#birds of paradise

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

[alradeck]

Birds of Paradise! This was done as a charity card for the Seattle Children's hospital. Essentially you get the drawing from a child and you're asked to render it out without changing as much as you can. The only thing I added was legs and some tail feathers, I was very careful not to taint Eli's vision.

I got this card for answering an email quickly, lol. I happened to be at a show when the email asking for interested folks went out and answered it in a few minutes, haha. I adored the previous set they'd done like this and was beyond excited.

#mtg #magic the gathering #illustration #art #birds of paradise #bop #charity #kids drawing

[antiqueanimals]

Rothchild's Bird of Paradise. Brush, ink, and watercolor. 9"x9".

Drawing Birds. Written and illustrated by Maurice Wilson. Published in 1965.

Internet Archive

#birds #birds of paradise #rothchild's bird of paradise #Maurice Wilson

[greenthena]

Why we won't have an Apology Dance in S3--or, why I'm choosing to start WW3

Much as I love the Apology Dance, I have a hunch that neither Crowley nor Aziraphale will perform it in S3. It's such a weird (affectionate) little mating ritual, and I cannot see it without thinking of David Attenborough's "Birds of Paradise" clip from Our Planet. (The little fuckers really get going around the 2:30 mark, if you're interested.)

S2 demonstrates so many of these bizarre little mating rituals. Specifically, I'm thinking about the "Don't hesitate to ask me if you have any questions" moment...

...I mean, Goddamn. Someone damn it. Aziraphale is about to climb that demon like a tree.

And the exchange about borrowing the Bentley...

...which is a battle lost before it's even begun because Aziraphale flashes those pretty eyes and Crowley's too smitten to really put up a fight.

Mah point is (dolphins). My point is that every aspect of their interaction, particularly in S2, is a dance, a courting practice, a mating ritual to which only these two weird (affectionate) little birds know the steps.

And the Apology Dance is one of the key steps in this ritual. We know how important it is because Aziraphale has memorized each year when he performed it for Crowley. 1650, 1793, 1941... And Crowley has now reciprocated. But for all the importance of the Apology Dance, we never hear an actual apology. The words, "I'm sorry" are never exchanged between the Ineffables.

Of course, Aziraphale has forgiven Crowley on multiple occasions (have a tissue), but the absolution is never in response to an apology.

Why does this matter, you ask? Because Crowley has never asked to be forgiven. It's one of his self-identifying traits.

And every time Aziraphale offers him forgiveness, it calls into question Crowley's whole identity. I think this is why Crowley initially refuses to do the dance. He doesn't "do the dance," because he doesn't apologize. Because what's the point? If you believe yourself to be beyond forgiveness, why even bother with an apology.

But that's not what's most interesting to me. See, outside of mending his relationship with Aziraphale, I don't think the demon could give a single fuck about forgiveness. On the cosmic level, it's just another carrot dangled by Heaven. The whole concept of forgiveness of sins demonstrates a pretty fucked up power differential. I mean, who gets to decide whether God has forgiven you when She's not even talking?

I think it's fascinating that despite their squabble, Crowley removes his glasses the moment he steps back into the bookshop, performing the Apology Dance in his "naked" face. It suggests that he knows before he even starts that everything is going to be okay. He can approach the situation in a state of vulnerability because he deeply trusts his angel. But the dance, the mating ritual, still has to be completed. It's similar to how Aziraphale knew Crowley would let him drive the Bentley, but they still had to negotiate their way through the motions.

We've called it the Apology Dance, despite the fact that no apology is offered and no forgiveness given. Remember, Aziraphale's response to Crowley's successful completion of the ritual is, "Very nice."

So here's the crux. All these rituals that they perform, the Ineffable dances, if you will, rely on one crucial element. The result of the ritual has to be established before the ritual has begun. They each have to enter the ritual in a state of vulnerability, knowing the outcome will be safe and satisfying. And I think that's why Aziraphale doesn't say, "I forgive you" after Crowley's elegant spin and bow.

Because forgiveness is something Aziraphale only offers the demon when he feels cornered, frightened and unsafe. Think about the two times he's said it. In both cases, the forgiveness was weaponized.

(Apology Dance incoming for this next gif.)

In a very real way, when Aziraphale forgives Crowley, he invalidates his best friend's lived experience. Crowley doesn't want to be forgiven. He wants to be accepted. Loved. Seen.

So as much fun as it is to speculate about who might dance for whom in S3, I truly hope neither angel nor demon apologize to the other. For me, the most meaningful conclusion would be for them to complete their mating ritual not with some dogmatic, pedantic, fucked up power differential where one forgives the other for perceived iniquities. Nah. Fuck that. I want them to accept and love and deeply see one another and fully embrace whatever that means.

Here. Have some tissues.

#good omens #aziraphale #crowley #aziracrow #ineffable husbands #aziraphale is in love #crowley is in love #apology dance #im gonna make you cry #im really sorry for the last gif #david attenborough #birds of paradise #david tennant is 87% legs #good omens s3 #good omens season 3 #go3 #Youtube #Good omens meta

[nematodeneedles]

superb bird of paradise courtship dance but as a creature and that’s just its face

#superb bird of paradise #birds of paradise #creature design #character design #artists on tumblr

[weirdly-specific-but-ok]

I am currently alternating between watching an episode of Granada Holmes on Youtube, saving Good Omens pins on Pinterest (one day, one day I will run across one of my posts as a screenshot and then I will have peaked), watching Shadow and Bone edits on Youtube, writing my book and crocheting a Slytherin scarf.

There is not a single fucking real life thought in my head and I am McLovin' it fuck the real world.

#good omens mascot #weirdly specific but ok #asmi #maggots #good omens #granada holmes #shadow and bone #slytherin #oh the brainrot #the multi fandom brainrot #birds of paradise

[therosettasun]

Mothman is a musical genius /j

He has so many talents guys look at him GO!!!!

#birds of paradise #birdsofparadisearg #jorogumo #cryptids #cryptid #original comic #mothman #japanese yokai #indie series

[obsessedbyneon]

Howard Hughes Medical Institute interior landscape, in Chevy Chase, Maryland.

Scan

#scan #birds of paradise #interior green #interior landscape #chevy chase maryland #Howard Hughes Medical Institute

[kabukiaku]

my charming quetzal lad, Andrés in the color palette 'Yowl at the Yacks'.

#my art #oc art #kabukiaku andres #birds #quetzal bird #bird ocs #anthro art #furry #anthro #avian oc #avian furry #bird furry #character design #color palette #color palette challenge #original art #mariachi #mexican culture #birds of paradise #kabuki's ocs

[apple-cores]

💛??!!!!!

#well... i promised myself id post waynestar this year [checks calender] oh boy december 28th! #wayne hylics #instar hylics #hylics #hylics 2 #hobonichi #cuckoo #birds of paradise #the silly... #instar #wayne

[mtg-cards-hourly]

Birds of Paradise

Sages whisper of an undiscovered natural paradise, a tropical island unspoiled by war.

Artist: Mark Poole TCG Player Link Scryfall Link EDHREC Link

#mtg #magic the gathering #tcg #$5.09 #mark poole #birds of paradise #dominaria remastered #creature #bird

[hellsitegenetics]

Is there any reason for the Bird of Paradise flower specifically (at the end of your pinned post), or do you just really like the flower?

i just think it's particularly silly.

#birds of paradise #asks

[ticklishcicada]

Idea I had for Zapdos as a bird of paradise lol (plus dodrio for funsies)

#pokemon #zapdos #realistic pokemon #Paradisaeidae #birds of paradise #silly bird dance #birds #dodrio #doduo #google “superb bird of paradise” if you dont know wtf im talking about lol #the double wings dont make sense anyother way is all im saying!!!!!

[retropopcult]

Looking from Tomorrowland back towards the Disneyland hub, May 1962

#vintage #1960s #Circarama #Clock of the World #flowers #birds of paradise

[cadere-art]

A collection of perfectly normal birds, part one.

#black sicklebird #superb bird of paradise #parotia #birds #birds of paradise #tritone #art by me

[weirdly-specific-but-ok]

ALRIGHT. Hello my maggots I hope you're all eating each other very deliciously. Good job I'm proud of you.

Y'know NaNoWriMo is November but they also have a Camp NaNoWriMo in April and July and you know what? Fuck it I've set a word goal (you can do that for Camp) and I'm gonna do it. My first novel I completed during a July Camp and so I have hope for this one.

Is that too high a word goal, considering it's already the third of April?

No. I believe in the power of GAY.

A lot of things disappoint us but the power of gay always comes through.

Anyway wish me luck and more importantly if you wanna write this is your reminder to go for it and write.

You know what to do. Do it with style.

#good omens mascot #weirdly specific but ok #asmi #maggots #writerblr #writing #camp nano 2024 #birds of paradise #avian #my poor dumpster fire ship #you're getting put in words #camp nano april 2024 #camp nanowrimo