#remember to keep checking back! | Explore Tumblr Posts and Blogs

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

xhanisai · 9 days

Text

I think one of the main reasons why I don't go out of my way to follow a lot of people on socials even if I think their art is amazing is because at least half the time, they're shitting on the canon source material and act very big-headed. It happens too often.

#applies to all fandoms ofc #but especially ml atm #i remember i was suddenly being followed by this big artist on ig #and they drew so much pretty marinette art #and i was like okay i'll follow back #and then i see them posting marinette hate in their stories after Kuro Neko dropped #and i was like yo wtf #quickly unfollowed #i don't have time to background check every single artist whose art I like man #i genuinely love ml #with its flaws and everything #i don't mind when people do some sane critiques on the show #and i know everyone will have differing opinions #but my days it is such a pain when a hater comes into the fandom and draws fanart for the clout #and they get praised for it????#literally 10 years ago i used to follow soooooo many people on all socials #now i have to keep it as limited as possible #no one can enjoy anything in peace

23 notes · View notes

pcktknife · 2 months

Note

Yo! Do you use HoYoLAB, that social media app hoyoverse made? It is FOUL on there

hoyolab hurts the brain to be on for too long

#siiiigh i have it for check ins and the occasional mindless scroll #big thing over there rn(?) is genderbends which whew some of them thangs...aside from other things #i get that genshin women wear revealing clothing but u gotta take the character into account man.. would wriothesley wear short shorts #....ever? cmon put some thought into it. and they take the muscle away too sometimes like girl go to hell #and ppl over there are like...kinda mean. love to give criticisms where they arent asked for. weirdly hostile #i like to keep my hoyofan interactions to a minimum and ppl on hoyolab make me remember why #asks #anon #wait and circling back to the genderbends...the hair why are we doing the short hair thing like a third of the men in that game have hair #longer than chin length what are we cutting hair for #i should just make a catchall hyvrs tag #mhy

28 notes · View notes

sysig · 9 months

Photo

Hey. Read Roundabout. Love Awesome. (Patreon)

#Doodles #Wander Over Yonder #Commander Peepers #Emperor Awesome #Lord Hater #As always check the tags first but hgggg Roundabout is so gooooood <3 <3 #Absolutely the fic that convinced me that Awesome was worth thinking about more than he initially appears lol #The™ fanon interpretation to me <3 #Like the Eyesome stuff obviously (also the thing that convinced me to try out Eyesome and ended up loving it :D)#But also the Death Glare stuff! It's terribly cute the way Peepers and Hater go bouncing off each other haha ♪#Plus there's just a lot of fun phrasing like the one I put in the caption of Peepers curled up haha #Everyone's characterized so fun!#Plus there's just something very fun recalling my first reread lol - I don't actually remember my first reading experience #But I do remember getting fic-hungry for it later down the line at a local Mexican restaurant and reading it on their wifi lol #It's so fun to finally be at a point where I can confidently draw them and then to come back to the story and ahhh <3 <3 Very enjoyable #The first two aren't tied to anything specific other than the basic concept of those two drinking together lol #Same size glasses but very different alcohol-to-body-size proportions lol ♪ Buying drinks for Peepers saves hand over fist!#We all know he could put it away like no one's business so really it wouldn't matter in the end lol #It was so fun to doodle him curled up ahh <3 His silhouette <3 <3 Toss a blanket over him!#And the Drama! The deliciousness of Peepers keeping Secrets from his Lord Hater! Ah!#It feels so in-character of him to have alone time away from the ship that Hater doesn't even notice until he's been away awhile ♪♫#They're both adults ♪ They have aspects of their lives that aren't Entirely intertwined ♫ Until they do hehehe #Love 'em ♥#Hater was fun to draw there too lol slowly getting used to him! I like his PJs haha

49 notes · View notes

galahadenough · 6 months

Text

This is a scene from one of the best things I’ve ever read, book or fanfic, Blind, But Now by aperplexingpuzzle on ao3 (currently @ghirahimbo here)! I cannot recommend this story enough!

If a legend is a regal and intricately woven tapestry, hung on a distant wall, then BBN is that tapestry up close. It takes the legend and lets you see the threads, lets you feel the texture. Every knot, every spot worn smooth over time. The story sees both the original image and the pieces that make up the image. It looks at how the journey weathered the tapestry, looking at the broken threads, the frayed and discolored spots, and sees an image made all the more beautiful because it doesn’t just tell the story of the legend but the story of the tapestry.

This scene really gave me such a deep, almost physical feeling of the heat and immensity of the region. It stays with me and is one of the first scenes that comes to mind when I think about the story. I was hoping to catch a little of that, plus the overall feeling of their encounter, that edge of potential. Potential danger and potential.. something else.

26 notes · View notes

designernishiki · 11 months

Text

shout out to reina for being one of the only characters Ever to make kiryu shut the fuck up and stop trying to be a pointlessly self sacrificial lone wolf for a second by threatening to scream on the street like he’s attacking her if he doesnt get his ass inside

#this was SUCH a power move #god i miss her so much #her and nishiki are the only ones I remember successfully keeping his martyr complex in check- this incident and then obviously when #nishiki comes back after their fight like bitch did you honestly think I’d let you just walk away and get yourself killed? did you think I’d #just ACCEPT you cutting me off ‘for my own good’? shut up asshole we’re in this together whether you like it or not #man it’s almost like kiryu should’ve. learned something. way back in 1988. crazy #yakuza is just. kiryu’s abandonment issues: the game #make everyone lose you before you can lose them!!!!!!! life hack #yeah the collateral emotional damage is tremendous but uh. hey. oh well #god it’s aggravating. it’s like he’s constantly learning a little bit and then regressing again even further over and over again #rambling #reina #kiryu #y0

46 notes · View notes

creaturefeaster · 7 months

Note

could you talk more about what your geese are like and what its like to own them? ive been so obsessed with them lately and theyre so silly to me :3

Oh hell yeah I'll talk about my geese any day

Geese are really, really silly. A lot of people find them scary, but they can be very sweet and extremely loyal.

My geese will follow me everywhere. If I walk from one side of the land to the other, at a slow pace, they will typically follow in a slow line behind me. During late summer and early fall when green grass is more scarce, I like to take them to parts of the lot that they haven't been to in a while so they can keep up on their greens :3.

If I'm not the one leading, Sebastian, the gander of the group, takes on that role. I took these pictures today, and he was feeling particularly protective of the hens while I was taking these pictures (I was doing really close up pics, something I don't normally do so I don't blame him.) When a goose, especially a gander, is being protective of something, they always position themselves between you and what they're protecting.

Something else people don't realise about geese is that they pay really close attention to body language. A lot of attacks from geese are because people start acting weird around them. They take this like, "this human is not acting like how humans usually act, so I feel uncomfortable." Especially in early spring when they have babies.

...But also, they like to check people. They check every living thing around them more often than not, because they get bored easily and have fun asserting themselves. When alone they do this to each other, but if you're new around, they will try and fuck with you. And if you react how they want, which is usually in backing away, flinching, or even sometimes they're looking for a fight so approaching them the wrong way as well, they will keep going until you're chased off.

Sometimes I use my geese to keep my chickens safe, because getting occasionally pestered by a goose for straying into their grazing grounds keeps them closer together and near their coop, and out of sight of eagles and hawks.

But what's really funny, is if you just... ignore them, as long as you aren't walking towards something they're protective of and you aren't showing signs of stress, they just stop. They fail to check you and that's that, and unless you've really pissed them off beforehand, they'll forget about it. I have a tiny, clueless chicken named Sloppy Joe who doesn't read body language well at all. So whenever a goose checks her they never succeed, because she's too busy not paying attention to notice she's being challenged.

The center focus goose in this picture is Gertrude, or who I like to call Gerdy (I think of Binding of Isaac's boss Gerdy), and she's been especially funny lately.

My geese aren't ever thrilled about being picked up so I don't tend to upset them with holding them if I don't have a reason to. But lately, Gerdy doesn't leave the pen when they're let out. She gets vocal and upset that everybody left without her, and she paces by the gate. There's no reason for this. So I've been picking her up and helping her out, and when she's put back down she happily runs to go meet up with the others, it never fails.

I think she's just been wanting attention. When I first got her she was always a lot more tolerant to being touched and handled. She also likes to stand very close to me and stare at me and shake her head. (Head shaking can be fear, a threat, or excitement. It's hard to tell which it is, but I know her. She's giddy.)

I've been taking their pleasant mood in as much as I can lately, because when December rolls around, they start getting into their pre-mating season funk. Sebastian is a short fuse and the hens are hissy even before they start laying eggs 🙄

I usually have to avoid sitting on the hill like this during mating season, because Sebastian is so unpredictable during those months. But it was nice today and everybody was in a good mood :).

#anyone remember that one video of those guys trying to get like a frisbee back from aways #but theres a goose standing near it and it keeps scaring them off bc theyre being so weird about it #and then this chick just strolls up and picks it up like it's nothing and the goose does not care #she made it clear what she was doing and didnt make it a big deal #that's just how it is for real. sebastian checks me every day while getting food from the bin #fails every time bc idc bitch move. you wanna get fed or not damn.

35 notes · View notes

antiqua-lugar · 4 months

Text

does anyone else have this thing where everytime they have to pause and check they wrote "uldred" instead of "wyll's dad". my mind just going like wyll is my friend irl so he might be archduke ravengard to the world but to me he only exists as wyll's dad. going up to him in camp like "good morning mr ravengard, can wyll come play with the dragon today"

#mr. the blade #gale's mom #i mean it's the same with gale's mom and shadowheart's parents #do I remember her parents name? no #i remember morena but I also have to keep checking myself to not be like #bg3 #antiqua plays bg3 #i beat the companions have this problem for sure tho #like gale going hey astarion go tell wyll's dad dinner is ready #also they would probably forget everyone's surnames because they almost never use them #at some point someon calls uldred mr the blade and there is no coming back from that #tbh shadowheart also does not remember her parents name

14 notes · View notes

dearmrsawyer · 3 days

Text

sawyer was sick over the weekend so we got some blood tests done and it turns out she is diabetic, she stayed at the vet a couple of nights, it was really strange to be alone in my room those nights. i spend more time with her than anybody. then we were supposed to pick her up thursday morning and they said to come in the evening instead because her glucose was v low. the vet asked me to find a glucose sensor to bring with me that evening, it was a public holiday so i had to find a pharmacy that was actually open. when we went to get her we waited 90 minutes and the sensor was being weird so they said come back later. finally brought her back home at 11pm and the sensor still wasn't working, had to go buy another sensor and bring her back this morning to switch them out, had to leave her there for a few hours so they could switch them and make sure the new one worked, then come back in the afternoon. i've had like no sleep at all this week, its a miracle i kept my eyes open to get training to give her insulin. she's so much better since she came home, even though she's not stabilised yet she very clearly feels heaps better ❤ it was such a relief to have her sleeping on my bed again last night. i was still up all night because i felt like i needed to keep an eye on her because i didn't have the monitor. we'll be in and out a lot over the next couple of weeks while they fine tune her dosage and monitor her levels.

#i want to know when i get a break #had planed to use this week to catch up on the prof development course i enrolled in months ago that started the day before nonna passed #i hoped it would be a chance to really apply my mind to something because i feel like my brain is utterly degenerated #after the time i took off this week for this i won't be able to do any of it before it closes i'll just have to download the modules #and read them in my own time without doing any activities/participating in discussions #have to keep canceling my dental check up because things keep coming up #i've also spent the last few weeks trying to link my online tax account to my government services account but it says all my info is wrong #no matter what i give them #what do i need to do #my life updates are so miserable. i delete so many of the posts i start because they just depress me #i deleted two earlier this week #feel like i need to get something out so i keep coming back to try #i still haven't asked hr about whether we have that counselling service thing because i keep forgetting bc i always have so much to catch u #on #i'll try to remember to do it next week #tp

9 notes · View notes

rohirric-hunter · 29 days

Text

.

#i mean obviously im disappointed as well that lotros down #but like. the entitlement??? of the people on the forums?#i keep going back to the forums to check for updates and i keep seeing people swearing theyre not gonna renew their vip #which i mean. it shouldnt upset me this much because ill bet anything that they will anyway #but theyre saying this because its down for one day? one day?#its up and running the other 364 days of the year but ONE day of unscheduled downtime and the sky is falling #these people would not have survived in the early days of the internet #remember when you couldnt be on the internet if someone was on the phone?#these people would not have survived before the internet #when in order to be entertained you had to *gasp* go somewhere #that was only open at certain times and on certain days #the internet is bypassing natural selection. this is bad for us as a species #i think in a few days im gonna make a post that will piss so many people off #about the fact that there is so little lag in this game actually #anyone who complains about constant lag doesnt know to troubleshoot their computer or isp #because the issue is basically always one of those things for me #(i just want to piss people off because its the same people you know.)#(they complain about lag and other things outside of the devs control constantly and then also threaten to cancel their vip constantly)

7 notes · View notes

hailsatanacab · 2 years

Note

so good to see cetbwa back! here are some fun little memes to celebrate your return!

thanks for the chapter!! love to see it

and i did not forget it was september i was not surprised by an update no sirree

Welcome back everyone, it's angst time!! 🎉🥳

for chapter 11 of cetbwa, thank you!!

#danny phantom #dpxdc #batman #danny phantom crossover #close enough to be whole again #cetbwa #tellmeabtspinos #hey look i actually remembered to tag you without doing anything rambly tags first!!!#this will never happen again haha #HEY HI HELLO TO YOU #i must admit it was very hard for me to sleep last night because i was too excited to see what you'd do with the chapter #and i woke up stupidly early - had to keep turning over and being like 'no get some sleep! you cant check yet!'#hey just a quick aside did you know that the comma to split up tags counts in the character limit???? isnt that fucked?#back on my bullshit with stupidly long tags haha #ANYWAY SIR YOUR MEMMEEESSSS LOOK AT THEM #my absolute favourite #that made me laugh so fucking loudly #was the pingu one (is it pingu or just a penguin? idk its funny tho)#i tell you the show is so stupid and childish on the surface level but if you actually think about what they go through #its all so fucked up #guess thats why the phandom loves it so much haha #the tom cat one - it was all going so well! there was so much laughter! and just like normal vlad comes along to ruin it haha #and the 'this is fine!' one!!!! would you believe me if i said that in the original version of this chapter (and version 2 as well!)#it was a way happier ending and everything was actually fine??? danny leaves the dining room filled with hope #and the certainty that he's going to tell damian because damian doesnt know about ghosts and danny can control the narrative you know?#like he was almost giddy with that happiness - knowing that he has a chance to be part of the family here #why would they hate ghosts?? they could accept him as he is they really could!!!#he's almost like excited to finally get it out in the open - and he plans to tell dami first and then bruce and then play a few pranks #on everyone else #oh gdi tag limit shit fuck THANK YOU FOR THE MEMES ILYSM I HOPE YOU ENJOYED THE CHAPTER THANK YOU THANK YOU TYSM ILY

153 notes · View notes

juriyuna · 2 months

Text

people who follow 500+ blogs terrify me. how can you keep up with all of that? how do you even catch any of your mutuals' posts? how many times a day do you take psychic damage from people reblogging cursed things onto your dash

#for reference i have never followed more than a couple dozen blogs at a time #(maybe back in 2011-2014 i followed 30-50??? but it's been so long i don't remember)#i keep my dash fairly slow-moving and just make the rounds to check in on various blogs i like instead #which... i guess is the point of following people but. y'know #i need a new personal tag

8 notes · View notes

greghatecrimes · 3 months

Text

also p.s. if i'm quiet for a few days it's nothing personal. i'm probably just resting. moving & new job & new place & getting out of crappy situation really sucked the spoons outta me

about + tag list + pinned post here

#personal #i feel a giant adrenaline crash coming on #probably no one cares/would check but at this point this blog is kind of like a journal? sometimes i write things here just for myself #so i can look back and read them when time has passed and remember where i was at that point #this is one of those 'just for myself' things. this is a big time in my life. i don't keep a handwritten diary #so this blog is kind of like a selected journal for this part of my life #and what i'm hyperfixated on at this stage of my life #and why it's important to me #to past and future anya: we deserve to rest!!!! we will learn how to rest

9 notes · View notes

jils-things · 4 months

Text

memoryshipping x studio ghibli: the masterpost ✨✨

see them separately: (x) (x) (x)

no need to rb!

#damn dude... what a movie does to a selfshipper....#im very proud of these - because i figured out a nice filter for these edits #for those who're curious - i used gaussian blur + bloom + faded frame or whatever it was called in ibispaint and ofc the vhs effect #and i totally intended to make the VHS effect a combo of purple and green since it was an option available AHEHEHEH #i honestly... really like how i drew stevens back view 🥺🥺🥺🥺 like it looks so.#attractive?????? is that the right word? it just looks really nice to look at from behind #i tried to make sense with his hair and i think it worked well here #jaides hair is so POOFY AAAHJCCKCK shes so pretty 💚💚💚💚💚#okay guys who wants the air walk raise your hand SLASH J SLASH J DON'T ACTUALLY PLEASE #I AIN'T DOING AN AU HERE BECAUSE YOURE BASICALLY SAYING YES JAIDE SHOULD BE A GRANDMA AKSKDJSBDHJSJDJSJSJS #yk im so tempted to do a little... directors cut here but itll be so LONG 😭#i literally havent seen this movie in ages i only saw it once but my sister is such a big fan of the movie and she checks it often LOL #but now after watching it again recently im like #alright i kinda get thr appeal now AJSHSHAJSBSHS #tho i regularly listen to the ost (THE OST IS LITERALLY ON THE STEVAIDE PLAYLIST AND NOW IT HAS MORE IMPACT ON ME LMFOAJDHSHA)#i know i keep saying this. but. howlsophie = stevaide ufghgg 😭😭😭😭 i never saw this coming #WEEEGHH IM TRYING TO PUT IN ALL MY THOUGHTS HERE BUT I CANT REMEMBER #IM ALREADY DOING A DIRECTORS CUT AKAKSKSJSJSJSJAJ #YEAH ANYWAYS YAY MEMORYYYYY #♥️ memoryshipping #~ art

15 notes · View notes

carefulfears · 10 months

Note

Remember how Mulder was thinking of peeing in the Tropicana bottle after drinking it all because he didn’t want to leave his spying spot, he’s my favorite little weirdo dude.

😭😭 he’s such a babe. that’s my Favorite sequence in arcadia. even before i got this episode, i loved that sequence. the way that his entire investigative strategy is just to fuck around and find out. the way that it’s also his entire strategy with scully. i’ve said this before, but sometimes mulder is annoying as a result, and sometimes he’s annoying as a goal. in arcadia, he had a goal.

#do y’all remember when i answered a question about why he ditched scully’s wine and cheese ‘consorting’ in ‘detour’#and i said that there is no world in which he sits and has wine and cheese with her because he HAS to go check for monsters #and that the universe is constantly reinforcing that and saying: you’re right. you can’t stop.#because there are always monsters wherever he looks #yeah something about him sitting there in front of that window all day #contemplating peeing in the orange juice container so as to not give up keeping watch for even a Moment #and overriding that instinct and coming back to see that the mailbox is fixed and he missed it #just reminds me of that #🤷‍♀️🤷‍♀️#anyway that gag is my favorite of the episode it kills me #asks #arcadia

17 notes · View notes

aalghul · 2 years

Text

I’m actually always going to be angry that Damian being drawn somewhat less white (and only occasionally) came at the price of him not wearing the Robin colours anymore. Get that ugly grey off of him. He’s Robin. The Robin. He should get the colours, the name, the city, the faith, everything. While being consistently portrayed as non-white. he’s Robin, dammit, not some largely unknown character with no relevance to the main Bats.

#still pissed that Tim gets to go back to those colours despite 20 yrs of it. the white boy gets robin AGAIN and Tom Taylor calls him #‘the best robin’ all the while it’s actually DAMIAN who’s robin right now. DAMIAN!!!#Damian al ghul!!! He is Robin!! does dc remember?#or are they going to keep him out of gotham still because *checks notes*#‘he’s discovering himself’…why did dick and Tim get to do that AS ROBIN with BATMAN in GOTHAM #but it’s too much to ask with Damian? oh fuck off. It’s so transparent

302 notes · View notes