Tumgik
#Message for a specific verse!
tomhiddleston · 1 year
Photo
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
sorry did someone say 215+ screenshots of miguel??? (i put ‘em on my dropbox in case you beautiful heathens want ‘em too)
89 notes · View notes
erikahenningsen · 1 month
Text
It really is so personally tragic to me that every clip of Mean Girls in DC looks like this
Tumblr media
7 notes · View notes
nulltune · 1 year
Note
hakuno has received ... an egg!! that's right, this fragile-seeming, half-phantasmal pod that was nevertheless large enough to take two arms to lift and hold ... was absolute proof that anybody here was not human. a black fog rolls about in the murky, semi-opaque shell, like thick wildfire smoke encased in lighter cigarette fumes. was that nothingness drifting about the center an embyro? regardless, it was up to hakuno to decide what to do with it now. nobody would have blamed her if she handed it off to the authorities in the manner of a dutiful citizen, (after which, it certainly might not see the light of day ever again,) or fed it to a snake just to see what might happen. the enormous pool of blood is quite telling of an unfortunate mishap as well, yet the egg says nothing, its inhabitant fast asleep and subdued. who knew when it might wake up and be born again? who knew what, or even who, it would be born as, into?
unprompted,  always accepting !   @tenkoseiensei  ♡
there had been no issue in transporting the item to her quarters,  though to the unassuming they'd think it to be a workload ill - suited for a lady of her stature,  the size of it merely obscuring her sight,  but such a thing didn't matter when one had the route to their destination memorized perfectly.  there was no delay to her movement speed,  nothing particularly of note.  if anything,  it was the blood that was ...  unpleasant.  ultimately,  it was inconsequential,  but it lingered in the back of her mind faintly.  the scent of iron,  the knowledge that it must've stained her clothes,  it was so much.  that amount must've resulted from—
the plastic bag tied to a close,  the red color on the fabric still prominent against the translucent material, and hakuno tosses it into the bin.  she washes her hands afterwards,  a sigh coming from her as the water runs clear.  her mind is similarly calm,  no longer distracted by what shouldn't have taken that much of her time,  she returns to the task at hand.
temperature,  humidity,  gaseous environment  —  verified.  it is unclear what stage of incubation the egg is at this moment,  but these conditions should be ideal ...
❛   if there is anything not to your liking,  please let me know.   ❜      she blinks at her own voice,  uncharacteristic for her to speak when alone,  thoughts kept all to herself without an issue—  but,  oh.  vacant eyes turning to the egg  ( carefully kept in an impromtu and specially made area ) ,  cool caramel eyes blink once more.  to already be recognised as a presence by her should signify a sign of life;  at the embryotic stage,  at the very least. 
this was something she should've confirmed at the scene where she'd first stumbled upon it,  but even she could've picked up on the vague sense of a lingering threat.  ‘ instincts ’  had seemed to kick in at that moment,  and although bringing along this large egg was not the ideal choice to make in such a situation,  the thought of leaving it behind was out of the question.
and now that the two of them are within safety,  it seemed that she was able to speak with more ease;  that was the logical conclusion to be made,  anyway.       ❛   do you know what it was that caused that—   ❜       recalling that sight,  hakuno's mouth briefly presses into a thin line.       ❛   —blood spill ?   ❜       it may be out of her field of concern,  but she'll look into it.  though at this moment,  first priority comes to  ...  her guest.
it is ...   what is it,  exactly ?   it looks somewhat ominous,  if she were like a regular person  /  human,  perhaps that would be the conclusion made.  with how she is though,  she merely accepts that as an aspect of this creature  —  the murkiness of its shell covering what lay beneath,  she wondered if it was hiding.  idle thoughts don't last long,  thoughts turning to trying to find out just what this embryo was  —  as it was right now,  she'll have to make do with what little she knew and ensure that the conditions were right for its sake.
it's unlikely.  but,  the possibility of—  being able to hear the sounds and noise of the world around you,  being able to hear everyone,  yet to be unable to utter a single word.  that is ...  so unbearably lonely.  taking a seat next to it,  she faces forward in the same polite way of sitting,  hands folded neatly by her lap.  though her side gaze lingered upon the ..  individual.        ❛   i apologise,  if you are speaking right now,  i'm afraid i cannot hear you.   ❜       what is she even doing ...  well,  to bombard the egg with questions in the first place was odd.  ( not to mention,  rude .. )       ❛   if you would like,  please feel free to speak as much as you'd like when i am able to listen.   ❜
shifting slightly in her position.       ❛   and,  if you have the intellectual capability for it in the future,  please do tell me what it's like—  to be born.   ❜       how curious,  even without any ties connecting the two,  hakuno found that the outcome of the egg perishing was incredibly  ...  unsatisfactory.  could this be the miracle of a life ?       ❛   i wouldn't know.   ❜       i was made,  after all.  whether her creation brought  ‘ joy ’  or  ‘ sadness ’  or maybe nothing at all,  she wouldn't know.  it doesn't matter.  not anymore.
eyes crinkling just a bit,  hakuno resists the urge to pat the egg  —  contact is unnecessary,  lest she do so to turn it for the sake of the incubation process.  instead,  her mind wanders within her still frame.  who are you ?   what are you ?   even without the answers,  she tilts her head to face it fully,  a vague flicker of warmth in the still pools of her eyes.
❛   you have a long life ahead,  i hope you may soon hatch to live it.   ❜
6 notes · View notes
happi-tree · 10 months
Note
nature is healing, cute, cool dice related to cool dice (maybe?) I have mentioned recently that I'm neutral on k-pop but I saw you mention dreamcatcher and immediately went to listen to some of their music. Seems like a really cool group and such nice outfits. I love BonVoyage :]
Lessie!!! Hi, there, lovebird 💚💚💚 Thank you so much for the ask!!!
Tumblr media Tumblr media Tumblr media
First off ty my socks ARE cool they've got little cat faces on them :3c Secondly you're also absolutely invited on that group hike I mentioned!!!
And thirdly I'm very happy that you enjoy what you've heard of Dreamcatcher so far!!! They're my absolute faves and I adore their sound. Bon Voyage is one of my favorites of their newer releases :DDD
4 notes · View notes
stormbcrn · 11 months
Text
my friend is visiting for a couple days! queue will be running, but i'll probably wait to respond to any ims until the weekend. hope everyone is doing good!
1 note · View note
planisphaere · 2 years
Text
consider this a threat short starter call! like & specify or it’s gonna be Jin Ling 
11 notes · View notes
mslangermann-a · 2 years
Text
OOC. *points to previous post* like this post for a medieval verse starter :)
2 notes · View notes
glambytes · 2 years
Text
Tumblr media
@glamserve​ sent a transmission!
      ★ for whomever works best for you, xoxo.
Tumblr media
⇒ How does my muse feel about yours? | accepting!
Tumblr media
      ♡ ◦  Stella and Mangle
I like you // I love you // You’re one of my best friends // You’re like family // You are family // I dislike you // I hate you // I’d kill you if I got the chance // I want you to like me // I’m scared of you // I would adopt you // I’d date you // I’d sleep with you // I’d marry you // I’m worried about you // You confuse me (a NICE technician? even if she’s part-time? sounds sus) // You’re annoying // I pity you // I respect you // I trust you // I feel protective of you // I’d invite you with me to parties // I’d lend you my money  // I’d borrow steal your money pizz.a.plex security pass // You’re good-looking // I’m suspicious of you // I’m hiding something from you  // You’re fun // You’re boring // I’m upset with you // You’re nice // You’re mean (mangle wishes stella was meaner just to have a better excuse to dislike her 👀💦) // I’m envious of you // You’re smart (and cunning, all technicians are >.>) // You’re stupid // I look up to you // I think you’re a better person than me // I think I’m a better person than you // I want to apologize to you // I wish I’d never met you // I never want to forget you // I want to get to know you
4 notes · View notes
hellsitegenetics · 3 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes
technicolorxsn · 2 years
Text
thinking abt shouji rei
0 notes
veiliisms · 2 years
Text
shakes the dash. something something teenage au starter call >:)
1 note · View note
wood-white-writer · 8 months
Text
"Didn't mean to make your heart Blue" || [5/...]
Tumblr media
“Where I'll be looking in their eyes when they're down, I'll be there on their side. I'm losing by their side.”
— Mitski, "Bet On Losing Dogs"
Pairing: Buggy the Clown (Live action) x F!Reader
Part 1 | Part 2 | Part 3 | Part 4 | Part 6
Summary: You were an apprentice of Gol D. Roger’s crew in your youth, long before his eventual demise. Along with the Red-Haired Shanks and Buggy, you were a formidable trio; the embodiment of a new generation of pirates yet to come. But times changed, and so did you and your friends. 
It's been a few weeks since the events in Orange Town, and Luffy notices something that others do not. So, he decides to ask you.
Warnings: Canon typical violence, LA!Verse, No (fully bodied) Buggy this chapter, Luffy being the precious cinnamon we all love and must protect above all else, flashbacks about Shanks, past discussions, Luffy and Reader have a heart-to-heart.
A/N: I was initially going to write them going to the Baratie this chapter, but it became too long so next one for sho.
Taglist:@kurinhimenezu, @carpinchootaku, @ay0nha, @teh-vampire-bunny, @lokiscure, @internationalsuper-spy @detectivesparrow , @yuriwk, @notyuralycat, @angeli-fucking-cat, @machinema7k (If you want to be tagged for this story, just send me a message or leave a comment :))
You're sitting by the table in Party's bar, nursing a cold glass of rum against your cracked lips as you observe to the kid - Luffy - demonstrating his newfound Devil Fruit powers without any regard for poor Makino's furniture. 
You don't get him, at all. Then again, you don’t get kids. 
You've never thought of yourself as someone who easily got along with them ... or people in general. Shanks has always been the better-suited one for that kind of work. Whereas he is smiling and grinning at the kid’s mischief, you've barely offered him more than a glance at most.
Your crew has been positioned in Foosha village for the better part of the month, stacking up on resources and food in preparation for your next job. Incidentally, the Red-Haired Pirates also happened to be in town for similar excursions. You rarely see Shanks nowadays since you parted ways several years ago, but whenever you happen to come across one another, you share a drink on his tab.
While your crew is around and about, replenishing their strength and vigor for the work to come, you're content with just sitting here at your leisure. When you're not plundering or fighting or attacking Marine bases, you can't find it in yourself to do much of anything anymore. 
Nothing adds any purpose to your life save for what keeps you fed and clothed, which in the life of a pirate, simply means pirating.
"I've heard you had good fortune on your latest heist," Shanks says from where he's sitting opposite of you. "For your efforts, the Marines have granted you among the highest bounties in all of the East-Blue."
You hum noncommittally in response, not offering much to the conversation in terms of merriment. "The quality of the Marines has been in decline. It says more about their effort, or lack thereof, than mine."
"Do you know what they call you nowadays?"
"They call me a lot of names, you got to be more specific."
"'Cross-Hairs, the Beast of the East'. It's got a certain ring to it, don't you think?"
"Sure."
Shanks smiles the kind way he always does. Always has done.
"Gum-Gum Pistol!" 
The sound of yet another chair breaking has you rolling your eyes without even looking, and poor Makino ages ten years in seconds across the bar counter. 
"Luffy!"
"Sorry!"
Shanks laughs heartedly at the display, only to cut it short upon noticing Makino's even glare sent his way from across the bar. 
"You were careless," you state matter-of-factly and take another gulp from your drink. "You should've kept the fruit hidden more securely."
"Now, in my defense, I didn't think the lad would searching through my loot."
"Well, you should've." You slam your glass down, strong enough to leave a dent in the wooden surface. "What kind of captain leaves his loot undefended and unsupervised? Especially when it contains a Devil Fruit?"
Shanks doesn't argue with your statement and settles with taking a gulp of his own drink, letting your words simmer in his head. "You're right, I should've been more observant. Now, it'll be more difficult for him to achieve his dream."
"His dream? Of what? Becoming the King of the Pirates?" Try as you might, there's no suppressing the snort that escapes through your nose. "There's only ever been one King, and we all saw what happened to him. What do you think is going to happen to a kid who can't even swim?"
"Oh, come off it!" He gives you a playful nudge to the rib, which you reciprocate with a glare. He remains undeterred. "You mean to tell me you've never thought about finding the One Piece? Not even once?"
"I have no interest in whatever plunder Gol D. left behind." 
"Then, what does interest you?" He rests his elbow on the edge of the table and leans over to your side. "What is your dream?"
You grit your teeth under your lips, a flash of blue circulating in your head. "Dreams are for fools and children," you point your head to where Luffy is currently sitting, trying to put the chair back together with a half-empty tube of glue and little luck. 
"Come on, I know you better than that. Surely there's something in this world you want more than anything?"
"What I want is ..." You have half a mind to tell him the truth, whereas the other half wants to push the idea further down to the bottom of your chest. "Is another bottle of rum."
You raise your arm to Makino to gesture for another one, but Shanks is quick to lower it with a gentle shove of his arm. You flash him a scowl and brush off his hand, but unlike your crew or anyone else, he's not afraid.
"The point which I'm trying to make before you're completely pissed," he starts. "Is that no matter how much opposition one faces, it's that dreams are never out of reach if you have the will to reach for them."
He inclines his head over your shoulder, and you turn around to see Luffy successfully putting the chair back together. You don't know how he did it - it looked pretty busted minutes ago - but there it is, wholly intact.
And when the boy smiles, it's so vibrant and full of joy that it's almost blinding. He proudly runs over and shows the repaired chair to Makino, who proceeds to pat his head and hand him a plate of food.
"See?" Shanks grins. "Nothing is impossible."
"You can hardly consider putting a chair back together the same as achieving an impossible goal."
He shrugs. "Maybe not, but you won't know unless you try. All it takes is a little spirit."
You watch Shanks for a couple of minutes in silence, processing his mythic words, then shift your attention over to Luffy who's preoccupied with shoving an unholy amount of food into his mouth. If this is to become the future King of the Pirates one day, then it'll be an interesting future indeed.
"A little spirit, huh?" 
— — —
You're sad.
Luffy first notices it when you leave Orange Town, and it lingers throughout your voyage. 
For as long as he's known you, you've always been a person of relatively few words; never speaking unless you feel the situation requires it, and only acting when necessary. Even following the Kuro situation™, getting the Going Merry, and adding Usopp to his crew, he can tell that you're not all there anymore.
Not to be mistaken, you're not conspicuous with the way you behave. You still act like usual, talk like usual, however little, and commit yourself to your work on the ship, almost to an excessive extent. 
All in all, nothing’s changed about you. However, he’s gotten used to your face and general lack of expression most of the time, and though it doesn't seem to alter, he still catches onto the fact that you're sad. 
"Hey," he asks the group and props himself in the kitchen, legs crossed atop his seat. "Do you think she's any different?"
"Who? Your friend?" Nami asks, raising an eyebrow. "How so?"
"Well, I think she's sad."
"Doesn't look any different to me," Zoro supplies while polishing his swords on the table. 
Usopp's in the middle of munching a piece of loaf, and answers with his mouth still halfway occupied. "Dunno how she usually is, but she's kinda terrifying if you ask me."
"No, she's not," Luffy dismisses lightly. 
"What's her position on the ship, anyhow? How'd you come across her?"
"She's always been with me," Luffy answers without any thought. "And she’s a good fighter.”
Zoro — to everyone’s surprise — nods his head to this in concurrence.
Their Captain claps his hands together to get the subject back on track. "But anyway, I just think she seems kind of down now."
"How can you even tell? With eyes like these, —” Usopp puts both of his index fingers at the crow’s feet of his eyes and draws them back to imitate yours. It’s borderline shameful, truth be told. “— I can’t tell for shit what she’s feeling or thinking.”
“I just can.” Luffy shrugs.
“Has she said anything?” Nami asks. “Anything to make you ask?”
“No, not really.” He heaves a sigh and props his hand under his chin, contemplating. “But she's been different since we left Orange Town.”
"If you ask me," Zoro speaks up. "You should ask her about her relationship with that fucking clown."
"Who? Boogie?"
"Buggy," Nami corrects. "Didn't you notice that at the end? They have a history, it's obvious. They know each other, and I don't know what pirate customs are like nowadays, but I doubt you'd touch the face of an enemy unless there was something going on. Has she said anything about it?"
Luffy shakes his head. “No... but then again, she never does tell me much about anything unless I ask.”
The tangerine-haired girl blinks as if the answer to this whole predicament is obvious. She quickly comes to realize that, to Luffy, it’s not.
“So…” she prompts slowly.
“So…?”
She rolls her eyes at his inability to catch her drift. “Go ask her.”
It’s like the thought never even crossed Luffy’s mind in the first place because truth be told, it hasn’t. He lights up like a candlestick on the spot. “Yeah, I should just ask her!”
“Ask me what?”
The members of the Straw Hat pirates (save for Zoro) withdraw in various unique positions, having not heard you make your entrance before you speak. 
You’re standing in the doorway to the kitchen, eyebrow slightly quirked at the Baroque-esque scene in front of you. Deciding not to address the display, you simply ask, “Anything I should know about, Captain Luffy?”
Usopp doesn’t even dare to answer, because he knows you sure as hell don’t see him as a captain in general, much less your captain. He swears he notices you briefly look in his direction at the mention of the title, and a shiver runs across his skin. Like static electricity in the air.
“Oh, yeah,” Luffy turns to you, not an ounce of fear in his eyes as he pops the question. “Are you sad?”
You blink once, then twice, like the inquiry on its own is of unfathomable origins to you. “Do I look sad?”
The boy in the straw hat nods. “I think you do.”
“Then I’m not.” It’s not only an answer, but also a sentence that marks this subject as finished on your part. One that does not permit any subsequent additions.
You incline your head to the deck above. “We’re going to have company soon, likely Marines, and they seem to be in supply of heavy fire this time.”
———
The situation with the aforementioned opponents temporarily distracts the crew, yet Luffy maintains a close eye on you, taking note of anything that can point him to the source of the unknown problem. You talk relatively little with the other crew members, but you seem to have developed an amicable enough relationship with them compared to when you first met. 
Before, you could care less about getting to know them. Now, you’re actively going out of your way to ask Nami about her cartographic skills, even giving her tips for additions to her geographical detailing. You provide Zoro pointers on self-developed defensive techniques and ways to paralyze opponents in certain spots (which he seems appreciative of).
You even give Usopp a short nod when he tells you one of his fantastical stories, even knowing that they’re full of shit.
Luffy’s happy, but he still sees that you are not.
It’s all in your eyes. They’re hollow somehow, like the end of a barrel. He doesn’t know how he knows, only that he knows, and he’s known for a good while now.
So, that night, Luffy finds you in the kitchen by the windows, absentmindedly snacking on a red apple while you gaze into the dark nothingness outside. He also discovers that he’s subconsciously become quite observant of your habits as of late. 
For example, you specifically pick red apples above any other color when they happen to dock someplace, not even paying any mind to the green or yellow ones. Just the red ones.
“Hey,” he positions himself next to you on the bench, a piece of loaf tight in his hand. “Why are you sad?”
You turn your head just a fraction to the side to look at him, not annoyed, but not appreciative of the focus he’s settled on as of late. "Shouldn't I be asking you that? The Vice-Admiral looks a little weary as of late, after all. Are you sad about it?"
"Nope."
“So why do you insist that I’m sad?”
“Because you are,” he states like it’s obvious.
You huff humorously and return your attention to the window that supplies no real view. “How can you tell?”
“I just can.” He takes a generous bite of his food and continues talking, oblivious to the crumbles that fall while doing so. “When I’m sad, I—”
“Eat?”
“Well, yeah.” He swallows the bite down. “But I also like to talk about it with someone I trust. Shanks used to say that true friends are the kind of people you can share your heart with and not get hurt.”
This annoys you, that much he can tell. A nail digs into the apple you’re holding, leaving a crescent-shaped indent on the red skin. “Shanks said many things, and not all of it's true.”
This doesn’t deter him from pressing on the matter. “If you keep all the hurt inside, it’s going to turn bad. You know, Makino said that if you leave a piece of ham in the fridge too long, it’ll get sour and people can’t eat it.”
“Only you could find a way to compare this sort of thing to food.” You withdraw your finger from the apple and end up leaving it alone altogether. A minute or ten of silence waves between you, laced with unspoken questions and denied answers. “Tell me, Luffy, just how much did Shanks tell you about his past?”
He thinks for a moment, mimicking your movements by putting his loaf aside. “Just about his adventures with the Red-Haired Pirates, and a little about the time you served with him. Is it true you were strong enough to throw a three-hundred-pound man to the ground when you were thirteen?”
He swears it’s a snort that he catches leaving your throat, but it’s hard to differentiate it from your more-than-usual scoffs. “He exaggerated.”
“Really?”
“The man was two-fifty, at most.”
Luffy grins with genuine admiration, so much so that your face tilts back slightly, being overwhelmed by the mere brightness that is him. “Wow! You must’ve been quite a beast when you were a kid!”
He notices it again, the sadness that latches onto your eyes like insects to sour meat. Whatever brief smile adorned your lips moments ago disappears like it was never there at all. Thinking he said something wrong, Luffy prepares to apologize when you speak again.
Your voice is soft yet faint like you’re afraid speaking too loudly will make something bad happen. “It wasn’t just me and Shanks, back then, you know.”
The Captain of the Straw Hats thinks it’s almost unnatural of you to be this demure, but he doesn’t interrupt you.
“Buggy was there, too. It was the three of us, together.”
“Oh, yeah.” He remembers it now. “He did mention that in Orange Town. You served the same crew.”
“… He did, did he?”
“He said you and Shanks betrayed him, but I didn’t believe him.” Luffy knows you and has known you for longer than he’s known a lot of people in his life. You’re one of the few permanent people he’s had, and he knows with a certainty that you’re not the kind of person who leaves anyone behind, not without reason. 
Even if you did have a reason for leaving Buggy, it must have been a good one.
Your mouth opens and shuts several times in the span of a minute like you’re hesitating to talk about the past. You’ve never been one to talk about it, except to share some details about your time as captain, and even that was limited to the bare minimum.
Still, Luffy, being in no hurry for you to reach an answer, waits patiently by your side until you do decide to talk about it.
Talk about what he believes is the reason for your sadness.
“We were close back in the days,” you begin slowly. “Me, him, and Shanks. It was us against the rest of the world, and we were going to sail together to the end of the seas one day. It was our dream.”
“Then, what happened?”
You put your palm over both your eyes and rest your elbow on the window frame, heaving a sigh that resembles someone who’s spent too much of their life working and working and working without catching any breaks. Pure, simple exhaustion weighs you down, Luffy can tell. 
When you speak next, you sound tired too, and perhaps a little strained. He can’t see your eyes, and so, he can’t truthfully tell what you’re thinking now. “The thing is, I don’t know what happened. All I know is that he decided he didn’t want to stick around.” You breathe through your nostrils. “Our captain was gone, and so was the crew, but we three were still together, and I thought we were going to stay together.”
“But you didn’t.”
“No … We didn’t. I don’t know what happened, but one day when I was talking with Shanks about what to do next, Buggy came in, and it … He looked at me like … Like he hated me.” You exhale. “He did hate me, and I don’t know what it was I did, but he practically told me that we were done … And then he left. I never saw him again, up until Orange Town.”
Luffy doesn’t require your eyes this time to tell that you’re sad now because you are. You’re so sad that it’s destroying you from the inside, and even that is an understatement on its own. There are no tears trickling down your cheeks, no quivers or thickness to your voice, no nothing to base his assumptions on, but he knows.
He stays silent for a short while, doing nothing but look at you. You’re one of the strongest people he knows. He’s seen you fight; seen the strength you possess, the fire in your eyes. You’ve stayed with him ever since Shanks left Foosha Village, you’ve looked after him from the sidelines when you thought no one was watching. 
You’ve been with him throughout everything, and seeing you like this makes him feel blue on your behalf. You don’t express it yourself – you never do. You carry your weight with the same kind of strength you always do, never letting anyone see you beyond just that, and sometimes, he wonders if you’re lonely because of it. 
At least, now he knows why you’re so sad. You’re heartbroken.
He’s never been acquainted with the feeling himself, has never felt any particular inclination toward it, but he can tell it’s your heart that’s hurting now, and it’s not as easy to heal as that cuts he received on his chest from the butler.
His hat seems to itch the harder he thinks about it, as if there’s something digging at his scalp through his hat. He thought Nami patched it up for him. He tries to scratch at it, but for some reason, it doesn’t cease. Maybe he’s got lice? 
He ignores it. “It’s weird. Bunky seems to think you were the one who left him for Shanks.”
“I didn’t.”
“I know. You’re not that kind of person.” He says it so easily, without a smidgen of doubt or hesitation. You look at him through your peripheral vision, and your eyes slightly widen at his statement. “But, do you know what happened between them? Shanks and Bonky, I mean?”
“No, I don’t.” You admit with a shake of your head. You’ve tried to figure it out for years, and at some point, you decided to give up. “Shanks never told me, but whatever it was, it was enough for the stupid clown to leave for… He chose a childish rivalry over me.”
“Then, there you have it. It’s all just a big misunderstanding, so why don’t you just tell him if you meet him again?”
“You seem awfully defensive of the guy who destroyed an entire village and almost drowned you.”
“Yeah, but talking about him seems to make you happy.”
You freeze for a bit, snort, and turn your back to the window frame, leaning back and crossing your arms across your chest in silent resignation. “I tried to explain things to him back in Orange Town, and a fat load of good that did. Like I said, he hates me, and he’s sure as hell not my favorite person at the moment. If we do meet again, it likely won’t end any better than it back in Orange Town.”
“You know, –” Luffy takes another bite of his bread. “It didn’t sound like he hated you.”
“Hmm?” You raise an eyebrow, halfway curious and halfway skeptical. 
“He still remembers that you like red apples and that you hide knives in your shoes. Is that true?”
You raise both your eyebrows and look at Luffy like he’s just grown a second head. Without a word, you pull your left foot up until it rests on the bench, and withdraw not one or two knives, but four. Small and subtle, hardly enough to turn any heads, but in a flash, you throw it across the kitchen until it lands on a specific spot on the opposite wall. 
Bull’s eye.
“We used to have knife-throwing competitions,” you reminisce idly, staring at the knife lodged deep into the wall. “I was good, but Buggy was better.” Your lip tilts up an inch or two. “We made bets, and whoever lost would have to steal a bottle of whatever liquor we happened to find in the next town we docked at.”
“Oh?”
“I ended up snatching quite a lot of bottles, but once every blue moon, he would have to snatch one instead.” You smile. It’s an actual, genuine, honest smile this time, and Luffy can’t help but marvel at the sight. It’s a rare thing for you to smile like you’re doing now. It’s usually brief or sarcastic and never seems to reach your eyes. 
This one does.
He thinks you look pretty when you smile. It’s your smile, and it’s so warm that he wishes you could do it more often. He tells you as much, and a red color falls over your cheek. You promptly turn your face to the other side to save face, and it makes Luffy think.
When he thinks about his dream of becoming King of the Pirates, he can’t stop himself from smiling ear to ear. So, that begs the question: “What is your dream?” 
What makes you smile?
“My dream …” You reach for your apple and hold it against your face, the uneaten side of it shining against your face. “Is unattainable.
“I don’t think it is,” Luffy says without missing a beat and takes your hand in his, determined to make you see that. “I think that no matter how much stands against us, dreams are never impossible if you have the will to reach for them. All it takes is a little spirit.”
He doesn’t know where those words come from, but he’s heard them from someplace, and judging by your staggered reaction, you’ve heard them too. 
“A little spirit, huh?”
“Exactly! So, please tell me, what’s your dream?”
You look straight ahead into the room, resting your elbows back on the window frame without a word. He thinks you’re about to decline his question or ignore it altogether. However, he’s surprised to hear you actually answer this time, truthfully too.
“My dream was to sail the seas with him again.”
Suddenly, the itchiness on his head stops, and it stays that way.
497 notes · View notes
here2bbtstrash · 2 years
Text
party on you (explicit)
Tumblr media
genre: SMUT SMUT SMUT with an extremely small side of fluff lol
pairing: hoseok x reader
summary: the only thing stronger than your social anxiety is your big dumb crush on hoseok - and you're certainly not expecting it when he tells you the real reason he threw this album release party.
word count: 9.8k
contains: explicit sexual content aka PORN !!!! idol-verse, literally takes place at the JITB album release party, friends to lovers, erotic hand holding, they're both cute and dumb, a studio hookup 👀 dirty talk, thigh riding, cunnilingus, a single pussy slap lol, taint touching (?), HOBI EATS ASS, multiple orgasms, overstimulation, throat fucking, reader gets a facial, and a lil bit of cum eating, it's cute 😌
A/N: so, hi, i went to hobipalooza lmao. this is actually lowkey a songfic ??? charli xcx was one of the earlier acts on hobi's stage and. my god. seeing her live was a religious experience, and when she performed party 4 u i was like hnnnhghg this should be a fic. and now it is !!!! and i hope u enjoy 🥺🥺 i tried some new stuff in here, both soft and freaky lmao so i'm nervy to share!!! as always your support and feedback means the world to meeeee ok ilysomuch bye~
read on AO3 !
~*~
Tumblr media
You collapse back against the cushions of your couch with a soft whine of distress.
The whole thing is really so ridiculous. You told yourself when this started that you could be chill about it. People get crushes every day. It doesn’t have to be a huge fucking deal. You’re a sane, rational adult, perfectly capable of admiring a man quietly from afar while doing your best to be a good friend to him.
And, yes, maybe also obsessing a little too much over what to wear when you hang out, and what to post on Instagram in case he might see it, and dear god, how long his hair is getting. All normal crush things.
But now, as you press your phone to your chest with both hands and sigh forlornly, you wonder if it might actually be possible to yearn yourself to death. To like somebody so much that your heart just fucking explodes. If anyone could be capable of inciting spontaneous combustion, it is absolutely Jung Hoseok.
And he wants you to come to his big fancy party– has specifically sent a day-of reminder text, like you didn’t already receive a formal invitation weeks ago.
You purse your lips, fighting to keep a smile off your face despite being alone in your apartment where no one can perceive you. Hoseok is always so good at keeping in touch, even when he’s in an insanely busy season of his life. You can picture him now, probably bustling around his place in a robe, getting ready while simultaneously sending everyone their own personalized message.
Everyone– when you last chatted about the party, he rattled off enough of the guest list for you to know that easily half the industry will be there tonight. And even Lizzo has gushed about how great of a texter he is. You try to ease yourself off the ledge with the comforting thought that this has to be just one courtesy text of dozens, his pretty painted thumbnails working overtime to send gratuitous emojis out to every idol in the city.
And somehow also to you. Because your big fat crush made you stupid enough to say yes to what is arguably your worst nightmare: A party full of cool famous people, where you will know no one except the guest of honor.
Skipping the party is not an option becomes your internal refrain as the hours tick by. You have to remind yourself of this even more emphatically when you wind up on the floor of your bedroom, having tried on every article of clothing in your closet and having decisively hated it all.
Skipping the party is not an option, you think again, grabbing your phone to check the clock. Your heart sinks when you realize how much time you’ve wasted being an anxious wreck– you had planned to be ready to leave five minutes ago, not laying half-naked on the floor, hair and makeup still undone.
But skipping the party is not an option. A pre-party cry, however, might be on the table.
Pushing yourself up to sit on your heels, you force the tears back while you aimlessly sort through a pile of clothes. You’re barely looking at what’s in front of you, but you pause to do a double-take as your hand passes over a particularly enjoyable texture.
When you manage to extract the item, you realize it’s a dress you’d forgotten about entirely– something a friend made you buy a lifetime ago that you’ve never worn because you’ve always been uncomfortable with how short it is. But it’s smooth baby pink satin, and as different from your usual as it may be, you recall not being mad about the way it stuck to your curves like water.
Fuck it. You’re already late, and if there’s ever a party where you can take a fashion risk, it’s one thrown by Hoseok. You can only imagine what he might have on tonight; it honestly wouldn’t surprise you if he showed up in the same fucking dress.
The thought of seeing him is enough to make your heart leap in your chest, and you do your best to speed through your usual makeup and hair routine despite the way your hands are starting to tremble. By the time you grab your purse and make it out the door, you’re thirty minutes late. That thirty minutes quickly stretches into a full hour before you’re stepping off the elevator onto the 19th floor of HYBE headquarters, feeling like an asshole.
Gorgeous idols and various other famous people stream in around you, dressed in clothes that appear casual but you’re sure cost double your monthly rent payment, looking less than unbothered about showing up late. You do your best to slip in unnoticed and stick to the perimeter of the massive room, feeling like an absolute fraud.
Thankfully it’s only a few steps before you find a table taken up entirely by pre-filled flutes of champagne, and you eagerly grab one, mostly just grateful for something to do with your hands.
It occurs to you how little you know about celebrity culture, because the party doesn’t even seem to have started yet: early 2000s R&B is bumping through the speakers, and it feels like every few minutes the elevator chimes to let another group of people trickle into the space. You find an unoccupied section of wall to lean against as you sip your drink slowly, hoping that if you try hard enough, you might actually manage to become one with the wallpaper.
Tipping your head back for another sip of champagne, you nearly choke at an unexpected voice from over your shoulder.
“You look like you hate parties as much as I do.”
You manage to not inhale your drink, instead giving a polite smile as your eyes drift across the crowded room. You’re too nervous to immediately steal a glance at whoever is speaking to you, though you’re sure it just makes you seem rude. “Hate isn’t exactly it.” You have nothing against parties, or people who enjoy them. “I just… haven’t figured out what I’m supposed to be doing, exactly.”
“I think talking to people is generally expected,” the voice quips. “So, hey, you’re doing great already. Keep it up and they might even think you’re an extrovert.”
You exhale a soft laugh, a slight heat of embarrassment creeping up your neck.
“But Hobi said I didn’t have to meet and greet if I didn't want to. So I’m taking that as full permission to enjoy free alcohol and read webtoons on my phone.”
Your gaze snaps over at the familiar nickname, and your mouth goes dry as you realize you’ve been casually conversing with none other than Kim Seokjin, who is absentmindedly fiddling with the thin green strap of the bag slung over his shoulder.
Fuck. Embarrassing yourself in front of random famous people was exactly what you were trying to avoid when you picked this wall to lean against. You’d figured the other members would all be out mingling in the center of things, not hiding in a corner. Who knew celebrities were just like you?
“I-I’m sorry,” you stammer, immediately dropping your gaze to avoid making eye contact when Jin looks up. He probably assumed you’d sidled up next to him on purpose, like some kind of creepy fan. “I’ll leave you alone, I actually really didn’t mean to–”
You glance up again only to realize Jin is laughing, shoulders shaking slightly.
“Wow, I’m so bad at this. That wasn’t me telling you to fuck off. I was just trying to sympathize.” He gestures lazily towards the stage at the front of the room. “Thankfully it looks like you don’t have to suffer my conversation any longer.”
A Jack in the Box graphic has started to flash, projected onto the screen. After a few seconds, the image stills, and a spotlight clicks on, following Hoseok as he emerges from backstage. You lean forward to set your drink on the closest table so you can join in the applause for him.
Hoseok looks as effortlessly cool as he always does, but even more so tonight, like someone has cranked his charisma up to the max setting. A real fucking popstar, a rockstar, even: baggy clothes, multiple layers of necklaces, chunky black boots, dark hair pushed back with a few strands falling into his eyes. He somehow even manages to make wearing sunglasses indoors look cool– probably because they’re immediately offset by the wide, sweet grin of his mouth as he addresses the crowd. You can hear that he’s nervous by how hard he’s trying to keep his voice even, and it’s enough to make you feel the flutter of butterfly wings in your throat.
As you pick your drink back up for another sip, you can’t help but wonder if Jin can literally see the hearts in your eyes, or a nervous little teardrop floating above your head like an anime character. You do your best to hide your smile behind your glass.
“J-Hope is pretty cool, huh?”
You bite down on your bottom lip, answering Jin’s question with a shy nod.
Hoseok descends the stage as the lights lower, and then the album intro is starting and there’s no more time for conversation. You watch from across the room as he drops down on the large built-in stairs next to Jungkook, who immediately wraps a supportive arm around his waist while Hoseok laughs like he’s embarrassed. You’ve always been in total awe of the way Hoseok can light up and command the energy of a room easily, then squirm away from it at the next second.
Jin gets waved over and gives you a small nod as he departs, and then you’re alone again with the champagne in your hand and the wall against your back and Hoseok’s music thrumming through your nervous system.
The album is nothing like you expected– you didn’t know what to expect, really– and you absolutely love it. You’ve always felt like you have a stupidly limited vocabulary when it comes to talking about music, particularly around Hoseok, but even you can manage to string together the thought that these songs are fucking special.
But then again, so is he.
In what feels like the blink of an eye Hoseok is taking the stage again to giggle through his thanks, bent slightly at the waist in overwhelmed appreciation, and then the pop playlist is switched back on and the lights are dimmed and you suddenly feel your palms start to slick up against your champagne flute.
You can’t help but wonder what the fuck you’re supposed to do now.
The obvious choice would be to finally go talk to Hoseok, but of course, he’s the man of the hour, so every other person in the room seems to have the same idea. You choose to hang back and watch as he weaves through the growing crowd, putting on a bored expression to pose for pictures, laughing excitedly as people shake his hand and speak to him in hushed tones, and flashing thumbs ups and peace signs left, right and center.
It looks exhausting, you think to yourself with a small smile. And this is why you’re not famous.
For the second time tonight someone manages to sneak up on you, and this time it’s accompanied with a gentle call of your name. You nearly drop your drink as you whip around.
When you find yourself face-to-face with Park Jimin, it takes a few seconds for you to remember how to close your mouth. What is going on?
“I thought that was you.”
You double-blink, unable to find any words at all. You have never met this man before in your life. Seen him dozens of times on your TV screen, sure, but certainly never formally introduced.
“I’m Jimin,” he says, and you have to swallow the urge to giggle in his face because, yeah, no shit.
“Hi, Jimin.”
“Hoseok is going to be excited that you’re here.” Jimin scrunches his face up a little, like he knows he shouldn’t be telling you this. “He kept asking me if I thought you would show or not. He really wouldn’t shut up about it.”
You find yourself stammering again, trying to figure out how the hell to respond. Why, out of everyone on the guest list, would Hoseok be concerned about you? And he’s talked to Jimin about you enough for him to know who you are, that he can recognize you on sight alone? Your head starts to spin, despite the fact that you’re only halfway through your glass of champagne.
“Since you don’t like parties,” Jimin says, like it’s common knowledge, as if it’s totally normal for this very busy and famous kpop idol to keep tabs on your socialization preferences.
You nod dumbly. “I, yeah. I’m just not very good at them.”
Jimin nods, pushing up the sleeves of his white Chanel sweater. “You just have to get comfortable with talking to people about boring shit. Did you try the food?”
You shake your head– the very thought is enough to make you feel a little sick. “I get, like, a nervous stomach?” You hate that it comes out like a question when it clearly isn’t.
“Aish, you and Hoseok are so alike,” Jimin rolls his eyes, hands on hips, but you can see he’s smiling a little. “I haven’t been able to get him to eat anything all day. And we ordered so much food, I don’t even know why. Like half the people in this room aren’t on fucking diets.”
“Jimin-ah!”
Both of your heads snap up at the sound of Namjoon’s voice from the other side of the room, distorted slightly by the thudding bass.
“Ahh, they’re doing pictures,” Jimin says with an exaggerated sigh, like it’s just so hard being desirable and photogenic. “Do you want to get a photo?”
You shake your head as emphatically as possible. “No, nope, absolutely not.”
Jimin pauses, squinting at you for a second in a way that makes you think that if you were closer friends, he’d be dragging you across the room regardless of your answer to the question. You watch as he clearly attempts to restrain himself.
“Well, don’t drink too much on an empty stomach, okay? I’ll make you a to-go plate of food before you leave.” He starts to walk backwards away from you, raising his voice a little so you can still hear him. “And please talk to Hoseokie when we’re done! Maybe then he’ll calm the fuck down!”
You can’t hide the smile that blooms across your face, and Jimin wiggles his eyebrows for emphasis before turning around and pressing his way through the crowd to the photo wall.
The members take turns passing Hoseok around, punctuated by the snap of the camera: pinching his cheeks, leaning into him, clinging to his shoulders, wrapping an arm around his neck. You laugh out loud when Taehyung hikes a leg up high on Hoseok’s hip and tips back, a hand draped across his forehead, eyes shut, so fucking dramatic.
Hoseok stares down the camera like a professional, only to immediately dissolve into giggles between shots, tongue poking out between his teeth like he can’t quite handle all the attention. It’s enough to have you nearly fighting for your life.
The members crowd in for a few group shots, posing cutely until Jimin finally waves everyone back off to the dancefloor. He keeps Hoseok behind with one hand gripping his bicep, and your heart drops into your stomach when Jimin leans in to whisper something in Hoseok’s ear.
Oh, fuck.
You try to calm yourself down, reasoning that he could be talking about any number of important things, but then Jimin pulls Hoseok’s sunglasses off his face, turns him unmistakably in your direction, and gives his shoulders a hard push. It’s clear Hoseok doesn’t quite know where he’s going as he stumbles forward and squints at the party lights, so you throw back the last of your champagne for some assistance, set the empty flute on a table, and force yourself to be brave.
You run your palms nervously over the sides of your dress, trying to focus on the feeling of smooth satin as you cross the room to meet him.
“Hobi.” His eyes find yours and you watch as his face, still in party mode— all perfect straight lines and severe grace and supermodel apathy— softens, brightens.
“Oh thank god, you made it,” Hoseok huffs a disbelieving laugh. “Come here.”
He pulls you in for a hug, not the lazy one-armed greetings you’ve seen celebrities give each other all night but a real, solid embrace, both arms crossed firmly over the small of your back. You press your nose into the crook of his neck, the thin fabric of his tank top brushing against your skin. Heat radiates off of him in waves, and he smells so good, like expensive cologne. It’s dizzying.
“Hi,” you murmur, and it’s punctuated with a soft giggle when you realize you’re speaking directly into his collarbone. You move to extract yourself, but his grip tightens.
“Five more seconds,” Hoseok says with another half-laugh, and you gladly allow yourself to melt back into his arms.
He sounds slightly hoarse, you notice, probably from talking all night. You think for easily the millionth time that you have no idea how he does it, but this moment of softness makes you wonder if being the life of the party is a little more difficult than he lets on.
Hoseok hums a little, and the feeling rumbles through your chest, buzzing all the way down to your fingertips like an electric current. When he finally releases you, it’s with a soft sigh, something that almost sounds like reluctance. Your heart backflips at the thought.
The lights flash waves of rainbow color over his face, each one painting his perfect features with a slightly different energy: pink, blue, orange, green. You momentarily forget how to talk, but Hoseok doesn’t miss a beat.
“Are you having fun?”
You nod as decisively as you can. “I’m just awkward, but that’s not your party’s fault.” He giggles, gaze flitting nervously around the room, as you continue. “Seriously, it’s a great party. And I’m not just saying that because you have free booze.”
“Did you want more?” He asks quickly, then seems to think better of it. “Or, well, how much have you had? Do you need water?”
You smile a little despite yourself. “I’m fine, Hobi, thank you. You have better things to do tonight than look after me because I nursed a single glass of champagne. And besides, Jimin already tried to mother hen me earlier.”
A look of serious anguish crosses Hoseok’s face, and he glances back over his shoulder, but Jimin has evaporated into the crowd of beautiful people. “God, I specifically told him to leave you alone.”
You shrug. “It’s not a big deal. He was sweet.”
Hoseok’s gaze lands back on you, and it feels like your chest lights up from the inside out. You almost can’t look directly at him– it’s not unlike staring into the sun. You blink up at him once, twice, more than dazed, and then he laughs again, nose scrunching slightly as if to cringe at himself.
“Agh, I feel awkward. I don’t know what to say.”
You’re smiling, too. “That’s okay,” you say, because it is. You’re perfectly content to just stand here with him, unconcerned with the chaos of the party around you.
“I’m really glad you’re here.”
“Me too.”
“And– well, I guess you’ve never been here before, right? Can I give you a tour? I can take you downstairs and show you my studio.”
Your cheeks start to burn from all the questions, from how fixed his gaze is on you. It’s overwhelming. “Hobi, this is literally your party. You should stay here. I was doing fine holding up the wall over there.”
“Come on, I really want to. Please?” He leans in towards you slightly, glancing around as if to make sure he’s not being overheard. When he speaks into your ear, his voice drops to a lower register for privacy, and you can’t ignore the chills that dot up your spine. “I can’t talk to one more person that isn’t you right now.”
You nod, every nerve ending in your body now hyper-aware of how very close he is to you. “If you’re sure. I’d like that.”
“Thank you,” he says softly, and you breathe a soft giggle at how ridiculous it is that he’s the one thanking you at this moment. Before you even realize what he’s doing, his hand finds your hand, delicate fingers intertwining with yours. The skin of his palm is soft and warm. “Let’s go.” He chases the words with a gentle squeeze.
Hoseok leads you into the elevator and presses the button for a lower floor. You’re a little surprised when he slumps back against the wall with a heavy sigh as the doors close, still holding your hand.
“Oh, I’m tired.” He says quietly, almost like he’s talking to himself rather than to you. “It just hit me now. That was a lot.”
You squeeze his hand back, and his eyes flutter open to look at you. You press yourself up against the wall next to him. “You sound like me after any social event. And here I was thinking all night that you made it look so easy.”
Hoseok smiles. “I’m good at faking it. But I always collapse after stuff like this.” His eyes drift away from you and he stares into the empty space in front of him, his expression darkening slightly. “I just really hope they liked it. It’s so hard to tell what people think, or who’s only bullshitting you when they tell you it’s good. I’d rather they be honest with me.”
“Well, if it means anything, I loved it.” You say softly, your eyes searching his face. “And I’m not a bullshitter.”
Hoseok blinks, then nods once, his eyes not meeting yours. “You’re not. I appreciate that.”
The chime of the elevator seems to snap him somewhat out of his headspace, and he tugs on your joined hands to pull you through the doors as they slide open. “It’s just at the end of the hall.”
There’s something about Hoseok that comforts you all the way to your core, laps gently at the edges of your shyness until it recedes a bit. He just makes you feel like you can say anything without fear of judgment. Conversation comes easier with him, like this.
“How do you feel about it?”
“The album?” He asks.
You shrug. “Everything.”
“I’m very nervous,” Hoseok answers immediately with a bright peal of laughter, squeezing your hand again for emphasis. “I’m working really hard but… it all feels like uncharted territory. It’s so different to do it alone.”
His eyes jump from studio door to studio door as he leads you down the hallway. “I don’t know if people are going to like this side of me or the things I have to say. I don’t know if anyone will still care now that it’s just me. And ugh, I’m so unsure about the music festival. I’ve never done a whole show on my own before. I practice so much every day and I still don’t know if I can do it. Or if it will be any good.”
When he stops you outside of the final door at the end of the hallway, he seems to remember himself. “Wow, look at me. You were probably only being polite and I threw so much at you. This is just what goes around in my head. Every day and every night.”
“You sound stressed,” you say softly.
Hoseok purses his lips for a second. “I guess. I just really want to do well. I don’t want to disappoint anyone. I would– what?”
It isn’t until he asks the question, regarding you with a confused expression, that you realize you’re shaking your head. The smile that has crept across your face is a mixture of disbelief and appreciation.
“I’m sorry,” you’re practically laughing. “Please, keep going.”
“No, no, what is that face?”
You chew on the corner of your lip, trying to figure out the best way to word it. “I just… I don’t want to dismiss your concerns, because I absolutely understand all of them. And I would be shitting a brick, no question. But you…” Hoseok’s eyes widen a little as you pause, drinking him in, the way concern tugs down the corners of his mouth. “You just have no idea. No idea what it’s like to watch you from out here. And I wish you could see yourself the way I do.”
He pauses as if to consider your words. “What do you see?”
You don’t even have to think about the answer. It feels as steady and honest as the beat of your heart behind your ribs. “I see a fucking star. I see somebody who was born to do exactly what he’s doing. And, I mean, I think being nervous is a good thing, and I don’t say this to try and invalidate how you’re feeling at all. But I don’t see any possible future where you don’t succeed, Hoseok. It’s just... not an option. You’re going to get up there and kill it, I know you are. Because it’s you.”
Hoseok’s hand slips out of yours, and you can feel the warmth of his palms as he presses them to your waist to pull you close. Anticipation sparks through you. His eyes search yours intently, like he’s looking for something. “You really feel that way?”
“Completely. There’s no doubt in my mind.” Your gaze drops to his mouth, the way his full lips are parted slightly, and it occurs to you that maybe you’re talking about more than one thing now. “It feels predestined, to me… I don’t know. Inevitable.”
Hoseok makes a soft noise as he continues to close the distance between you. “Inevitable?” You tilt your chin up towards him, every cell in your body humming. “Like this?”
The way he kisses you is so gentle and sweet, you swear your heart leaps into your throat. You allow a second, maybe two, to move your mouth against his and get lost in it, and then you force yourself to break away, your mind reeling.
“I’m sorry,” he says automatically. “I’ve been wanting to do that all night.”
“Hoseok,” you murmur, eyes squeezing shut as you attempt to navigate the discomfort of being vulnerable. “I– you should know that I really, really like you.”
“Really?”
The shock in his voice makes your eyes snap open again, and you can’t help but make a face of utter disbelief. “I thought it was obvious.”
“Looks like I’m not the only one who doesn’t realize how other people see me. You’re actually very hard to read.” Hoseok slips one hand off of your waist to push down on the door handle behind you, then gestures for you to step through. He keeps talking as he follows in after you, letting the door shut behind him. “I second-guess myself all the time with you. Jimin is so fucking tired of hearing about it.”
“Wow,” you say dumbly. “I had no idea.”
“You didn’t even text me back about tonight! I had no idea if you were coming.”
You start to laugh as the realization washes over you: you’d been so busy sighing forlornly and stressing about what to wear, you’d forgotten to actually reply to his messages.
“Okay, this time was actually an accident. But…” You sweep your gaze over his studio, trying to think. “I don’t know, I just always feel like I’m bothering you. Your life is so big and important. Even now: you should be upstairs being the star of your own party. Not down here with me.”
Hoseok shakes his head immediately. “I don’t want to talk to anyone up there the way I want to talk to you. I was such a wreck today when you didn’t answer.”
You can’t believe what he’s saying, even as he takes a step in towards you, his mouth invitingly close to yours again. “Why? I am quite literally the least important person on the guestlist.”
“Because,” Hoseok pauses for a second, then sighs. “I like you, and I was scared that you’d decided not to come, when I…” He’s practically grinning, and the tell of his scrunched up nose makes you realize– he’s embarrassed. “I threw this whole party just to have an excuse to see you.”
Your jaw drops open. “You what?”
“Please don’t make me say it again.”
“Hobi.” You both start to laugh as you stare in disbelief, trying to process the most ridiculous statement you’ve ever heard in your life. “You could have just called me.”
“I tend to overthink these things.”
He’s close enough that you barely have to move to slide your hands up his chest and grip the lapels of his white button-down.
“I think I can help with that,” you murmur, and then you tug him back down into a kiss that makes your head spin.
The sweet nervousness of your first kiss has been replaced with urgency now, Hoseok’s mouth moving over yours like he’s hungry for it. You tug gently on your fistfuls of his shirt to move him towards you, stumbling backwards until you find purchase against the door of the studio.
Hoseok moves skillfully, tongue licking into your mouth while one of his strong thighs shifts to tease your legs apart and press between them. The quick succession of the two is enough to make your breath hitch, and it seems to encourage him more. The rough denim of his jeans grinds into your center, and your already-short dress has ridden up enough that the pressure drags hot sparks right over your core.
Your jaw goes slack as your focus slips, and you tip your head back against the door with a soft whine, circling your hips for more friction. “Fuck, Hoseok.”
His lips drop down to the exposed skin of your neck. The warmth of his mouth has your back arching, your nipples rubbed into stiff peaks under the thin fabric you couldn’t wear a bra with.
“You look so fucking good tonight,” Hoseok groans. “Driving me crazy in this little dress.”
There’s the soft brush of a hand on your thigh, and he teases the hem of your dress up higher and higher as your hips keep moving; his tongue darts out to lick a languid stripe over your collarbone. His other hand slides up from your waist to cup your breast over satin, deftly rolling the bud of your nipple between his long fingers, pinching with just enough pressure to coax a moan out of you.
“I like the sounds you make. Don’t want you to be shy with me.” Hoseok murmurs over your skin before he starts to suck deliberately at your neck, right on your pulse point. You couldn’t stifle the sound his mouth pulls from you even if you wanted to.
With all your attention drawn to grinding your clit against his leg and the warmth of his palm cupping your breast, your grip on the fabric of his shirt has loosened. Moving in a haze of pleasure, your hands fumble at his denim jacket, attempting to push it down his shoulders. Hoseok pulls back slightly when he realizes what you’re doing, though his fingers still lazily squeeze at your nipple.
“Let me just– hang on–” Hoseok untangles himself from you entirely with a sheepish grin, and you take the moment to collect yourself, your chest heaving in shallow breaths. You can feel the way your panties are soaked through as you press your thighs together, desperate for continued friction.
He’s moving quickly as he slips out of his oversized jacket and button down beneath it. You can clearly see the wheels in his head turning as he lays the pieces over the back of his desk chair, then immediately scrunches his face up as if to think better of it.
“Agh, sorry, sorry, one second–” Hoseok shakes out the jacket, then the shirt, folding both in quick yet precise succession before stacking the neat rectangles together and gently setting them on the small couch next to his desk.
Even in the dim studio lighting you can see his face is flushed pink with embarrassment as he returns to press you back against the door.
“I just– I don’t want wrinkles,” he says softly, and you’re very grateful that you no longer have to suppress the urge to take his face in your hands and kiss him.
“I like you so much,” you giggle into his mouth, and it’s punctuated with a squeak when his hands slide down to firmly grab your ass. The fabric of your dress is so thin that it hardly feels like it’s there at all.
Hoseok must have the same thought, because he releases his grip only for as long as it takes to push the skirt of your dress up over your ass; now there’s nothing separating his fingers from your skin when he squeezes you again.
“Like you,” he agrees, his voice husky. “Want to taste you.” Your core aches for his touch, clenches around nothing when he releases his grip and cracks a hand over the soft flesh of your asscheek.
“Please, Hobi.”
You find his mouth with yours again for a needy taste of a kiss, tongues sliding together. Your arms wrap around his shoulders in an attempt to pull him impossibly closer.
In one swift move he presses you flush against the door, and his hands slip to hitch your legs over his waist before moving back to your ass, hoisting your hips up to properly straddle him. You whimper at the grind of his erection through his jeans, right over your rubbed-sensitive center, and at the thought that he could fuck you just like this, up against this door.
Hoseok’s mouth doesn’t leave yours as he turns and carries you the short distance across the room, hands sliding to your hips so he can set you down on the desk. His lips are full and kiss-bitten red when he pulls back to look at you, pupils blown dark with lust.
“Sure this is okay?”
You meet his gaze, reaching up to dust strands of hair out of his eyes. His mouth chases the heel of your hand so he can press those soft lips into the center of your palm, chaste and sweet. 
“It’s so much more than okay,” you murmur.
He’s smiling as he leans forward for another kiss, only pulling back to press his forehead to yours once you’re both breathless. “I have wanted to do this for so fucking long. You have no idea.”
His hands hook under the backs of your thighs to scoot you gently forward until you’re perched at the very edge of his desk, and then he sinks to his knees. Your legs that were slipped around his waist find new purchase thrown over his shoulders and you tense a little when your high heels scrape over his back.
“I can take these off,” you start, but he’s already shaking his head as his palms encourage your thighs apart.
“I like it.”
You’re nearly gasping for breath with anticipation as his long fingers slip under the band of your panties and you lift your hips up so he can pull them down. You manage to extract one leg to drape back over his shoulders, leaving the lacy fabric to dangle off the other as you open up for him.
Hoseok’s thumbs press to either side of your pussy, gently spreading your lips apart to admire how soaked you already are. Anyone else examining you like this would have you squirming away self-consciously, but there’s just something about Hoseok that’s different. You want him to know every part of you fully, intimately.
“God, you are so gorgeous.” His breath is hot over your skin, makes your cunt tighten needily as if to beckon him closer.
You lean back to brace your forearms on the desk behind you and Hoseok’s gaze jumps up to meet yours. He doesn’t drop eye contact as he leans forward to press an open-mouthed kiss to your slit, both of you groaning at the contact.
His mouth moves just as it did against yours, and you let your eyes flutter closed as pleasure sears through you like a hot knife. Hoseok grunts a little, low in his throat when he adds tongue to his kisses, licking softly but deliberately to part your slick folds.
“Hobi,” you whine, rolling your hips up into him as he starts to apply more pressure with his tongue. “Fuck, ah, feels so good.”
Hoseok pulls off of you with a throaty gasp, like maybe he was so focused on eating you out that he didn’t quite remember to keep breathing. When you look down at him, his lips are wet and glossy, spread in a wide smile. “You taste so fucking good.”
You don’t even have time to ask for more before he’s hooking his biceps around your thighs and tugging your hips towards him, pulling you even closer to bury his face between your legs. This time he licks a stripe straight up to your swollen clit, pulling the bud into his mouth to suck on.
“Oh my god,” you gasp, digging your nails into the desk beneath you as sparks shoot through you and your clit twitches in his mouth.
Hoseok hums steadily around you, as if to once again encourage you to be vocal. He starts to nod his head as he sucks, his nose pressed flush against your pubic bone. Your hips fall in time with his rhythm, grinding back down on him.
“Yes, yes, yes,” you whimper. “Shit, Hobi.” Your voice catches on a dazed, disbelieving laugh. “You’re gonna make me come if you keep doing that.”
He doesn’t let up, squeezing his grip on your thighs that much tighter when you start to quiver beneath him. Your arousal coils tight and hot in your core as he works more not-so-shy noises out of you, breathy moans, needy whines.
You cling desperately to the edge of his desk, teetering equally on the edge of your own release. The wet slick wash of his tongue is lush, decadent, lapping at your clit between pulses of suction, and it’s all too fucking much.
“Yes, Hoseok, fuck!”
You cry out, your heels digging into the hard plane of Hoseok’s back as he works an intense, shuddering orgasm out of you. Your cunt throbs over and over as you come, a rush of arousal painting the crux of your thighs.
When you catch your breath it’s in uneven, shaky gasps, and the movement of your hips sharpens into jolts as you become hypersensitive to Hoseok’s mouth. He releases you almost reluctantly, still hovering close, continuing to dart his tongue out to gently lick up your folds.
“I don’t want to stop,” he says with a shy, blossoming laugh, the light catching the shine of his lips and chin when he glances up at you.
You’re dazed, beyond blissed out, unable to believe that any of this is real. You like him so much.
“Can I keep going?”
Just that sentence is enough to make you tighten all over again with anticipation. “I–” you laugh a little too despite yourself. “I want that. But I think my clit needs a second.”
Hoseok’s touch is featherlight as he circles a digit lower, over your entrance, as if to ask permission. “What about here?” Your pussy lips twitch even under so gentle a touch, but you ache for more; you like that it’s overwhelming.
“Yeah, yes. There, please, fuck,” you babble. He’s added a second finger to tease now, and you whimper when they finally press together into your sensitive cunt.
Hoseok is watching his fingers intently, and you can hear the way your pussy squelches as he pumps them slowly, can feel the tremors of your orgasm still shuddering through you, causing slick to drip from your center. You can only imagine what his view must be like, how you must look: dripping, needy, trembling for him, fingers gripping the desk and head lolling back.
“So pretty,” he murmurs, his voice low and soft, and then he dips his head down to lap below your entrance, tasting the juices that have leaked out of you. He pulls back to smack his other hand over your whole cunt, light enough that you barely feel the tap, but just the visual of it makes you squirm beneath him.
“So cute,” he smiles. His fingers rub circles into your front wall, becoming more insistent, and you breathe in shaky waves as you start to grip tightly around him.
“Hoseok,” you breathe, letting your eyes drop closed. Arousal blossoms through you like a heavy weight, your second climax already building, when you feel his other hand cup the join of your ass and thigh.
A soft whimper spills out of you as Hoseok starts to massage below your entrance, thumb working at a new bundle of nerves, like nothing you’ve ever felt. It’s pleasure that makes you hot all over, makes the muscles in your legs shiver and tense when it’s paired with the crook of his fingers still working your pussy.
“Fuck,” you pant, “Hobi, what are– that feels so–” You’re starting to lose a grip on your words, sentences going incoherent as your head spins. It’s hard to think over all the sensation, the way your body is lit up like a live wire, and the sound of your cunt gushing around him as he fucks into your g-spot.
“Has anyone touched you here before?” He asks softly, thumb tapping at the thin bridge of skin between your pussy and your ass. His head dips down for a chaste kiss there, then a second, adding a languid lap of tongue.
“N-no,” you whimper, toes curling in your shoes as he continues to drag his tongue over this delicate, sensitive place. “Keep going.”
Hoseok pulls back, a string of saliva still connecting him to you, and he lets it loose with a swipe of his hand over his mouth. His fingers slip out of you as he pairs a question with a smile. “Turn over for me?”
Your legs would be shaking even if you weren’t in fancy party heels, and you do your best to be graceful as you unsteadily spin, one arm keeping the fabric of your dress hiked up over your hips.
“Brace yourself on the desk,” Hoseok instructs, and you do, leaning forward until your stomach and forearms are flush with the wood, your bare ass hanging off the desk, presented for him. You spread your legs apart again and can feel the way your pussy drools arousal down your thighs. “That’s it,” he coaxes.
His fingers massage firmly into the flesh of your asscheeks, and your back arches up as you groan at the feeling. He spreads you just a little, enough for cool air to tease at your slick center; your hips wiggle towards him on instinct.
“Pretty back here, too,” he murmurs. “Tell me how it feels, okay? Won’t do it if you don’t like it.”
You clench for him in both places, even your fists grip tight in the fabric of your dress. “I’ll like it. Please, baby.”
“Baby,” Hoseok repeats back with a shy exhale. “I like that. I like you.” He leaves a sweet kiss pressed halfway up your thigh.
“Hobi–” you choke out a whine of his name as his breath ghosts over you, hands still firmly keeping you spread. His tongue returns to your perineum again, licking a hot, slow stripe that keeps moving up, up, until you feel the tease of warmth and wetness over your ass. “Oh, fuck.”
You’re so sensitive here, just the lightest drag of his tongue over your rim makes you moan, feet kicking listlessly as pleasure shudders through you.
“It’s good–” you manage to whimper, voice muffled slightly as your forehead drops against the desk, too, your whole body pinned down by his mouth. “–ngh, really good, Hobi.” Your cunt throbs when he does it again, as he falls into a consistent pace of long, steady laps that set off fireworks behind your eyes.
The ache in your core begs for touch, friction, and you oblige needily, tucking a hand under the weight of your hips pressed into the desk, a sweat-slicked palm for your mouth-wet clit.
Hoseok doesn’t miss a thing. It’s only for a second that he pulls off of you, but you whine at the loss of his tongue, sated slightly by the gentle brush of his lips over the small of your back. “Gonna get yourself off while I eat you out?”
You grind a circle down with your hips, hissing at the white-hot pulse against your hand. “Yes, baby, please.”
He doesn’t need any more encouragement to dive back in, fingers gripping harder to spread you and tongue licking deliberately, tracing patterns that work more arousal out of your pussy. You’re unraveling fast from humping against your palm, hips jolting forward to make your clit twitch and backwards to press towards Hoseok’s mouth.
You’re already wound so tight that you’re too desperate for words, reduced instead to little breathless gasps– “ah, ahh”– as you speed up the rub of your hand, your hips. Hoseok’s tongue never falters, firm pressure laved over and over your sensitive, flexing ass.
With a soft hum of effort, you feel him press a little harder, tongue barely dipping in past your tight ring of muscle, and the sweet stretch of it is the final push you need.
You roll your clit just right over your palm a final time and then you’re shaking and moaning as everything starts to pulse. The all-over clench pushes a fresh wave of fluid from your cunt, rolling down the backs of your thighs, fat droplets of arousal that Hoseok chases with sloppy kisses as the waves of your orgasm shudder through you.
It takes a moment before you can say anything, do anything, limbs too heavy and brain too fucked-out dumb. You do your best to slide gracefully off the desk, but your legs shake with aftershocks that betray you, and you stumble.
Hoseok is quick to wrap his arms around you and guide your hips down to the floor next to him. You collapse in a heap of giggles, him tangled over your waist, the skirt of your dress still pushed up, your bare ass on his studio carpet.
“Are you okay?” Hoseok laughs, and you bury your face in the fabric of his tank top as an answer, not convinced your coherency has returned to you yet.
“Too good,” you murmur, words slurring. “Fucked me too good.”
“You’re so hot.” You can tell he’s blushing just by the tone of his voice, and you start to come to a little, slow-blinking back to reality and rolling over to look up at him. His dark eyes shine as he smiles. You don’t want to come all the way down from this dazed, happy place yet, you realize, and you curl a finger into the loop of his jeans, tugging him closer.
“My turn.” Your hands start to fumble to undo his belt buckle. His jeans are oversized, but not enough to obscure the print of his hard cock pressed against his thigh.
“Let me take you home,” he says softly, running a fingertip along your jaw. “This should be– I want you to be comfortable. I want it to feel good.”
“It all feels good,” you say earnestly, sitting up to tug at the button of his jeans, undeterred. “And you can take me home. But you’ve been so good to me, Hobi.” You manage to work his fly open, and you lift your gaze to meet him. “Let me be good to you.”
You resume your work, wriggling Hoseok’s jeans down his thighs until his hands cover yours and he takes over, stripping himself of his shoes as well. He reaches back between his shoulder blades to pull his tank top over his head, and your eyes sweep over his body, taking in his lithe figure and smooth, hard muscles. You trail the tips of your fingers down the defined lines of his chest.
“Fuck,” Hoseok starts to smile self-consciously, one hand drifting over his dick straining against tight black briefs with a slightly darker spot in the center where he’s left a kiss of precum on the fabric. “I don’t have any condoms here.”
You sit up on your knees in front of him, considering this. “Use my mouth.” The high of your orgasm has subsided enough now that you’re not quite shameless anymore, and heat blooms in your face as you continue. “Like, fuck my throat.”
He tries and fails to suppress a groan, and his delicate hands reach to cup either side of your face, thumbs rubbing circles into the hinge of your jaw. “You–” he laughs softly. “You can’t just say things like that.”
“I mean it,” you say simply.
“But you really want to?”
You nod, half play-acting your shyness now, letting your lashes flutter as you blink up at him. “I’ve done it before. I like it.”
“Fuck,” Hoseok breathes. “I want to do everything you like.”
“Please?” You ask sweetly, and Hoseok is already getting to his feet, one hand still cupping your jaw.
“Pretty,” he murmurs, tongue darting out to wet his lips. “So pretty when you beg to suck my cock.” You’re smiling, your fingers slipping under his waistband to slide his briefs down his legs.
“Take your dress off, baby,” Hoseok instructs as he steps back to finish pulling off his underwear. “Don’t wanna ruin it.”
You do as you’re told, staying on your knees to pull it over your head, your heart squeezing again when he takes it from you and treats it as gently as his own clothes. It’s oddly domestic to watch him fold the smooth fabric with shaking hands, naked except for his jewelry, his hard dick leaking against his stomach.
When he turns back to you, you take the opportunity to properly admire him. His cock is as flushed and gorgeous as the rest of him, thick and dripping wet from his tip. You duck down to press a kiss to the sensitive spot under his head, then slide your lips up to gloss over his slit, slicking your mouth with his precum.
You look up at him, hands gripping the backs of his thighs; Hoseok’s eyelids are heavy with lust as he watches you work, tongue toying at the corner of his mouth. He groans a little as you pop just the head into your mouth and swirl your tongue over it, tasting the salt of him.
His hand slides to the back of your head, tangling in the hair at the nape of your neck, and his adam’s apple jerks in his throat as he swallows.
“Tap my foot if you need to stop.” Hoseok’s voice is quiet but firm, and his socked toes wiggle, brushing against your knee pressed into the carpet. “Okay?”
You hum your acknowledgement and maintain eye contact as he holds you still and slides his cock into your mouth. He starts off at a gentle pace, and you hollow your cheeks around him, pressing your tongue flat so it drags over his shaft as he starts to pump in and out of you.
As much as you want him in control, there’s a part of you that can’t help yourself– you lean forward, eyes fluttering closed, wanting to prove to him how much you can take. The head of his cock starts to stretch down your throat and you focus on breathing steady through your nose, your muscles jumping around him in a half-swallow.
“Fuck,” Hoseok groans, his voice dark and rough-edged. You can feel drool starting to leak out of your mouth, and the mess just makes it better. “You take it so well.”
His hips keep rolling, withdrawing his cock into the heat of your mouth only to push it back down the tight clutch of your throat. It gets easier as he starts to move faster, the weight of him pressing bright on your gag reflex in shorter and shorter bursts. It’s just enough to make tears well up in your eyes. They eventually spill over, staining your cheeks until your face is slick and wet, like the sounds of him hitting the back of your throat, all of it obscene and hot.
The hand in your hair tightens as he pulls you all the way down on his shaft until your nose is flush with his abdomen and your throat bulges, filled with him. He holds you there, eyes roaming hungrily over your face.
“You look so sweet with my cock down your throat, baby.”
The hum of agreement you try makes you gag a little, and he quickly releases, pulling out to let you gasp for air. Your tongue lolls out of your mouth as you smile up at him, dazed, and catch your breath.
“Was that too much?” His brows pinch together slightly with concern. You wipe a hand over your nose and shake your head.
“I want more, Hobi,” you purr, moving your face back towards his dick. You lean forward to lazily drag your tongue up his shaft for emphasis. “Want you to come on my face,” you admit as you fix your gaze on him.
You swear you feel his knees almost buckle when you take him in your mouth again.
“You are so fucking sexy,” Hoseok practically growls, hand returning to the nape of your neck. He pushes himself back down your throat and starts to pick up the pace. You want him all and take it easily now, drool slicking your neck and chest when you swallow around his length.
“Oh my god,” he gasps, and you can feel his cock twitch on your tongue as he fucks roughly into your mouth, chasing his orgasm. “Oh my god.”
Hoseok’s grip on your hair goes slack and he pulls out, hand pumping fast over his drool-glossed cock. He tips his head back, exposing the column of his throat with a heady whine when he starts to come. You’re up on your knees and ready for it, nose bumping his fist, face presented for him to paint. Warm spurts of cum hit your cheeks, tongue, lips, and you giggle a little as you try to hold still, as he makes another throaty grunt of effort and release.
“Shit,” he hisses as the movements of his hand slow, as he works out the last of it, stray drips already trailing down your neck, between the valley of your breasts. “Fuuuck.” His breathing is ragged, and you press a wet kiss to the tip of his dick as he recovers.
He’s clearly already focused on the mess he’s made of you, spinning in a dazed semi-circle before reaching to grab a box of tissues off of the desk. His bare knees thud on the carpet as he sinks down next to you.
You’re surprised when he leans in to kiss you, humming softly against your mouth, tongue even darting out to lick at the cum that drips off your lips. You smile into it, teeth gently grazing over his bottom lip.
“Hi,” he huffs a laugh as he leans back. “Was that okay? Not too much?”
You shake your head. “I liked it,” you say again, though your voice comes out a little hoarse. “Wouldn’t have asked for it if I didn’t. I like you. I–” your breath hitches slightly with nerves, and it’s funny to you, that it’s easy to ask him to fuck your throat, but hard to talk about the bigger feelings underneath. It’s more intimate, somehow, to be earnest. “You always worry so much about everyone else. I just want to take care of you.”
“You can.” Hoseok’s voice is gentle and warm. “We both can.” He pulls a tissue loose from the box, hovering close to you. “Let me clean you up.”
You’re too blissed out to stop yourself from giggling. “You have a whole party to get back to.” You nod dumbly at the verity of your own statement as he uses tissues to wipe cum and drool off your face, tear stains and smudged makeup from your cheeks.
“This,” he swipes a thumb down over your bottom lip, chases it with another quick kiss, “was so much better than a fucking party.” He adds the last of the dampened tissues to the small pile he’s made on the floor, tilting your jaw with his hand to inspect his work, to ensure perfection as he does with everything. “But I probably don’t have much longer before people start looking for me.”
“You should go,” you say quietly, trying to ignore the drop in your stomach.
His hand slips into yours for the second time tonight. “Will you come with me? I know it’s not really your thing.”
You falter momentarily– not because you don’t want to, but you can’t shake your own self-consciousness, this sense that you don’t belong here, rubbing elbows with all these famous people. But it’s hard to feel like any of that matters with the way Hoseok is looking at you, the soft turn of his lips in a barely-there smile.
“Are you sure?”
“Very.” He gives your hand an affirming squeeze. “Do I need to remind you that this entire party is literally for you?”
You shake your head, rolling your eyes at his antics despite the laugh that bubbles up in your throat. “I still can’t believe you. What is this, The Great Gatsby?”
His laugh is high and sweet, hand untangling from yours to wrap both arms around your waist, and he pulls you into his chest, bare skin on bare skin, hearts beating together. “Is that a yes?”
“Yes, Hobi,” you relent. “I’ll go back with you. Besides, Jimin promised to feed me.”
You can feel Hoseok’s smile as he presses a kiss to your temple. “Come on, then. I promise it’ll be fun. If we get Jungkook drunk enough he’ll probably start dancing on the stage.”
“Now that I have to see.”
Tumblr media
6K notes · View notes
pixiesfz · 2 months
Note
It make me so sad that’s there is not much lotte or Teagan content on here 😭
I’m gonna mix my two requests for teagan together!!
Tumblr media
take the punch t.m
plot: you take a hard punch in a corner kick, turns out it’s from the girl you’ve been talking to for months.
warnings: injury, aggression from teammates, Player gets hit in the face and player is only given a yellow also I am NOT a doctor
Tumblr media
You stared at your phone and the messages that were on it.
More specifically the girl behind the messages.
You had met Teagan at the start of the season on her debut as Liverpools goal keeper.
She had been a pain in your ass.
saving your shots left right and centre, it annoyed you but impressed you so much that you went up to her afterwards.
“Teagan is it?” You ask, walking up to her and she nodded “uh yeah, your y/n” she responded and you nodded “you know your really good” you told her “wasn’t fun for me but you know” you laugh and she laughed with you.
“I was honestly very scared to go against you” she admitted and you rose your eyebrows “really?” You ask and she nodded “watched you in the World Cup when Australia versed you, got those goals past us like it was nothing”
Oh yes, you remember that day.
“Sorry for kicking you guys out” you said softly and she shook her head “nah it’s all good, had me mesmerised to be honest”
You blushed, “yeah?” you ask and the goal keeper nodded “definitely”.
Before you could response you felt the hands of your teammate drag you away “Chloe!” You complained as she smiled at you
“No fraternising with the enemy y/n/n”
“Shut up”.
When you went to bed that night you didn’t expect to wake up to a dm from the Australian.
‘I really hope this is your account and not just a very popular fan account’
And for the first time in a while you woke up with a smile.
After a month or so of talking online with the girl your teammates noticed a change in your behaviour.
You were smiling in the morning, trying new things for breakfast and pestering Mary and Alanna for Australian facts.
One day Alanna turned towards you “Alright who is it?”
“Who is what?”
“Who is the girl that is getting you all…giddy”
You stepped back “there is no girl”
“There is such a girl, who knew our little German could find love?” She grinned and pulled you into a loving headlock.
“Fine” you grunted “there is a girl” you admitted and cheers filled the room.
“Who is it?”
“Does she play?”
“Do we know her?”
“Please don’t let it be a physio”
You turned to Jill weirdly “what?” You asked and she just shrugged before you turned back to your teammates.
“I’m not going to tell her name yet just in case it doesn’t go well, yes she plays and yes some of you know her well”
You gave away your hints before the team realised it could literally be anyone in the WSL.
“Can you at least tell us the team?” Mary asked, using her power of being one of the younger, cuter members of the squad.
“No.”
You were on a FaceTime with the Australian when she made the first move “Do you want to go on another date with me?” She asked after the topic of your worst date ever came up.
You smiled bright, a blush burning on your cheeks but you were so ever happy “I would love to, we can walking on the beach again”.
“Well we have the Liverpool vs City game coming up next week so after that” she declared “nah, I was thinking something fancier, we can go on a nice dinner and-“
“I want you to surprise me” you cut her off “I want to know what your creative Australian mind thinks of”
“Well mostly it’s you” she chimed in and you groaned, rolling your eyes “oh shut up”
Teagan laughed at your reaction, smiling at the way you reacted to her cheesy pick up lines.
Texts back and forth between the two of you did not help your nerves for the game ahead of you. But mostly you were more nervous for the activities afterwards.
You had ended up confiding to your national teammate Lena about your situation ship with the Aussie, not letting your club teammates know just yet.
But when the game ends and the girls see you walking out the doors with Teagan they'll find out who your mystery girl is anyway so with your blood rushing and head spinning you finally and well accidently tell your man city teammate and unfortunately Teagan's international teammate Mary.
"Really?" she responds to your quick words as you laid them out quickly, you just blushed harder before she gives you a thinking face "well that makes sense".
You furrow your brows "how-why- how does it make sense?" you ask, your arms moving with your words "well last international break she seemed much happier and that was after we versed Liverpool and if we weren't at trainings she was like stuck on her phone"
You stepped back at your friends words, You and Teagan had only successfully been able to go on one date together by the time the first international break came over, it brough a smile to your face realizing that she was in a similar state as you afterwards.
"I can help you two!"
"Mary I will not allow this to become a primary school relationship!"
Soon the game was here, you were lined up with your team in the tunnel, not in the starting XI but still in your gear as a sub. Mary was behind you, still the only teammate who knew about Teagan.
"look who's watching" she teased and you turned red, quickly turning around and smacking her arm "stop" you instructed and turned towards Teagan who was near the front of her line, she was already smiling at your interaction with Mary but gave you a small wave which you copied before you all walked out.
"that hurt" Mary rubbed her arm "deal with it".
You weren't subbed on until the second half, City were up by one as Lauren sent one through Teagan's fingers and into the net. You saw Teagan dust herself off as you ran on, her eyes fell on you for a second before going back onto the play which you joined in on quickly after.
Jess had scored not long after and you cheered after her, jumping onto her back with a smile. You wanted to look back to Teagan to see if she was doing okay but you were in your element, playing the sport you love and in this case winning!
In the 87th minute Kerstin weaved through the midfield and in between defenders as you lead towards the goal, her eyes darted towards you and sent you the ball, you jumped to header it in and then black.
The crowd watched as you jumped in the air, the ball hitting the front of your forehead and unfortunately the fist of Teagan's hands hitting the back, causing you to fall forward straight on the floor which you stayed.
Teagan all of a sudden didn't care about the ball that hit the back of the net and quickly dropped down to you, rolling you on your back so you faced up to her. "Oh my god-"
Teagan was cut off as your teammates pulled her away "Get off of her Micah" someone called out, Mary, cringing on the sidelines as she couldn't split her teammates and her friend apart. The words were catching your ears as you stirred awake to whatever had just happened to you.
Teagan ignored the man city players pesters and kept her eyes on you "please I just want to see if she's okay" she told them but Alanna pulled her back as medics ran on "Teagan she's not going to want to see you" she told her and Teagan crossed her head "I was supposed to ask her to be my girlfriend tonight" she told Alanna and the tall Australian stepped back and looked back over to you with wide eyes.
"let her go over".
Teagan ran over to you as the medics sat you up, The referee also showing her a yellow card but she didn't care.
"Hmm- Teags" you slurred as the girl came into your view "what happened?" you ask and the girl pursed her lips.
"Kinda punched you in the face"
"Oh" you said, not really gaining the information, a clear concussion on your behalf
Teagan watched as you were taken off by medics and went back into her box, the game quickly changed in the last ten minutes, the crowd was quiet and the teams weren't playing as hard, Liverpool excepting their defeat and man city not celebrating their win.
Not without you.
You were taken into the medics room before they quickly decided to take you to the hospital for a CT scan.
Meanwhile at the game, some of the players skipped the walk around the field to talk with fans and checked to see where you were. Hospital was what word was heard and Teagan along-side with Man city players were on their way.
Teagan drove herself, maybe going a bit faster than usual but you were on her mind, this was her fault.
She had had a concussion before, a bad concussion, it took her out for months on the team. She didn't want the same for you.
She was the first to arrived still in her kit, your teammates walked in five minutes later, quickly seeing the girl and walking up to her "you don't have to take pity on her" Kerstin said, Lauren quickly following "a quick DM would have been fine for her", their words were filled with pettiness which Alanna and Mary quickly shut down.
"They're not strangers" Mary said quickly and they all turned their heads "what?" Chloe questioned, Leia still stepping up to the Goal keeper "then what are they?"
"She's the girl".
Leia stepped back as Chloe gasped "oh my god, we are so sorry" Teagan just nodded, she ignored their comments her mind strictly on you "she was gonna tell you today after the game"
"before you punched her"
"useful information, thankyou Mary"
All the girls sat down, waiting for you "do you think she'll be mad?" Teagan asked Alanna who shook her head "she knows what she signed up for when she took that header, she knows the game" the blonde said and Teagan just nodded, still not convinced you wont cuss her out when you see her.
You sat in the room, looking at the scans, you would have a month off which you nodded your head at "I know it's not ideal but you have to be on a bed rest for about a week and you will have to miss the next international break for Germany" the doctor told you and you once again nodded your head.
"But you will be well enough for the Olympic but if you don't make it to the finals then you'll be out until the end of the season"
You sniffed, rolling your head back to stop any tears. You were sure Man city would make it to the finals with how they were playing, but if you missed a month you weren't sure if you would get any minutes on the film.
You had seen how time off had done for others, you didn't want that to be you.
You walked out of the room looking defeated as ever, your teammates were the first to walk to you, checking up on you with little questions before Kerstin gave you a hug, silently apologizing for her kick which you told her was not her fault.
It was nobodies fault.
When they all walked away, Mary softly turned your head towards the Liverpool keeper who had left to grab flowers from one of the stalls nearby.
"I thought you would have gone home" you said, relieved at the sight of her "and go to the dinner by myself?" she joked and you softly laughed.
You touched the back of your head "I don't think I look nice enough for a fancy dinner right now" you said and Teagan stepped forward her arm raising towards yours "Well personally I think you look amazing"
You blushed as she she tucked your hair you had taken out behind your ear "how long are you out for?" she asked "only a month" you smiled "that's really good Y/n" she started before looking down "I'm really sorry I just wasn't thinking and-"
You cut her off y quickly pecking her lips, distracting her completely as she widened her eyes "I don't blame you Teagan" you said, grabbing the flowers with one hand and grabbing her other hand with the other.
"So you're not mad?"
You creased your eyebrows "of course not" she let out a sigh of relief "well that's good, might have to cancel our plans though" she said and you smirked "how bout we order take out at mine?"
"yeah?"
"yes."
241 notes · View notes
ma1dita · 4 months
Text
child of dionysus headcanons
(similarly: trouble!verse character traits)
written for fun! purposed for my luke castellan x dionysus!reader blurb collection -> check out 'partners in crime' masterpost here
Tumblr media Tumblr media Tumblr media
[demigod traits/hcs]
-addictive personality
-really good at planning events and parties
-i saw someone hc that all mr.d's kids would have good sense of direction as a blessing from ariadne and I LOVE that
-super emotional and a good actress; i would think they can cry on command and it freaks people out
-unquenchable thirst literally and figuratively (always wanting more of something)
-random spurts of mania
-dionysus originally guided the process of reincarnation, would hc that the kids can receive messages from the dead to some extent
-can induce and cure madness and anxiety
-could deduce they'd be good event planners or therapists
-kids are def LGBTQIA in some aspect
-can control vegetation & vines
[more specific to trouble!verse (& possible sneak peeks woohoo)]
-super high-strung & has manic episodes
-drink of choice is an amber (strawberry apricot) redbull. yummy
-most definitely bi or queer
-likes order and control to stabilize own emotions
-fights with a lance & thyrsus
-big writer & poet; lots of notebooks and lists
-cat person!
-can't bake because she hates trial and error
-doesn't call her dad, dad---just D
-big daddy issues because Mr.D didn't know she existed until she pulled a Maury on him
-hyper independent and doesn't trust a lot of people
-cabin is split into three rooms for her and her brothers; she has a loft
Tumblr media Tumblr media Tumblr media
this is just for fun because i love storymapping! would love to hear yalls thoughts and feedback on how to make the story and characterization of a dionysus kid more accurate <3
363 notes · View notes
spider-stark · 1 year
Text
🕷Spider-Stark's Masterlist🕷
welcome to my blog! so glad you decided to drop by!
in this post you will find a links to all of my series specific masterlists! i regularly update my masterlists as i post, so feel free to check back frequently for new work.
below you will find some general information about my blog.
asks/requests:
my ask's are always open! nothing makes me happier than getting messages from you guys, whether they're just about random things, fandom related topics, or about my writing!
requests are open, however that doesn't mean i will be able to write what you request. please try to understand this! writing is a very precious hobby of mine, and in order to keep it as fun as possible i try to only write requests that strike some inspiration for me
who i currently write for:
Spider-Verse, Stranger Things, Daredevil, and House of the Dragon
important notes:
reblogs & comments mean the world to writers. likes are appreciated, but the more you engage with our stories, the more encouraged and inspired we will feel to produce more content! please interact as much as possible.
some of my work is not appropriate for all ages. those things will be labeled 18+, and if i see minors interacting with that material then i will block them.
my works contain warnings for all 18+ material and potentially triggering topics. while i do my best to label everything appropriately, please feel free to contact me if you think there is something in my work that needs to be added to the warning list.
Tumblr media
series masterlist links
SPIDER-VERSE MASTERLIST
🕷️ Includes TASM!Peter & Harry, MCU!Peter, & multi-chapter fics
HOUSE OF THE DRAGON MASTERLIST
⚔️ Includes Aegon II Targaryen
DAREDEVIL MASTERLIST
🖤 Includes Matt Murdock
STRANGER THINGS MASTERLIST
🌻 Includes Jonathan Byers
844 notes · View notes