of Clinical Case Reports Medical Images and Health Sciences

ABSTRACT

Pneumocephalus, the presence of air within the cranial cavity, is most commonly caused by trauma, tumor, infection and fistulation into the intracranial cavity or secondary to neurosurgery. We describe an unusually delayed neurological deficit from intracerebral tension pneumocephalus, 2 years following a head trauma with anterior skull base fracture. A 22-year-old man presented to our neurosurgical consultation with recurrent seizures and progressive right hemiparesis. The brain CT scan without iv contrast revealed an intracerebral tension pneumocephalus in the left frontal lobe, and a persistent hole in the left anterior frontal skull base connecting to pneumocephalus. We performed a left frontal craniotomy, and dura-plasty using galea flap to cover the skull-base bone defect. The patient has recovered gradually from his motor deficit after this surgery, finally to the level that he could play his favorite guitar. This is a rare case of a delayed development neurological deficit due to pneumocephalus from a “ball-valve” effect secondary to an old anterior skull base fracture.

Key words: Pneumocephalus, hemiparesis, craniotomy, dura-plasty

INTRODUCTION

Pneumocephalus is an air entrapment in the cranial cavity. It is commonly seen after head and facial trauma, ear infections, and tumors of the skull base or neurosurgical interventions. In some extremely rare cases, it happens spontaneously. Pneumocephalus is a complication of head injury in 3.9–9.7% of the cases. The accumulation of intracranial air can be acute (<72 h) or delayed (≥72 h). In tension pneumocephalus, the continuous accumulation of intracranial air is thought to be caused by a “ball-valve” mechanism. In turn, this may lead to a mass effect on the brain, with subsequent neurological deterioration and signs of herniation. Delayed tension pneumocephalus is extremely rare and requires proper neurosurgical attention. Surgical treatment involves aspiration of air into a syringe and closure of the dura defect through a cranial surgery.

CASE REPORT

A 22-year-old male presented to our neurosurgical consultation with chronic headaches, progressive right-sided weakness and occasional seizures. Two years prior to this visit, he suffered a severe traumatic brain injury by motorcycle accident. He had lost his consciousness for three days, and hospitalized in a provincial hospital for two weeks without any surgical intervention. He was then discharged home with persistent rhinorrhea for 10 months before it ceased spontaneously. 18 months after his injury, this patient began having progressive weakness on his right side of the body, and some episodes of seizures. He also reported occasional headaches.  He was otherwise healthy before this accident. On examination, the young man had full consciousness, was alert and oriented. He had grade 3 out of 5 hemiparesis on his right side. A brain CT scan without iv contrast was obtained revealing a large pneumocephalus in the left frontal lobe. We noted a continuity of the air and the anterior skull base defect. (Figure.1)

CSF examination and culture were negative for infection, as well as the nasal swab.

Figure 1: A. Axial view of the CT scan showing hypodensity area in the left frontal lobe, pneumocephalus. B. Sagittal view presenting the large air space with its connection to the frontal skull base. C. Coronal view showing the bony defect of the anterior skull base.

We decided to perform the surgery by doing bi-coronal approach for a left frontal craniotomy and repair of the dura defect on the frontal skull base using the pedunculated galea flap. (Figure.2)

Figure 2 :A. Bi-coronal incision with preservation of large frontal galea. B. Galea still attached to the frontal base is lifted up.

The surgery went well without any complication. The post-operative course was without any significant event. No sign of infection was noticed. The patient recovered gradually from his motor deficit on his right side. The post-operative CT scan showed complete resorption of the intracerebral pneumocephalus. (Figure.3). Intravenous prophylactic antibiotics were used to prevent meningitis.

Figure 3: Post-operative CT scan showing no hypodensity area in the left frontal lobe, complete disappearance of the pneumocephalus A. Axial view B. Sagittal view C. Coronal view. Noted the small bone defect from craniotomy site.

At one-month follow-up, his motor function on the right body became normal that he could play his favorite guitar again. At three-month follow up, he had an episode of new seizures, we controlled his seizures with anti-epileptic drugs for two years afterward.

DISCUSSION

The term “pneumocephalus” was first coined more than one century ago by Luckett and Wolff independently. The term “tension pneumocephalus” was proposed by Ectors, Kessler, and Stern in 1962. Pneumocephalus or also known as pneumatocele or intracranial aerocele is defined as the presence of air in the epidural, subdural, or subarachnoid space, within the brain parenchyma or ventricular cavities. It is a complication of head injury in 3.9 – 9.7% cases. It also appears after supratentorial craniotomy surgery. The accumulation of intracranial air can be acute, less than 72 hours, or delayed, more than 72 hours.

Two mechanisms have been proposed to explain pneumocephalus. In the first mechanism, the pathophysiologic process starts with Cerebro-Spinal Fluid (CSF) leak in the presence of associated discontinuity of the cranium and leptomeningeal disruption. Subsequent development of relative negative Intra-cranial Pressure (ICP) results in a sufficient “vacuum effect” to cause additional accumulation of air within the cranial cavity. This air is generally distributed in the subarachnoid space. The second mechanism is based on the presence of a “one-way valve” at the site of the leptomeningeal tear. In this case, we found on the CT scan images a bone and dura defect in the left anterior skull base, in connection with intracerebral air collection. The air went in, and was trapped inside the frontal cerebral parenchyma. Slowly it became larger and more significant, putting mass effect into the brain tissue of the patient’s frontal lobe. The patient had experienced rhinorrhea (CSF leak through the nose) after the head trauma but disappeared spontaneously after 10 months. He then developed right hemiparesis and experienced episodes of seizures. Recurrent headaches were also a main complaint. These signs and symptoms were described in previous reports about tension pneumocephalus.

The diagnostic imaging for pneumocephalus is CT scan. “Mount Fuji sign” is described when there are bilateral hypoattenuation collections, causing compression and separation of the frontal lobes on CT scan. In our case, an intraparenchymal air-filled long cavity was seen in the left frontal lobe, with its tip connecting to the frontal skull base.

Most cases of pneumocephalus tend to resolve spontaneously with conservative management. Nonoperative management involves oxygen therapy, maintaining the patient supine or in Trendelenburg position, prophylactic antimicrobial therapy (especially in posttraumatic cases), adequate analgesia, frequent neurologic checks, and repeated CT scans. The use of continuous high concentration inspired oxygen as a treatment modality for traumatic pneumocephalus may have certain theoretical benefits. Prompt decompression of intracranial air is the initial treatment of symptomatic pneumocephalus. The principles of subsequent treatment parallel those for a CSF leak. It is important to identify the site where the communication between the air cavity and the external environment occurs. If the site can be identified, the passage should be sealed off, thereby decreasing the possibility of worsening or recurrent pneumocephalus. Effective therapy of tension pneumocephalus through a controlled decompression using a closed water-seal drainage system has also been described. In our case, we performed a full scale left frontal craniotomy to evacuate air from the intraparenchymal cavity, closure of the skull base defect by using pedunculated galea flap, re-enforced by bio-glue as a sealing material.

CONCLUSION

Tension pneumocephalus is a life-threatening neurosurgical case. Although the development of this massive intracerebral air trap was delayed in this case, it caused significant neurological deficit. The patients who suffer from head trauma, with CSF leak should be subject for long term follow up.

Disclosure: Nothing to disclose, and there was no conflict of interest among the authors.

Research ethics: Informed consent has been obtained from the patient.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#Pneumocephalus #hemiparesis #craniotomy #dura-plasty #CT #neurosurgical #headaches #Cerebro-Spinal Fluid #ICP #Intra-cranial Pressure #CSF #Sokchan Sim #jcrmhs

[jcrmhscasereports]

PHYSIOLOGICAL EFFECTS OF SINGLE BOUT OF MODERATE AND HIGH INTENSITY INTERVAL EXERCISE ON SELECTIVE ATTENTION IN YOUNG ADULTS by Farida ahmad in Journal of Clinical Case Reports Medical Images and Health Sciences 

ABSTRACT

Objectives: The primary objective of the study was to determine the effect of moderate intensity exercise and high intensity interval exercise on selective attention.

Methodology: This experimental study was conducted at Khyber Girls Medical College Peshawar from September 2020 to February 2021. A total 34 young adults were recruited who were called for two experimental sessions. During 1st experimental session, participants performed moderate intensity exercise of 15 minutes. Forward digit span test were done both before and after exercise. They were then called after one week for 2nd experimental session. Same steps were carried out but this time they performed high intensity interval exercise. The High intensity interval exercise consisted of one minute of low intensity alternating with one minute of high intensity exercise.

Results: The mean age of participants was 20 ± 2 years, body mass index (BMI) was 23 ± 4 kg/m2 and mean waist hip ratio was 0.81± 0.05. After 15 minutes of high intensity interval exercise, selective attention was significantly improved (P = 0.001).

Conclusions:  A single session of High intensity interval exercise was more effective at improving selective attention as compared to moderate exercise.

Key words: High intensity interval exercise, Selective attention, Young adults.

INTRODUCTION

Physical exercise (PE) is defined as “ a subset of physical activity that is planned, structured, and repetitive and has as a final or an intermediate objective of  improving or maintaining physical fitness” [1]. There are different types of PE, exercise performed at 50 - 63 %, 64 -76 % and 77 – 95% %   of heart rate maximum (HR max) are termed  low, moderate and high intensity exercises respectively. High intensity exercise has been further classified as continuous,  high intensity interval training (HIIT) and sprint interval training [2]. HIIT is a type of exercise characterized by short bouts of high intensity exercise alternating with same duration of rest or lower level of physical exercise [2]. Though PE positively affects selective attention and subsequently memory but unfortunately most of our population is not sufficiently active. A World Health Organization survey shows that 23% of males and 32% of females worldwide do not engage in enough physical activity; only 5% of the adult population worldwide meets the basic recommendations of physical exercise [3]. The situation is even worse in Pakistan, 24.4% males and 43.3% females are not sufficiently active. They consider lack of time, use of internet, cell phones and computers  as causes for noncompliance to exercise and sedentary behavior [4, 5]. Luckily HIIT  is less time consuming as compared to continuous moderate exercise and is preferred by most people [6-8]. It has recently emerged as an effective exercise paradigm for brain health [9]. The main advantage of HIIT is that it provides strong stimulus for neuronal growth. HIIT is especially beneficial for controlling attention and filtering out unnecessary information when performing any cognitive task[10]. However there are few studies on the effects of HIIT on selective attention.The effects of HIIT on brain health still need to be explored [11, 12]. Our study aims to add to the existing body of evidence by determining the effects of HIIT on selective attention in young adults.

Selective attention permits us to filter out insignificant information and focus on what matters. It also forms the basis for learning of complex material [13]. Unfortunately most of our young adults lose attention within 10 – 20 minutes after the start of a cognitive task[14]. The  importance of phonological loop and attention  in classroom teaching cannot be underestimated [15, 16]. Moreover it is equally important etiological factor in patients with attention deficit disorders, obsessive compulsive disorders, Alzheimer’s disease and Parkinson disease [17-19]. The amount of attention we pay to a task is controlled by central executive in the frontal lobe of the brain which also has the capability to access long term memory stores so by controlling attention one can enhance memory as well[20].

There are different ways to improve attention and subsequently memory for example environmental modifications, attention process training, self‐regulatory strategies, use of external aids  and psychosocial support in adults with attention deficit disorder [21].  In addition , physical exercise is known to improve attention both in healthy and attention deficit population [22, 23].

MATERIALS AND METHODS

This experimental study was carried at the Department of Physiology, Khyber Girls Medical College Peshawar. For the within subject design, sample size was calculated by power analysis and effect size based on previous results of Labban et al.,[24]. Power analysis was calculated by using effect size of 0.50. A sample of 34 participants was enough to get power of .80.  After approval from ethical committee of Khyber medical university volunteers were recruited through personal contacts, notices and circulars. Young adult females age 18 – 25, were selected who had no history of psychiatric illnesses, psychiatric medications, smoking, neurological and musculoskeletal disorders. All of them fulfilled the exercise fitness criteria as assessed through physical activity readiness questionnaire [25].

After informed consent, anthropometric measurements of all the participants were taken such as weight, height, waist circumference and hip circumference.  Low, Moderate and high intensity of exercise was determined for each individual according to their age. First Maximum heart rate (HR max) was calculated for each individual by the formula 220 – age[26]. Exercise performed at 50 -63 %, 64 -76 % and 77 – 95% %  of HRmax was their low, moderate and high intensity levels respectively.  High intensity interval exercise comprised of  one minute high intensity exercise alternating with same duration low intensity exercise [2]. BMI was calculated by Quetelet’ s formula(weight in Kg/height in meter square [27]. Adopting a within subject design, participants were asked to come for two experimental sessions. Participants were asked to refrain from tea and other caffeinated drinks 24 hours prior to experiment. On first experimental day pre exercise selective attention was assessed through Forward Digit span Test (FDST) which is used extensively throughout clinical and research studies and has high validity and reliability among healthy adults and is a subset of Wechsler’s adult intelligent scale [28]. After this test participant were asked to perform 15 minutes of moderate exercise on tread mill (American Fitness, LK700T CORE) according to their individual levels calculated previously. We were closely monitoring the participants to keep their heart rate within the target ranges of moderate exercise. The subjects were assessed within 5 minutes of finishing exercise for selective attention again through digit span forward test. They were then called after one week for experimental session two. The same steps were carried out but this time they performed high intensity interval exercise for 15 minutes.

RESULTS

The mean age for participants in years was 20 ± 1 SD, mean BMI 23 ± 4 (kg/m2) and mean waist hip circumference ratio was 0.81± 0.05. The average Heart rate of the participants for moderate exercise was between 122 and 152 beats per minute, for high intensity most achieved heart rate of 153 to 190 beats per minute. Data was analyzed by SPSS version 20.  Statistical significance was considered at P < 0.05. Shapiro wilk test was used to check the normality of data. Wilcoxon signed rank test for serum FDST showed a positive significant change z = - 1.422, p = .15 with a small effect size (r = .1) and z = - 3.182, p = .001 with a medium effect size (r = .4) for MIE and HIIE respectively.

Table 1:  Forward Digit Span Test Scores After Exercise

Figure 1: Forward Digit Span Test Scores before and after exercise FDST = Forward digit span test, M1=before moderate exercise, M2= after moderate exercise, H1= before high intensity interval exercise, H2 =after high intensity interval exercise

DISCUSSION

The objective of this study was to assess the effects of an acute HIT session on one aspect of cognitive function i.e. selective attention in young adults. We used digit span forward test (FDST) to assess selective attention. Moderate exercise did not affect attention while HIIT had a significant effect on selective attention. Mean forward digit span test scores before moderate exercise were 8.41 ± 2 and post exercise they were 8.86 ± 2 (P = 0.15). However HIIT had a significant effect on attention with mean FDST of 8.86 ± 1 and 9.86 ± 1 before and after exercise respectively (P = 0.001).

Results from previous research support our findings. There are several studies demonstrating a positive effect of HIIT on cognition and attention as measured by Victoria Stroop test, Reaction Time test and digit span tests [10, 29, 30]. Walsh et al., 2018 recruited 22 university students, nineteen of the participants were females aged 20 ± 1 year. They were called for two sessions; a HIIT and control visit on separate days. The HIIE session lasted for 11 minutes. Participants completed the d2 test which is another test for measuring selective attention [31]. Effect size analysis revealed a moderate effect size of 0.459 in favor of HIIE  with a P = 0.01 [32]. Our effect size was 0.486 and P = 0.001. Another study done at the university of Boston is also in line with our findings who checked inhibitory control, selective attention and declarative memory [10].However Study by Alves et al., 2014 does not match with our findings. They used both Stroop color word test FDST and concluded that HIIT improved the performance in Stroop color word test (P = 0.02) after performing 15 minutes of HIIT on cycle ergometer but no significant effect on FDST which may be attributed to the older age group that they recruited for their experiment  i.e. 53 years [33].

Another study by Kao et al demonstrated that HIIT was more beneficial at inhibitory control as assessed by modified flanker task in young adult males and females [10]. A study carried out in children 8 – 10 years of age, also report significant effect after HIIE. Stroop performance was improved after one  minute after ( P < 0.01), and improvements were maintained until 30 min after exercise cessation [34].

Tsukamoto recruited 10 males and used felt arousal scale (FAS) to assess arousal level and color word Stroop task for measuring attention and found significant increase after HIIE [35].

Previously it was thought that intensity affects cognition in a U shaped manner, meaning that if we continue to increase the intensity of exercise from low to moderate, cognition will improve but after a high intensity is reached cognition will deteriorate [36]. On the contrary, our and other recent research do not support this hypothesis [33]. In our study the high intensity exercise improved selective attention as compared to moderate exercise. Possible explanation for improved attention can be attributed to psychophysiological mechanisms such as improved cerebral blood flow which provides brain sufficient amount of glucose and oxygen and improved psychological wellbeing [11, 37].

It is also suggested that there is increased levels of epinephrine and nor epinephrine which leads to more  arousal and subsequently increased attention [38] .Following exercise there is increased allocation of attention resources [32]. When a person is engaged in any information processing operations involving encoding and decision making he uses attention resources to complete this information processing. Human beings select a limited amount of sensory input to process the information while neglect other unrelated sensory inputs through attention resource allocation [39].

CONCLUSION

Our study validated the previous results and showed that even a single bout of 15 minutes of HIIT improves selective attention and it is more effective as compared to moderate exercise of same duration.

Acknowledgements:

We acknowledge the participants for their contribution to the study.

Conflict of Interest.

The authors declare that there is no conflict of interest regarding the publication of this paper.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#High intensity interval exercise #Selective attention #Young adults #participants #Khyber #Physical exercise #FDST #PE #felt arousal scale #Farida ahmad #jcrmhs

[jcrmhscasereports]

Successful Jatene procedure for great arteries transposition correction in newborn with SARSCoV-2 infection by Guillermo Careaga-Reyna MD in Journal of Clinical Case Reports Medical Images and Health Sciences

ABSTRACT

Pandemic of COVID-19 represents a challenge for treatment of patients with congenital herat disease. We present a newborn with great vessels transposition and positive SARS-CoV-2 PCR test. The patient was submitted to a successful surgical treatment with corrective Jatene procedure, requiring opened chest wall during 72 h of postoperative period and 43 days of total in-hospital lenght of stay.

KEY-WORDS: COVID-19, SARS-CoV-2, great vessel transposition, Jatene procedure, congenital heart disease.

INTRODUCTION

Coronaviruses are single stranded ribonucleic acid viruses with a diameter of 60–140 nm and a high rate of genetic mutations and recombinations, rendering them capable of escaping from the immune system and causing novel infections (1). In less than six months, the coronavirus disease 2019 (COVID-19) pandemic has swiftly spread from one city in China to over 190 countries worldwide (2-4). Neonatal infections with SARS-CoV-2 have been described although robust data on vertical transmission are lacking. In most instances where neonatal infection has been reported, close contact with infected mother or caregiver is postulated to have occurred (4).

In newborns, the case is regarded as positive for infection if any of the following conditions occurs, (1): positive PCR for SARS-CoV-2 in respiratory tract or blood samples, high homology of viral gene sequences of the samples from the respiratory tract or blood to the COVID-19 sequence.

We present a case of a newborn with great vessel transposition and SARS-CoV-2 infection.

CASE REPORT

We present a new born with great arteries transposition associated to aquired SARS-COV-2 infection.

The patient was refrerred to our hospital, with a positive SARS-CoV-2 test, with mechanical ventilatory support in order to confirm a complex congenital heart disease.

The diagnosis was established via echocardiographic evaluation which showed normal venous return, concordance atrio-ventricular and ventriculo-arterial discordance. It was concluded: great arteries transposition, patent ductus arteriosus and permeability of foramen oval.

The patient was recovered from a septic shock with no evidence of systemic inflammatory response requires inotropic support and after stabilization in neonatal intensive care unit, at 10 day in-hospital stay,  was submitted to an open heart surgery consisted in anatomic correction with Jatene procedure. The aortic cross-clamping time was 119 min, with cardiopulmonary bypass (CPB) of 181 min. It was decided to maintain in postoperative period opened chest wall, and after 72 the chest wall closure was succesfully realized with favorable posoperative evolution. After 32 days of postoperative, the patient was discharged from hospital. Actually, two years after surgery, the patient is doing well, only with mild pulmonary stenosis without hemodinamic or clinical repercusion.

DISCUSSION

For infants born to COVID positive mothers should be reasonable to separate him from the mother if will need cardiac surgery to try avoid post-natal infection.

In fact, there is minimal evidence of placental vertical transmisión. In this case, the patient has a positive test for SARS-CoV-2 infection and evolved with septic shock in the preoperative period.

It may also be reasonable to do serial testing on the infant, but there is no consensus on the correct timing surgery should be scheduled with advice from a multidisciplinary team of experts including cardiac medical, cardiac surgical, and infectious diseases as indicated. After evaluation of the clinical conditions for a heart team in our hospital, it was decided to realize the surgical procedure in order to avoid progression of heart damage and irreversible heart failure.

However we must remember that, if prudent, surgery should be delayed until the patient’s symptoms have improved and/or testing has been repeated (often after 14 days) and is negative (5).

On the other side, in older patients the inflammatory response due to SARS-CoV-2 infection has been a frequent complication.

In our patient, probably due to the age, it was no presented even with the septic shock o posteriorly associated to the use of CPB during the surgical procedure

It was concluded taht COVID-19 may affect all age patients. However with cautious evaluation and treatment of associated disease as in our case, the patient improves survival, despite severity of viral illness, and during this pandemic period, patients with active COVID-19, at neonatal period we have no treated any other.

FINANCIAL SUPPORT: None.

CONFLICTS OF INTEREST: The authors declares there is no conflict of interests.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

#SARS-CoV-2 #great vessel transposition #Jatene procedure #congenital heart disease #PCR #COVID-19 #hemodinamic #cardiopulmonary bypass #preoperative period #Guillermo Careaga-Reyna MD #jcrmhs