Tumgik
#faq
soliminizemma · 1 day
Text
125 notes · View notes
Note
Hydro I love love love ur arts! And I was wondering, For your plastic pals do you draw them from memory or is there a little toy next to you that you use for reference on how the joints work and such?
Thank you! From memory at this point, though when I was starting out with designing them, I did look up refs and such on google. It helps! I actually only have about two action figures (ignoring a mega man amiibo and a weird bendy knuckles figure) so it's kinda funny I have a whole roster of ocs like that when I don't actually have a lot of em myself. I sometimes glance at them for reference, but their joints aren't quite what most of my merch mimics have.
42 notes · View notes
tyjrose · 2 days
Note
how many followers do you have?
Like 7
32 notes · View notes
Text
Tumblr media
A.2.8 Is it possible to be an anarchist without opposing hierarchy?
No. We have seen that anarchists abhor authoritarianism. But if one is an anti-authoritarian, one must oppose all hierarchical institutions, since they embody the principle of authority. For, as Emma Goldman argued, “it is not only government in the sense of the state which is destructive of every individual value and quality. It is the whole complex authority and institutional domination which strangles life. It is the superstition, myth, pretence, evasions, and subservience which support authority and institutional domination.” [Red Emma Speaks, p. 435] This means that “there is and will always be a need to discover and overcome structures of hierarchy, authority and domination and constraints on freedom: slavery, wage-slavery [i.e. capitalism], racism, sexism, authoritarian schools, etc.” [Noam Chomsky, Language and Politics, p. 364]
Thus the consistent anarchist must oppose hierarchical relationships as well as the state. Whether economic, social or political, to be an anarchist means to oppose hierarchy. The argument for this (if anybody needs one) is as follows:
“All authoritarian institutions are organised as pyramids: the state, the private or public corporation, the army, the police, the church, the university, the hospital: they are all pyramidal structures with a small group of decision-makers at the top and a broad base of people whose decisions are made for them at the bottom. Anarchism does not demand the changing of labels on the layers, it doesn’t want different people on top, it wants us to clamber out from underneath.” [Colin Ward, Anarchy in Action, p. 22]
Hierarchies “share a common feature: they are organised systems of command and obedience” and so anarchists seek “to eliminate hierarchy per se, not simply replace one form of hierarchy with another.” [Bookchin, The Ecology of Freedom, p. 27] A hierarchy is a pyramidally-structured organisation composed of a series of grades, ranks, or offices of increasing power, prestige, and (usually) remuneration. Scholars who have investigated the hierarchical form have found that the two primary principles it embodies are domination and exploitation. For example, in his classic article “What Do Bosses Do?” (Review of Radical Political Economy, Vol. 6, No. 2), a study of the modern factory, Steven Marglin found that the main function of the corporate hierarchy is not greater productive efficiency (as capitalists claim), but greater control over workers, the purpose of such control being more effective exploitation.
Control in a hierarchy is maintained by coercion, that is, by the threat of negative sanctions of one kind or another: physical, economic, psychological, social, etc. Such control, including the repression of dissent and rebellion, therefore necessitates centralisation: a set of power relations in which the greatest control is exercised by the few at the top (particularly the head of the organisation), while those in the middle ranks have much less control and the many at the bottom have virtually none.
Since domination, coercion, and centralisation are essential features of authoritarianism, and as those features are embodied in hierarchies, all hierarchical institutions are authoritarian. Moreover, for anarchists, any organisation marked by hierarchy, centralism and authoritarianism is state-like, or “statist.” And as anarchists oppose both the state and authoritarian relations, anyone who does not seek to dismantle all forms of hierarchy cannot be called an anarchist. This applies to capitalist firms. As Noam Chomsky points out, the structure of the capitalist firm is extremely hierarchical, indeed fascist, in nature:
“a fascist system… [is] absolutist — power goes from top down … the ideal state is top down control with the public essentially following orders. “Let’s take a look at a corporation… [I]f you look at what they are, power goes strictly top down, from the board of directors to managers to lower managers to ultimately the people on the shop floor, typing messages, and so on. There’s no flow of power or planning from the bottom up. People can disrupt and make suggestions, but the same is true of a slave society. The structure of power is linear, from the top down.” [Keeping the Rabble in Line, p. 237]
David Deleon indicates these similarities between the company and the state well when he writes:
“Most factories are like military dictatorships. Those at the bottom are privates, the supervisors are sergeants, and on up through the hierarchy. The organisation can dictate everything from our clothing and hair style to how we spend a large portion of our lives, during work. It can compel overtime; it can require us to see a company doctor if we have a medical complaint; it can forbid us free time to engage in political activity; it can suppress freedom of speech, press and assembly — it can use ID cards and armed security police, along with closed-circuit TVs to watch us; it can punish dissenters with ‘disciplinary layoffs’ (as GM calls them), or it can fire us. We are forced, by circumstances, to accept much of this, or join the millions of unemployed… In almost every job, we have only the ‘right’ to quit. Major decisions are made at the top and we are expected to obey, whether we work in an ivory tower or a mine shaft.” [“For Democracy Where We Work: A rationale for social self-management”, Reinventing Anarchy, Again, Howard J. Ehrlich (ed.), pp. 193–4]
Thus the consistent anarchist must oppose hierarchy in all its forms, including the capitalist firm. Not to do so is to support archy — which an anarchist, by definition, cannot do. In other words, for anarchists, ”[p]romises to obey, contracts of (wage) slavery, agreements requiring the acceptance of a subordinate status, are all illegitimate because they do restrict and restrain individual autonomy.” [Robert Graham, “The Anarchist Contract, Reinventing Anarchy, Again, Howard J. Ehrlich (ed.), p. 77] Hierarchy, therefore, is against the basic principles which drive anarchism. It denies what makes us human and “divest[s] the personality of its most integral traits; it denies the very notion that the individual is competent to deal not only with the management of his or her personal life but with its most important context: the social context.” [Murray Bookchin, Op. Cit., p. 202]
Some argue that as long as an association is voluntary, whether it has a hierarchical structure is irrelevant. Anarchists disagree. This is for two reasons. Firstly, under capitalism workers are driven by economic necessity to sell their labour (and so liberty) to those who own the means of life. This process re-enforces the economic conditions workers face by creating “massive disparities in wealth … [as] workers… sell their labour to the capitalist at a price which does not reflect its real value.” Therefore:
“To portray the parties to an employment contract, for example, as free and equal to each other is to ignore the serious inequality of bargaining power which exists between the worker and the employer. To then go on to portray the relationship of subordination and exploitation which naturally results as the epitome of freedom is to make a mockery of both individual liberty and social justice.” [Robert Graham, Op. Cit., p. 70]
It is for this reason that anarchists support collective action and organisation: it increases the bargaining power of working people and allows them to assert their autonomy (see section J).
Secondly, if we take the key element as being whether an association is voluntary or not we would have to argue that the current state system must be considered as “anarchy.” In a modern democracy no one forces an individual to live in a specific state. We are free to leave and go somewhere else. By ignoring the hierarchical nature of an association, you can end up supporting organisations based upon the denial of freedom (including capitalist companies, the armed forces, states even) all because they are “voluntary.” As Bob Black argues, ”[t]o demonise state authoritarianism while ignoring identical albeit contract-consecrated subservient arrangements in the large-scale corporations which control the world economy is fetishism at its worst.” [The Libertarian as Conservative, The Abolition of Work and other essays, p. 142] Anarchy is more than being free to pick a master.
Therefore opposition to hierarchy is a key anarchist position, otherwise you just become a “voluntary archist” — which is hardly anarchistic. For more on this see section A.2.14 ( Why is voluntarism not enough?).
Anarchists argue that organisations do not need to be hierarchical, they can be based upon co-operation between equals who manage their own affairs directly. In this way we can do without hierarchical structures (i.e. the delegation of power in the hands of a few). Only when an association is self-managed by its members can it be considered truly anarchistic.
We are sorry to belabour this point, but some capitalist apologists, apparently wanting to appropriate the “anarchist” name because of its association with freedom, have recently claimed that one can be both a capitalist and an anarchist at the same time (as in so-called “anarcho” capitalism). It should now be clear that since capitalism is based on hierarchy (not to mention statism and exploitation), “anarcho”-capitalism is a contradiction in terms. (For more on this, see Section F)
28 notes · View notes
Note
Hey, have a vulture culture question. I have a small animal body that i want to breakdown in its entirety. I was thinking of a rot pot, but im not sure the best way to break down the bones. Also, in theory, if i were to grow plants with that soil would they be edible? Or does breaking down a body cause toxicity issues. Any advice would be helpful!
It's honestly been so long since I've used rot pots and I need to update the original post ;o;!
Short version, they work well if you need a low-no smell method. If you have a way to macerate the bones I would recommend that over a rot pot depending on the size of the animal. Rot pots are better for medium to large size animals, and I only use them for things that are like, really nasty roadkill that I can only salvage the bones from.
The nitrate released in the soil is good for certain plants but it would still need to be mixed with a bit of fresh soil to use it for growing anything. You either need to grow plants that like lot of nitrate, or use the rot pot dirt as extra fertilizer mixed in with the soil!
23 notes · View notes
mrghostrat · 3 days
Note
Hi!! I adore your work, all of it!! Mon horrible cheri and postcards from Paris hold a special place in my heart!!!
I also just wanted to ask what brushes you use to draw? sorry if you already answered it somewhere else, just starting my digital art journey and selfishly asking all my favourite artists for tips :')
<3
helloo, thank you kindly!!
i’m very picky with my preference of sharpness & texture so i’m using the same brush i found ten years ago (Mr Natural by Kyle’s Brushes, included in an adobe subscription), and a brush i made myself in an attempt to emulate Mr Natural’s texture haha
you can download all my clip studio brushes/settings/fonts here with my $1 patreon tier 💛
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
52 notes · View notes
bonus-links · 9 months
Text
Tumblr media Tumblr media Tumblr media
WOO, finally got this ref chart together! the art's actually kinda old by now (I started this back in february) but I didn't feel like redrawing everything outside outfit changes sooooo,,,,,my apologies 😅 here's the main cast! you can find individual refs in this masterpost
8K notes · View notes
mcytblrsexymen · 1 year
Text
MCYT SEXYMAN WINNER JOE HILLS
Tumblr media
[ID: the sexyman bracket, showing that the final winner is Joe Hills]
13K notes · View notes
havnenndiaco · 9 days
Text
1K notes · View notes
akanemnon · 10 months
Text
Tumblr media
TWIN RUNES MASTERPOST
1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 -15 - 16 - 17 - 18 - 19 - 20 - 21 - 21-1 - 21-2 - 21-3 - 22 - 23 -24 - 25 - 26 - 27 - 28 - 29 - 30 - 31 - 32 - 33 - 34 - 35 - 36 - 36-1 - 37 - 38 - 39 - 40 - 41 - 42 - 43 - 44 - 45 - 46 - 47 - 48 - 49 - 50 - 51 - 52 - 53 - 54
To be continued...
TWIN RUNES MINI COMICS
Glasses - Fallen down - First steps - Press [C] - Frisk Dance - But nobody came - Whatstheirface - An acquired taste - Eye opening
______________________________________________________________
TWIN RUNES - FAQ
What exactly is this AU about? Twin Runes is essentially a comedic crossover AU between the universes of Deltarune and Undertale. No fancy nicnacs. Just the characters being their chaotic selves. But there might be some darkness lurking up ahead...
When is the next comic? The comic updates most Sundays at 6:30 PM Central European Time.
Why is this AU called Twin Runes? The name is more or less a play on the typical naming format of most AU's by featuring the "Runes" part. There are no literal Twin Runes. The whole name is more of a stand in for Undertale and Deltarune as parallel worlds. Hence the "Twin" part.
When does Twin Runes take place? This AU takes place between a hypothetical Chapter 3 and Chapter 4 of Deltarune. On the Undertale side of things, it takes place post neutral route just as Frisk was about to deliver Undyne's letter to Alphys.
Tumblr media
Is the player a thing in this AU? The player lost control over both human children as soon as Frisk entered the world of Deltarune.
When Chapter 3 and 4 are released, will it affect the story? Any chapters after Chapter 3 won't affect the story in the grand scheme of things. If possible, I might make a reference to Chapter 3, but all in all Twin Runes created a new timeline so to speak.
What's up with Kris' and Frisk's hair? The red bits of their hair is more or less a representation of their souls. That in turn is also why Chara doesn't have that feature. They are soulless. It's a stylistic choice.
What's that thing on Kris' chest? It's a scar they got from tearing out their soul.
Tumblr media
And why do they have weird lines all over their body? Both Kris and Frisk's anatomy resemble that of ball-jointed dolls. They appear just as markings across their bodies. Think of them as elaborate birthmarks. Kris and Frisk are still made of flesh and blood, but are in fact hypermobile. The reason as to why they do is still a little secret :) People here like to refer to these markings as "puppet limbs". You can get a better look at them and the scar in this artwork
Tumblr media
Why does Kris have braces? This is why:
Why is Dark World Frisk green? Frisk changes their main sweater colors with Kris when they enter the Dark World.
Tumblr media
Can other ghosts see Chara? (pre Darkner transformation) No, only Frisk and Kris are able to see Chara.
IS KRIS NOW FRISK'S COUNTERPART OR CHARA'S???? :)
So, was Chara in the locket all along? No, Chara possessed the locket to become a Darkner.
Where are Jevil and Spamton? Are they in Castle Town? The Fun Gang have already fought these two in the previous chapters and added them into their inventory. Outside of that little dream sequence, neither will be making an appearance.
Tumblr media
Is anyone from Undertale Yellow gonna make an apperance? Outside of a tiny cameo from Clover (that has no greater bearing on the story) no one from Undertale Yellow is going to make an appearance.
Is (insert character here) gonna go to the Dark World/underground? With the way the story is going to play out, only the main group will be heading to this new Dark World. The rest of the story will be taking place there.
Is the Group Project miniseries canon to Twin Runes? It was made before Twin Runes was conceived and before I had any idea I would make a series. It is it's own self-contained story. So it is NOT canon to Twin Runes, but You can read it here: 1 - 2 - 3 - 4 - 5 - 6
How did you come up with the idea of Twin Runes? Twin Runes is an offshoot of a separate script I wrote. It's a similar concept but turned on its head. The funny moments in that script made me just continue what now is the start of Twin Runes. I pretty much just wanted to see if I am actually capable of drawing a comic to begin with. So... in a way Twin Runes is my first attempt at a comic ever. If I ever finish Twin Runes, then I know I can tackle turning that mammoth project of a script into a comic too. In the grand scheme of things these two projects are sister series. They have A LOT in common and even share similar plot elements. When Twin Runes is over you will automatically also know certain mysteries of The Other Script.
What is The Other Script? As of this moment I call The Other Script: "Lost in the In-Between". At its core it's an inverse of Twin Runes. I.e. Kris falling into the underground and being aided by Frisk on their quest to return home. The story and jokes are a considerably more grounded than in Twin Runes and so are the characters. Though they do have their moments from time to time. The overall mood of that script is a lot darker in nature and it's a 200+ page passion project of mine.
Am I allowed to make fanart? ABSOLUTELY! You are very welcome to make fanart if you feel like it. Please let me know if you do by tagging me, so I can share it with everyone to see so that you get the appreciation you deserve :)
Can I use the funny faces you draw for memes or for private stuff with friends? That's what they're here for :)
Is there x ship in this comic? The focus of the story is not on shipping. If it's in the game it will very likely be mentioned or brought up, but that's about it.
What pronouns do you go with for the human children? I try to stick as close as possible to the games so I use THEY/THEM FOR ALL OF THEM WITHOUT ANY EXCEPTIONS.
______________________________________________________________
ABOUT ASKS
Asks will open for 24 hours after a new comic has been released. Your questions will then be answered over the course of the week.
Try not to submit multiple asks. If necessary, just keep everything in one post.
Keep in mind that I receive AL LOT of asks, so not every question can be answered...
Questions containing spoilers will not be answered on principle. Wouldn't be as fun if the surprise was ruined, right?
Before leaving an ask (mostly for everyone who's new), please make sure to read the FAQ section above. A lot of times your question might have been answered already :>
I love memes and dumb jokes as much as the next guy, but try not to spam
It probably goes without saying, but please stay civil. I want to give everyone the respect they deserve, and naturally like to be treated the same way.
Please be mindful about drawing requests. It is understandable if you're eager to see a certain character drawn in my style, but I do not like to be bombarded by requests. The more it happens, the less likely I am to do it. Be kind and ask nicely.
Don't use other people's posts that I reblogged to ask me questions! It has happened before and I do not wish to see this!
______________________________________________________________
REFERENCE SHEETS
The following are ref sheets of characters that don't have established Dark World forms yet (as of writing this comic). The list will be updated as soon as a new character enters the Dark World. Here you will also find references of characters that might appear as surprise cameos, or maybe even completely new faces...
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
______________________________________________________________
FULL ART
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
4K notes · View notes
hellsitegenetics · 2 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes
writingwithcolor · 6 months
Text
WritingWithColor FAQ: How do I start writing a character of color?
First, be mindful that no race, culture, or ethnicity makes one inherently predisposed to certain emotions or personalities, despite what stereotypes or TTRPGs may suggest. We are all humans who share the same range of emotions and ways of thinking, even if we have different values.
Understand that there is no single template for a good [race, ethnicity] character. A person’s social, economic, and geographical background influences their life and values just as much as their race, culture, or religion. Consider: a Black American boy who grew up in a California mansion versus a Black American boy who grew up on an Illinois cornfield versus a Black boy who grew up in an apartment one city over. All three will have very different privileges, disadvantages, and outlooks on life.
Further reading (WWC x NaNoWriMo):
The Do’s of Writing PoC
Properly Coded: Creating Characters of Color
3 Ways to Show a Character's Culture
---
This Q&A is an excerpt from our General FAQ for Newcomers, which can be found in our new Masterpost of rules and FAQs. For more general resources on POC representation, check it out!
-Writing With Color
2K notes · View notes
disteal · 2 months
Text
head up if you don’t want tumblrs partnered ai companies automatically scraping your blog for image datasets, you need to manually opt out.
You can’t do this in the app rn (apparently you can but I couldn’t find it so you might have to update), only the desktop version or web browser on your phone. It will also need to be done for every sideblog you have.
You find it by opening up your blog settings > scroll down to visibility > prevent third party sharing
Tumblr media Tumblr media
As an aside, I’d thoroughly recommend opting out of having your blog scraped, even if you’re not an artist. Afaik Tumblr hasn’t explicitly stated which companies they’ll be partnering with, but the vagueness of that wording is really alarming.
These datasets use a lot of selfies for photorealistic results, moderation of who has access to these datasets is notoriously ass, and a lot of AI engines are being used to generate pornography and racist imagery (you can see this rn with the rise of ai generated propaganda). While ‘your likeness is used in an awful generated image without your consent’ IS a worst case scenario, it’s a really upsetting one. Protect yourselves.
1K notes · View notes
butchfairyzine · 4 months
Text
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
Butch Fairy Zine: Answering questions
What art style are we looking for? What is the estimated timeline? Will you get paid? we answer them here!
We will be answering more questions and posting them in the days leading up to the artist application form opening. So if you have questions, use our inbox, or you can fill in our interest form and leave them at the bottom. And if you have queries for the frog, you can leave them there too. He is very busy, so keep that in mind.
Find the interest form here.
Our Artist Application form will open on the 12th of January 2024.
text version under the cut
What type of artists are you looking for? And are you after a specific style or a range of styles?
We are looking for artists who can create pieces with fully rendered fairies and a background within the specified schedule. These can be digital artworks that are flat colour artworks, paintings, a mixture, or another style entirely.
We will also accept mixed media and traditional artworks, but they will need to be scanned at a minimum of 300dpi.
~
When you sign up for an artist position, are there any requirements to be a part of the team?
E-mail communication is required (discord is optional).
You must have a PayPal account to receive payment.
You must be able to communicate comfortably in English.
You must be 18 or older at the time of signing the contract by the 16th of February.
~
For artists accepted into the zine what would be the timeline for completing and submitting artwork?
Our current schedule for the artists requires concept ideas to be submitted by Feb 16th, and the final version by May 16th! Progress check-ins will be on Feb 29th, March 21st, and April 11th.
(In the image there is also a table including this information as well as the final submissions date being May 16th)
~
When the zine is for sale, where would the profits go to (charity, zine admin, etc.)?
We are aiming to hold pre-orders in June/July of 2024, with a flat fee paid to all contributors and additional proceeds split between contributors and mods.
Our priority is to make sure each contributor is paid fairly for their work. If sales do well enough, 20% will be used for future books and projects, and 80% split between taxes and fees, production costs, contributors and shipping costs.
~
Is this physical or digital and will there be prints of the art available? Got any merch ideas planned to go along with the zine?
Both physical and digital! Our goal is to make a 210 x 148 mm (A5) perfect-bound soft cover book.
We also plan to add some paper merch, including prints of some of the art from the book. Additional merch ideas include stickers, sticker sheets and bookmarks.
1K notes · View notes
fishbloc · 7 days
Text
Tumblr media Tumblr media
my storybook is now live! link to PO on my profile!!! (rbs are appreciated!)
happy 3rd life anniversary! 💚💛❤️
992 notes · View notes
Note
I know we've all established that you're just a master at typohraphy 'n unique/funny ways to format speech but, like-
Tumblr media Tumblr media
I need to know how you come up with TD's dialouge. I feel like y'just have to be on a completely different mental wavelength to even conceptualize speech like this.
My best guess is that I was inspired by a mix of Half Life's G-Man's speaking style, Portal 2's Space Core's aimless rambling, and freeform jazz/eccentric poetry, where thoughts and sentences are broken down into repeating fragments.
"I would like an apple please, how much would it cost?"
Becomes
"Apple! Many. Would enjoy. Me. Would. How?how much. Many cost. Much? Many much?? How. Would it. Cost. Have. Apple. Red. Apple.! For boy. Me! Would like. Apple. Cost? Cost? Cost? What"
Another way to describe it is that your train of thought normally goes from A to B to C, but TD is so scatterbrained his train of thought goes from A to B to C to B to C to A to D to C, and it happens so fast his speech can't keep up with it.
My brain isn't.. THAT messed up, but I think I have a little brainrot of my own that causes me to blank out in the middle of my sentences, ramble, etc. If I didn't speak carefully and just voiced my stream of consciousness, it'd honestly just sound like a slightly more coherent version of how I write Tails Doll's speech.
That's why he's my son!
686 notes · View notes