Hi!! I love this series so much, and as someone who hasn’t really drawn since they were a kid but wants to start as a hobby, do you have any advice for sort of learning to doodle on paper and get better at it? I want to start but I don’t really know how/where
The most important step in getting better at any skill is Persistence and Consistency. Practice and keep practicing! The best way to do that is to keep it fun! Picking a project helps generate ideas (e.g. drawing Pokémon, or characters from a series you like). There are also a ton of monthly prompt lists out there!
I also highly recommend scheduling in a 'drawing/practice' time in your day. For me, I started with 30-60 min before bed (bonus: its a good 'no screentime' activity), and the habit took root there.
There are a lot of 'technical' things to study but find the fun first. At a certain point you will discover you've hit a wall, and have a specific aspect/goal you want to target (colour theory, anatomy, lighting, comic layout). Then it's time to go looking for resources.
Once you have the habit and some goals, go collect some inspiration! Find people who inspire you and study their work!
Another little 'art skill builder' I recommend is the Shrimp Method! Only if you find technical challenges like this fun though (Example of one of my studies below)
271 notes
·
View notes
I've been working on this on and off because there were always questions about Template's abilities, so I hope this helps to keep an overview. I tried to keep it simple without too much of an information dump but this was the best I could do. I'm sure I've left some things unanswered but I hope this makes Template's combat abilities easier to understand.
Oh, I also plan to make a sheet like this for Pale! If there is anything you're particularly interested in about his abilities or if you have any suggestions, let me know!
✨~DeviantArt /★/ Patreon /★/ Twitter~✨
697 notes
·
View notes
do you have any bulk deals for your website?
i offer 18% off for orders over 8 items. code LUCKY8 at checkout, never expires + can be used on multiple orders
43 notes
·
View notes
hello ! How do you make transparent gifs ? Ive been struggling with them ww ;;
haii anon , i've already answered something like that right over here !
7 notes
·
View notes
my faq: i do not engage in fandom discourse or respond to antis
ppl after reading my faq: ok *immediately sends an ask about fandom discourse & their anti BS*
11 notes
·
View notes
🪩 what are your thoughts ab wiring fan fiction for carl? i know some people age him up, and i was just wondering what you thought!!
i missed you too hehe🤭 and ready to read what you wrote!!
bby anon<3
I personally wouldn’t feel comfy doing it, and honestly even reading it at this point in my life. But I don’t judge those who do. He is a fictional character and I remember having a crush on Carl when I was young and watching the show, so I don’t really think it’s that big of a deal.
I wouldn’t want to read/write and my Carl fics now just given that in my mind he’s 17, and im 21 so just… not for me. But zero judgment to those who do.
I just personally want daddy grimes, not baby grimes🤭
5 notes
·
View notes
não rola de um server no discord? o tumblr tem muito bug no chat
amô, você pode chamar os players em particular e perguntar se eles querem partir para o discord para combinar os plots, eu fiz isso quase agora, inclusive!!! mas um server para os players nós não vamos fazer, não - a menos que todos queiram. em um grupo geral assim, normalmente tem o pessoal que interage mais enquanto outros menos, e sabemos que não é nada confortável não conseguir acompanhar um fluxo de conversas onde achamos não nos encaixar.
7 notes
·
View notes
Welcome to my g/t blog!!
Hi! My name is Froggie (also can be spelled Froggy, I don't mind), I use she/they pronouns, and I write pretty much exclusively g/t! I am AuADHD and physically disabled, so I sometimes forget about things, hyperfocus on others, or even just sleep for 15 hrs straight instead of doing things.
I am newly 18 years old, but I would very much prefer nsfw blogs don't interact with my work. My work (at the very least on this blog) will always be sfw.
PLEASE SEND ASKS IM SO BORED
My masterlist can be found here and my DMs and asks are open!
DNI: Terfs, transphobes, homophobes, nsfw blogs
For requests I take Doctor Who, Criminal Minds, Supernatural, NCIS, MCU (although i kinda fell off that after endgame), X Readers, probably Stranger Things but I'm not sure yet, your ocs and my ocs if you wanted, MCYT maybe, and Spiderverse, but this list might change as I consume new content.
I don't often write about straight-up death of a MC, but I will write upsetting themes while having the characters learn to deal with their reactions/trauma or whatever. I will not write sexual content period.
If you want me to write a story for you, the best way is to send an ask saying the characters and theme or a prompt. When I get just a prompt I kinda ignore it because idk what you want.
Anyway if you've read this far, thank you! I reply to almost everyone that talks to me as long as you're respectful, so hmu! And to all my mutuals and/or my readers: I would die for you <3
16 notes
·
View notes
TAGS AND NAVIGATION
Organizational
#witcher comment crawl - every post related to the event
#faq - your asks, answered
#crawl call - the compiled list of fanworks for each month
#guide to crawling - informational posts on how the witcher comment crawl works
#theme reveal - a post detailing each crawl's theme and including information for fanwork submissions
#commenting 101 - helpful resources and tips for leaving good comments
#comments are magic - fun posts about the effect comments can have on a fandom!
Mod tags - each post will be tagged with the name of the mod who posted it
Crawl-Specific
#crawl 01 Oct '22
#crawl 02 Dec '22
etc., more to be added as the event continues
Recommendations
Fanwork Type
#cc fanart
#cc fanfic
#cc fanvid
#cc podfic
#cc cosplay
#cc other
Fanwork Details
Ship Name - will always be formatted #character x character, first names only, in alphabetical order (example: #Geralt x Yennefer) OR alternatively, if no ship is present: #Gen
Length (word count/listening time) - #0-5k, #5-10k, #10-20k, #20-50k, #50k+ OR #0-10 mins, #10-20 mins, #20-30 mins, #30-45 mins, #45-60 mins, #1-2 hours, #2+ hours
Rating - #rating: G, #rating: T, #rating: M, #rating: E, #rating: NR
Canon - #canon: books, #canon: games, #canon: tv, #canon: other
Characters - will always be full English names preceded by ch: (example: #ch: Geralt of Rivia)
Creator Name - creator username on the platform the work is located on
5 notes
·
View notes
Hey, has anybody determined if we'll be able to get GME More on demand?
4 notes
·
View notes
leipzig 2020
5 notes
·
View notes
Unprintable: Artists Against Authority
I am absolutely beside myself with excitement to announce the launch of Unprintable.
Unprintable is an online free shop, where original artwork and arts resources are released into the public domain.
Everything listed here is free to use, copy and remix any way you like. You can print off hi-res artwork to decorate your apartment, or to use in your own projects. You can use the writing in your own zines, anthologies or performances. You can put it on a t-shirt. You can read it on the radio. You can paint it on a truck. It's up to you, entirely and forever.
The collection will be updated continuously, on an unfixed schedule, with contributions from a wide range of named and anonymous artists and activists. You can read the FAQ for a full rundown of what Unprintable is and why it exists, but these are the really important parts:
Can I download/print/use the work listed here?
Yes.
Can I use it for [X]?
You can do whatever you want with it forever.
But what if I want to [Y]?
You can do whatever you want with it forever.
Why do this?
A few reasons:
1. We want a space to just share things, no strings attached.
We recognise that copyright is an irrational system that was designed to protect the profit interests of publishing middlemen and IP hoarders. In fact, copyright is often weaponised against the creators it pretends to protect. As long as it exists, we are unlikely to win any other form of protection for our work, and we are profoundly limited from engaging in the kind of communal artistic and storytelling practices that were the norm around the world for thousands of years.
2. Radical art is often unprintable.
Profit motives make people cautious. A lot of print-on-demand or local print shop services will refuse artwork with controversial, sensitive or political content. This is very frustrating when these themes are the focus of so much of our work (and indeed our lives). Rather than waste any more breath trying to explain why a trans artist might want to print the word ‘faggot’, we can give our work away for free. Got a printer? It’s yours.
3. It feels good.
Sharing is joyful. It’s the reason we love making things in the first place. We don’t write poems because we look forward to filleting them for consumption, or layer colours so that we can sell a canvas by the ounce. We have only ever wanted to be able to support ourselves so that we can make, but that relationship is deeply dysfunctional under capitalism. We made these things, and we want you to have them. It doesn’t need to be complicated.
I'll write up some more posts introducing the launch collection soon. In the meantime...be free, enjoy, explore, have fun!
https://free.mortalityplays.com
2K notes
·
View notes
STARES AT YOU WITH MY AUTISTIC EYES. clown has a site detailing what welcome home is!!! this is just the prolouge btw ^_^ https://www.clownillustration.com/from-me-to-you here ya goooo :3
please be warned that it focuses HEAVILY on unreality. as this is an arg and is meant to take place in a world where this was an actual show
Oh ! I already know about the site I'm just trying to figure out if it has a much darker undertone or if it's supposed to be a genuine silly cute arg !
Edit: OHKAY I SEE THISLL BE FUN TO KEEP UP WITH!!! OOOOoooohhh i love me some good horror!!!!! (≧▽≦)~!!
0 notes
It's here, it's here! Starting today - get your own physical copy of the Scarland Artbook! Pre-orders will close on May 12!
We invite you to check out our Home, About and FAQ pages ✌️
Remember to check your spam folders to don't miss any emails 📩
1K notes
·
View notes
0 notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes