#generic insects not bees | Explore Tumblr Posts and Blogs

the-derpy-duck · 5 months

Text

The TFA universe is a fucking nightmare and I wish people would actually talk about it. Long rant incoming.

Don’t expect good spelling or grammar I’m sorry

Like the show didn’t even care enough to address how fucked everything was. Like all the little baby robots just don’t have names until they go through the military/boot camp, which doesn’t make a lot of sense as the whole point of basic training/boot camp is taking away one’s identity and individualization aka what a lot of cults and extremist groups will do to get people to go along with whatever they want them to, as it’s a lot easier for group think to occur when there is a group. The whole “small cog in a bigger machine” bullshit speech is literally just that but dressed up to look and sound pretty (propaganda). But half of the names given at the boot camp are insults and that’s really fucked up. And it’s almost implied that the other transformers recognize Bulkhead and Bumblebee’s names as being insulting in nature because when Sari introduces herself to Bumblebee it sort of goes like this:

“My name is Bumblebee” “I’m Sari” “Oh don’t be, I like my name.”

But that would also imply that the show was thinking about acknowledging how messed up its own world is and I don’t really think it is. I think that’s a joke, was meant to be taken as a joke, but could be read into as world building or something.

It’s been a hot second sense I’ve rewatched season three of tfa but from what I remember, Ultra Magnus was sort of a dictator? Like I know that there is some form of election, but the main way anything gets done is through the council of primes and in TFA it is established that “prime” is a military rank, and those who advanced to “prime” have to be approved by the council, which Ultra Magnus is the head of. He doesn’t have full dictation over it (he wanted OP to not be horribly punished) but he does have a sizable amount of control (op was still given a job and got to keep his rank). The election cycles are nonexistent as the only time anyone thinks of trying to replace Ultra Magnus is when he is on his death bed. So is it like the Supreme Court? The people technically elect a leader but the council that would decide on important laws and if they are constitutional is chosen by the leader, not the people, can serve until they die, and can do fuck all and no one will challenge them because they have the final say on the law? For a thing like economics or the Supreme Court it would make sense to have these be not elected officials for the sole purpose of “they wouldn’t be pressured by potentially not being re-elected and so they would be able to do their jobs without worrying if it would please the people.” A lot of things done to fix and adjust the economy will look really bad at first but it ultimately serves to balance everything. But the people in charge of the FED and other economic shit also don’t serve until they die. Long tangent to say, not a lot of democracy in this word.

The only way to gain power in cybertron seems to be to either join the military or do a hyper specific job. Also how long has ultra Magnus been the leader? Was no one ever unhappy with how he lead? Sentinel Prime was but that was seen as a bit of a taboo. Also Sentinel’s Cybertron immediately turning into an Orwellian styled red scare nightmare was a choice. Establishing curfews during a time of potential war where the planet/country/city could easily be targeted for an attack isn’t in itself unreasonable. It’s immediately taken to 11 but the general idea of curfews makes sense. As well as reporting potential spys for the main reason that spy’s had been proven to have infiltrated the prime counsel thing. It goes to fear mongering almost instantly but the general idea isn’t bad.

Im interested to know how Ultra Magnus would have handled the situation because the show just sort of is neutral about him. He’s just there most of the time and tells OP not to try and be a hero. I want to know if he would have done something similar to Sentinel and I want to know if the show would address it. Because the general difference between UM and SP is that UM is better at hiding how much he manipulates power. He’s still a dictator even if he isn’t an antagonist force. He’s not a benevolent dictator because dictators, by definition, cannot be benevolent. If they were truly benevolent then the people would get a choice in the world that they live in.

All this to say, “dictator bad”

ALSO is there no trial system? Wasp just was sent to prison and they didn’t think to look into any of the evidence? Did no one think to maybe investigate the people who would have had the codes or spare keys for the locker things? Do they just send people into solitary confinement without any sort of hearing or evidence or was Wasp just waiting for his court date? Why does Optimus want Bumblebee to apologize to the guy who clearly doesn’t want to speak to him? He literally watched Bumblebee give an apology and a reasonable explanation for his actions. He wasn’t making excuses he was manipulated by a person who he thought was his friend and the main reason why he was able to be so easily manipulated was because the person in power was actively antagonist towards him. He did the right thing. He asked a person, who would have known how to make a report, how to make a report. If shockwave wasn’t the person who was in that roll then Wasp probably wouldn’t have been framed. And even if Bumblebees wasn’t the one who found the things in his locker, Sentinel still would have found them because Shockwave planted them. I’m sorry but asking a person how to make a report so you can go around the person who is acting aggressive towards you and holds a significant position of power over you isn’t the same as purposefully ruining someone’s life. Bumblebee was going off of evidence that was 100% circumstantial, biased, and highly questionable, that doesn’t automatically mean that he was trying to frame Wasp. If he had reported that he overheard a spy communicating with the decepticons and had reasons to believe that it might be Wasp, then I would assume that whoever the fuck would do an investigation and either clear Wasp or just arrest him because due process and fair trials is for babies. In which case, it still wouldn’t be the fault of a person who isn’t in control of anything. Blaming Bumblebee for what happened to Wasp is like blaming doctors for how expensive medical treatment is. He trusted the wrong person and that person used his trust against him. The people in power did not think to do an investigation into any of this. And even if the whole Wasp thing was open and shut why wouldn’t they look further into this? Maybe there was other spy’s? Did anyone think about that? No? It also isn’t Bumblebee’s fault that Shockwave got to the position of Prime. The security system and the people in charge of screenings didn’t pick up on the fact that there was a spy. That is not the fault of a random cadet who trusted someone. Shockwave’s actions and the people who died because of them are the fault of Shockwave. Bumblebee’s fuck up did help him not get caught, but it was also the closet we see to him being caught before he becomes a prime. If the people in the TFA world weren’t so fucking stupid then this wouldn’t of happened because maybe this hyper advanced world would have fucking security cameras. If they can figure out how to bend time and space then I think they can figure out how to install things that would record a conversation.

WAIT- doesn’t Bumblebee use something similar to that to figure out the decepticons plans and relay it back to earth? And they have computers that have screens so why don’t they have cameras installed?

Anyway, Wasp blaming Bumblebee makes sense. It makes sense that he is angry at him and it makes sense that he wouldn’t forgive him. That’s not the issue I have with this the issue is that OP also blames Bumblebee. Which I guess would also make sense as animated Optimus seems to be deeply rooted in the military and is a string supported of Ultra Magnus. It is stated in the first episode that he watches propaganda and repeats the military speech about being one big machine. He lies to save his friend and he sucks for that because his friend abuses his power whenever he gets the chance to and he knows this. Optimus lying for Sentinel is much more egregious to me than what Bumblebee does because Bumblebee didn’t know that Longarm was a spy. I understand why Optimus would lie for Sentinel, he is a loyal friend and he definitely did blame himself for what happened. That doesn’t change the fact that he KNOWINGLY let a person who he knew to be irresponsible and who got others into dangerous situations into a position of power. I think Ultra Magnus knew that Optimus was lying and like- why are you people like this?

Bumblebee could have been called out for so many different things that he actually did. Like is he a bad friend? Yes. He treats Bulkhead badly, most of there interactions are just him insulting Bulkhead and Bulkhead never insults him back. If they both were insulting each other then I wouldn’t really have an issue but most of the time they are seen together it’s just Bumblebee being an asshole. He’s willing to abandon his team and objective to chase down Blurr, he doesn’t listen when people tell him not to do something and it often leads to problems. There are reasonable things to call Bumblebee out on but the Wasp thing doesn’t make sense. If Optimus wanted to address Bumblebee never taking responsibility for his own actions, then why not do that when a consequence is the result of Bumblebee’s actions in a meaningful way. What the hell was he supposed to do? He didn’t know how to make a report so he asked. This is one of the only times that Bumblebee stops to think and consider his options, he could have immediately began spying on Wasp and the other cadets but he didn’t. He wanted to pass it off to the right people who would be able to handle it.

Animated OP frustrates me because I come so close to liking him and then he does something that personally annoys the hell out of me. I get why he would lie for his friend who was manipulative and generally awful towards him but its still just like— you have seen the consequences of his actions. This is no longer just hurting you or him, it has maybe killed a person and he has not changed. Optimus thinks he can change but he has an obligation to not let him hurt anymore people and he just needs to tell the truth. It’s really hard to leave friends behind, I know that. Even when they hurt you and actively make your life worse it is still extremely difficult to let that relationship go. I appreciate how Optimus has issues in that regard. But it’s gotten to a point where Sentinel’s poor judgment and refusal to listen to others puts himself and others in danger. Optimus gave him the opportunity to continue to cause harm to others, and he really wants to sit here and say that Bumblebee was making excuses when he just wasn’t? And he never and would never be called out on this.

One last thing, Ultra Magnus and the rest of the high command clearly don’t give a shit about the cybertronians who were fighting (they were so willing to just kill Arcee for the activation code) in the war and also don’t ever try to investigate any issue further. Potential spy? Eh sure throw him into solitary confinement. One of our top cadets went missing and might have died but no body has been recovered? Well fuck, gotta just say she died and not look into it to make sure there wasn’t any malpractice.

So in conclusion:

The name thing both doesn’t make sense and makes too much sense

Ultra Magnus is kind of a dictator kind of not a dictator

Optimus prime spew’s military bullshit and propaganda and no one cares

Wasp is a dick, didn’t deserve what happened to him

Bumblebee is an asshole, he still didn’t try to ruin a persons life.

No one cares about investigating serious crimes and accusations

109 notes · View notes

def-notagoose · 13 days

Text

Based biofriendly lawn enthusiast vs. beta cuck HOA

8 notes · View notes

printabledesignrf · 14 days

Text

13 notes · View notes

arthro · 1 year

Text

Hello all! I made this little poster to raise awareness about some lesser known bees! All these types are found pretty much worldwide, so no matter where you live this poster might be quite helpful to you. Despite their ubiquitousness, a whole lot of species within these taxa are in decline or endangered due to human activity. If you or someone you know happens to manage a lawn or garden, I'd recommend following a few of these tips to provide good habitat for these bees and many more insects that use similar shelter!

P.S. Bee experts: please let me know if anything on the post is inaccurate! That last part about stem cutback is purely based on observations in my own garden, so I just gave a ballpark estimate.

#arthropod #insect #hymenoptera #bee #informative #yes this is part of a project I needed to do for a course #yes i'm still quite sincere about it #i tried to make it applicable globally which means there are some generalizations #if you have questions about your area in particular feel free to message or ask me

71 notes · View notes

octoagentmiles · 1 year

Text

Animals I wish to see in Above and Beyond:

Alternate title: I Am Banging On Silvergate’s Door As We Speak /j

Bees!! because a bee model does in fact exist. I know this. They just need to use it /srs. Plus bees would make a really cute episode anyway- and when they finally do it I am willing to bet $9999 on it being a Vegimals episode.

Orchid mantis, or any kind of mantis really. Why? They are my favourite bug, next question-

Gynandromorph animal(s)!!! They're so cool—they're what happens when an animal with vastly different gender differences (think the harlequin ducks) is born intersex, and they look like Picasso paintings come to life. (it could also be a fun way to introduce a character with they/them pronouns-)

Parrots! (I know we got the mountain parrots but shh-) I desperately want a Pete-centered episode, and give him some friends while you're at it please.

Centipede! They’re literally just remipedes on land. Make it a Shellington episode and call it a day 👍

Snails. I love snails. They're the best mollusks, I am not accepting criticism.

Tarantula. Just because :)

Bunny. They showed an illustration of a non-anthro bunny in The Cold Snap and I have not felt peace since.

I’d gladly take a jackrabbit too; they’re not really rabbits (they’re hares), but if you’ve read that one post you’ll understand. It’s a Kwazii and Tweak episode.

Sammy The Falcon specifically. What is his deal???? They introduced him as Paani's living taxi and gave us ZERO context.

Maned wolves. Weirdos. (affectionate)

Moose. I will not elaborate further.

I’m down to see the chinstrap penguins again, or Ooju and Rocko—I think they should interact 👀

Ostrich?? Emu?? I have nothing else to say.

Ring-Tailed Lemur. They’re another one of my favourite animals, and I think the Wild Kratts fans would get a kick out of it. They deserve nice things.

Mole lizard. Look it up I DARE you. (cw if you're scared of snakes or worms) /nf

#octonauts #octonauts above and beyond #help i have no idea what to tag-#if you're curious about the bee model: it was shown in a chinese promo poster for anb that i found on my deep dive a while ago #i didn't include it in the post i made but it exists trust me-#source: trust me bro #i want it to be a vegimal ep bc the veges were implied to be a hivemind in the books and i would LOVE for that to be referenced #we need more kwazii and tweak episodes in general. but gimmie em chasing a jackrabbit in the middle of the night bf unsolved style >:)#that'd be so fun you can't argue bc i'm right /lh #shout out to the wk fandom. ily.#i watched like 2 eps of that show as a kid but i was obsessed with the online flash games where u made ur own avatar and went on missions #i dont think it exists anymore but twas a cherished childhood memory nonetheless #do i need to tag bug cw for this post? i just noticed a fair amount of these are insects- i like bugs ig lol #ask to tag

52 notes · View notes

cantankerouscatfish · 9 months

Text

Xenox tigrinus my beloved

#tiger bee fly. :)#insects #bugs #(general catch-all tag)

10 notes · View notes

thekuriousbeing · 11 months

Photo

Buts, Bolts & Insects

Metallic insects crawl and fly, Gears and circuits amplify, Intricate movements, precision true, Mechanical wonders, a futuristic view.

#aiart #midjourney #midjorneyart #insects #machines #mechanical #ant #ladybug #beetle #butterfly #centipede #mantis #firefly #bee #ai generated

1 note · View note

simptasia · 2 years

Text

but the real question is can catholics eat bees?

#this convo reminded me of the debate about whether bees (or insects in general) are animals or not #and that leads us to What Is An Animal #what defines an animal really

3 notes · View notes

pizzapizzadickz · 2 years

Text

Mn. I really wanna leave and go somewhere. If I wasn't terrified of most bugs I probably would instantly. But where?

#gotta do everything i want before i die #diary #personal #hm. i like camping. but theres just so many bugs. hm. where to tho? i dont mind camping around here - but maybe somewhere better is nice #i guess ill look into it. and maybe a therapist to help with my insect phobia thing.#im rly only scared of bees. but bc of how my mom acts with other bugs like tics and bc ive had them in my pants before -#im just generally scared and alert around bugs.#haaaah. not much to be done.#maybe i should go somewhere farther away?#i have one place in mind. but how would i get there?#theres like this stupid family emergency going on round where i wanna go so im sorta hesitent to ask for them to drive me.#hm. well maybe ill talk to my mom and see what we can do? once im camping ill be fine anyways.#all i rly need to eat is granola bars that i like. anything else is a bonus.#and i could take a break from all this *vaguely gestures around everywhere*#i could write and draw and take plenty of pictures. i should have enough room on my camera afterall. maybe i should check tho #i think this would be the cheapest option but also one of the more fun.#i dont have a passport rn so maybe i should start the application process? hm. i think ill go to japan next maybe.#or somewhere else perhaps? theres so much i wanna do suddenly lmao.#i can tell im still quite depressed. but idk what happened - most likely its that mentality #but rly i just wanna go have fun somewhere.#idk. i love to travel and with covid and everything i havent been able to and it makes me feel trapped.#i dont wanna be here forever. i sometimes hate it here... but. i just wanna go. yknow?#haaah. i rly wanna know whats wrong with me. like. not that i feel its something inherently wrong #just... i wanna know whats going on so i can better accommodate it yknow?#either way a short vacation sounds nice. like a 5 day or so one. of course this doesnt mean that ill just jump ship lmao #but hm. where to go? i cant drive so i gotta plan around that in the end. hm hm hmm. well i guess ill browse around.#i think ill research more on my break? or whenever i have free time lmao. even tho its not much. haha.

2 notes · View notes

bogleech · 8 months

Text

Anyway while we're on the subject of public misconception towards living things (which is completely understandable because have you SEEN living things? There's like dozens of them!) here's a fresh rundown of some common mistakes about bugs!

Arachnids aren't just spiders! They're also scorpions, mites, ticks and some real weirdos out there

Insects with wings are always finished growing! Wings are the last new thing they ever develop! There can never be a "baby bee" that's just a smaller bee flying around.

That said, not all insects have larvae! Many older insect groups do look like little versions of adults....but the wings rule still applies.

Insects do have brains! Lobes and everything!

Only the Hymenoptera (bees, ants and wasps) have stingers like that.

Not all bees and wasps live in colonies with queens

The only non-hymenoptera with queens are termites, which is convergent evolution, because termites are a type of cockroach!

There are still other insects with colonial lifestyles to various degrees which can include special reproductive castes, just not the whole "queen" setup.

Even ants still deviate from that; there are multi-queen ant species, some species where the whole colony is just females who clone themselves and other outliers

There is no "hive mind;" social insects coordinate no differently from schools of fish, flocks of birds, or for that matter crowds of humans! They're just following the same signals together and communicating to each other!

Not all mosquito species carry disease, and not all of them bite people

Mosquitoes ARE ecologically very important and nobody in science ever actually said otherwise

The bite of a black widow is so rarely deadly that the United States doesn't bother stocking antivenin despite hundreds of reported bites per year. It just feels really really bad and they give you painkillers.

Recluse venom does damage skin, but only in the tiny area surrounding the bite. More serious cases are due to this dead skin inviting bacterial infection, and in fact our hospitals don't carry recluse antivenin either; they just prescribe powerful antibiotics, which has been fully effective at treating confirmed bites.

Bed bugs are real actual specific insects

"Cooties" basically are, too; it's old slang for lice

Crane flies aren't "mosquito hawks;" they actually don't eat at all!

Hobo spiders aren't really found to have a dangerous bite, leaving only widows and recluses as North America's "medically significant" spiders

Domestic honeybees actually kill far more people than hornets, including everywhere the giant "murder" hornet naturally occurs.

Wasps are only "less efficient" pollinators in that less pollen sticks to them per wasp. They are still absolutely critical pollinators and many flowers are pollinated by wasps exclusively.

Flies are also as important or more important to pollination than bees.

For "per insect" pollination efficiency it's now believed that moths also beat bees

Honeybees are non-native to most of the world and not great for the local ecosystem, they're just essential to us and our food industry

Getting a botfly is unpleasant and can become painful, but they aren't actually dangerous and they don't eat your flesh; they essentially push the flesh out of the way to create a chamber and they feed on fluids your immune system keeps making in response to the intrusion. They also keep this chamber free of bacterial infection because that would harm them too!

Botflies also exist in most parts of the world, but only one species specializes partially in humans (and primates in general, but can make do with a few other hosts)

"Kissing bugs" are a group of a couple unusual species of assassin bug. Only the kissing bugs evolved to feed on blood; other assassin bugs just eat other insects.

6K notes · View notes

anthurak · 6 months

Text

As someone who was very curious as to how Mammon was going to be presented in Helluva Boss, you can probably imagine I was looking through the new episode very closely.

And while I may have been off the mark with my theory that Mammon would follow the trend of Asmodeus and Beelzebub and NOT actually be antagonistic, I nonetheless think it is VERY interesting how Vivzie and the team handled and presented him.

Specifically, in just how PETTY Mammon is shown to be in this episode.

Like really think about what you might generally expect from a character like Mammon just from a basic background description: He is one of the seven rulers of Hell, lord of the seven rings and embodiment of GREED. Likely a fallen angel who helped to create hell as it exists today, is matched in power only by his five fellow Sins, and is functionally only truly outranked by Lucifer himself.

And yet, Mammon’s characterization in this episode presents him as this petty, selfish, manipulative asshole interested in little more than money and attention. He acts more like a shitty, full-of-himself asshole celebrity than a demon lord. Just look at how he manipulates Fizzerolli, not through lording power and authority over him but through emotional coercion like an abusive parent, ex-, or boss, which is precisely WHAT he is presented as. fi

What makes this even more interesting is that despite Mammon being characterized as Fizz’s petty, manipulative boss, we nonetheless see him display all the POWER and experience we’d expect from one of the seven rulers of Hell. Asmodeus mentions earlier in the episode that he’s known Mammon ‘since the START of Hell’, confirming they were both involved in its creation, and when the two square off at the end, it’s clear that Mammon is very much Ozzie’s EQUAL in power, and that everyone else present is pretty much an insect in comparison.

This is what I think makes the inclusion of that one creepy, obsessive fan of Fizzerolli’s in this episode so significant; he serves as a point of comparison to Mammon.

For all the power and authority that he might wield, Mammon is characterized as being no different/better than a creepy, manipulative, entitled and obsessive stalker.

I think this might be the true common ‘thru-line’ connecting all of the seven sins through Helluva Boss and possibly even Hazbin Hotel: That despite essentially being ‘God-Emperors’ of Hell and outclassed in power likely only by the most powerful angels of Heaven itself, the seven sins are characterized in a very grounded, down-to-earth and for lack of a better term, ‘human’ way.

All the times we’ve seen them, Ozzie, Bee and Mam haven’t presented themselves as these all-powerful beings lording themselves over their subjects like we might expect or even what we’ve seen of the Goetic nobility. They don’t present themselves as ‘royalty’ but rather more like celebrity performers, which is certainly in keeping with Vivzie’s comments about how Hell is meant to represent a circus.

It really gives this fascinating dichotomy to the Sins as characters, where they’re presented as these big wacky celebrities with big, over-the-top personas which in turn hide very grounded, down-to-earth people underneath. While at the same time still being these monstrously powerful and ancient beings whose dominion over Hell is entirely uncontested.

It also gives them a nice contrast with the Goetic Nobility and the Sinner Overlords. Like those two groups actually do act and present themselves like demonic ‘royalty’ who lord themselves over those considered ‘beneath’ them, while in reality they’re at best the ‘middle-managers’, and instead it’s these wacky characters who are the TRUE masters of Hell.

It may even continue into what we might see in Hazbin Hotel, what with Charlie being this bubbly, happy-go-lucky Disney-esque princess who also may very well have power outclassing literally EVERYONE else in the show apart from her parents.

Overall, I loved this episode and I think we may now have a good idea what we might expect from the other Sins, and possibly even Lucifer himself in Hazbin Hotel.

#helluva boss #helluva boss analysis #mammon #helluva mammon #asmodeus #helluva asmodeus #beelzebub #helluva beelzebub #fizzarolli #helluva fizzarolli #expectation subversion

2K notes · View notes

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

sixteenseveredhands · 18 hours

Text

Wool-Carder Bees: these solitary bees harvest the soft, downy hairs that grow on certain plants, rolling them into bundles and then using the material to line their nests

Wool-carder bees build their nests in existing cavities, usually finding a hole/crevice in a tree, a plant stem, a piece of rotting wood, or a man-made structure, and then lining the cavity with woolly plant fibers, which are used to form a series of brood cells.

The fibers (known as trichomes) are collected from the leaves and stems of various plants, including lamb’s ear (Stachys byzantina), mulleins, globe thistle, rose campion, and other fuzzy plants.

From the University of Florida's Department of Entomology & Nematology:

The female uses her toothed mandibles to scrape trichomes off fuzzy plants and collects a ball of the material under her abdomen. She transports these soft plant fibers to her selected nest site and uses them to line a brood cell. Next, she collects and deposits a provision of pollen and nectar into the cell, enough pollen to feed a larva until it is ready to pupate. Lastly, she lays a single egg on top of the pollen and nectar supply before sealing the cell. ... She will repeat this process with adjoining cells until the cavity is full.

These are solitary bees, meaning that they do not form colonies or live together in hives. Each female builds her own nest, and the males do not have nests at all.

Female wool-carder bees will sometimes sting if their nest is threatened, but they are generally docile. The males are notoriously aggressive, however; they will often chase, head-butt, and/or wrestle any other insect that invades their territory, and they may defend their territory from intruders up to 70 times per hour. The males do not have stingers, but there are five tiny spikes located on the last segment of their abdomen, and they often use those spikes when fighting. They also have strong, sharp mandibles that can crush other bees.

There are many different types of wool-carder bee, but the most prolific is the European wool-carder (Anthidium manicatum), which is native to Europe, Asia, and North Africa, but has also become established as an invasive species throughout much of North America, most of South America, and New Zealand. It is the most widely distributed unmanaged bee in the world.

A few different species of wool-carder bee: the top row depicts the European wool-carder, A. manicatum (left) and the spotted wool-carder, Anthidium maculosum (right), while the bottom row depicts the reticulated small-woolcarder, Pseudoanthidium reticulatum, and Porter's wool-carder, Anthidium porterae

Sources & More Info:

University of Florida: The Woolcarder Bee

Oregon State University: European Woolcarder Bees

Bohart Museum of Entomology: Facts about the Wool Carder Bee (PDF)

Bumblebee Conservation Trust: A. manicatum

World's Best Gardening Blog: European Wool Carder Bees - Likeable Bullies

Biological Invasions: Global Invasion by Anthidium manicatum

#entomology #hymenoptera #apiology #melittology #bees #woolcarder bees #nature #insects #arthropods #science #solitary bees #european woolcarder #anthidium #animal facts #cool bugs #cute animals

928 notes · View notes