#There's always next time

[hiko-the-teacup]

i do NOT know how to draw elk horns I am SORRY

#cold front #cold front game #augustine orlov #winnie bosko #cold front augustine #cold front winnie #I'm normal about these two #I totally didn't shed real wholehearted tears to this game #not at all because im so normal #mhm #I forgot augustine's massive eyebrows #there's always next time #my art

[oh-hamlet-archived]

Marcia.

#who's she fighting? #I dunno just don't get in her way.. #not sure if I'm happy with her face but alas #there's always next time #the cloak is too cool not to post #marcia overstrand #septimus heap #p.s. click for higher quality #ohhamlet art

[monochromehearts]

two sleep deprivations later, park jisung!!! i dont do him justice with how rushed it is ughhh source pic:  @940117Love  

also, happy seoul collection day!!

#onlyoneof #love #ooo art #uni has been fucking NASTY with my schedule #i wish i couldve finished this sooner and spent more time with details but #oh well #there's always next time #speaking of which #does anybody have links to jisung fansites? i found mayhaps 3 on twitter which were not on priv #ive seen quite a few potential pics to use as references but id like to make sure i credit a fansite if i use them

[sageostorms]

RAZZMATAZZ

I love their funky whiskers!!!

ArtFight attack I did against mango-cat!

#artfight #artfight attack #artfight 2023 #team werewolves #my art #traditional art #watercolor pencils #i also love the jelly tumy and claws and horns and ears #so good #I think I should've layered up some more on the blue #oh well #there's always next time

[psihoactiv]

i did try ketamine again like i said i would btw. but i took too much and threw up twice and the rest of the experience was mid </3

i did like not feeling any back or neck pain no matter what weird position i found myself in though. that part was great

#shoutout to my bf who made the bad parts go away faster #held my hair while i puked and sang a made up song to me while i was dry heaving like a demon exorcised #i feel bad in retrospect bc i kinda ruined his high. and he really likes ket :/ #oh well #there's always next time

[mrcspectr]

GUESS WHAT IT DIDN’T WORK.

I saw it in her eyes as soon as I said it out loud like. Ma’am. Are you a therapist or a professional wizard.

#there's always next time #isn't the definition of insanity trying the same thing over and over and expecting different results #or something like that #cool cool cool a n y w a y #i'm still normal #personal

[tgifg-rhysa]

Just finished listening to the new Panic! At The Disco album...

And oh Lucy, that was not great.

To be fair it wasn't an absolute shitshow, there were actually a couple songs I enjoyed.

"Don't Turn Off The Light", while not sonically super inventive or anything had me singing along around the third line. It's simple, it's sweet, it doesn't really evolve or go anywhere, but it was definitely the first track on the album I didn't actively dislike.

"Sing It Louder" was cool, I actually went back and listened to it a second time cos it was kind of a bop. Not a banger, but definitely a bop, I had to sing along with this.

Thematically, I liked "Something About Maggie" and "Sad Clown", but I can't really see myself humming or singing them to myself. These were also a couple of the more interesting one sound-wise on first listen but the bar was pretty low to be honest.

"God Killed Rock And Roll" is a song I kind of don't want to like. This song is basically Brendon Urie's take on Bohemian Rhapsody, but unlike My Chem with "Welcome To the Black Parade" for instance, it doesn't really evolve the core idea, and feels less "heavily influenced by Bohemian Rhapsody" and more "this is just Bohemian Rhapsody". Even down to using some note patterns which were definitely on purpose. But even though it's similar to Bohemian Rhapsody, it's still pretty flacid in comparison cos it only really has two parts to it, whereas the original has around four or five.

And that's about it in terms of songs on the album I actually somewhat enjoyed. The rest either didn't do it for me or worse off, did nothing but bad for me. Panic! has been a one man act for a while now, but this is the first album I think where it truly does just sound like a guy in his basement. The mixing is really weird in parts, some transitions are either jarring or non-existent, there are some weird sound choices in terms of amps and filters, and something feels off about his voice. Overall it just isn't a super high quality album in comparison to his previous work, which I think might be where the root of the issue lies for me.

I'm not the kind of fan to get angry when an artist changes their sound, they have the right to do so and fans aren't entitled into forcing their favorite creatives to stay in a bubble. But one thing that *does* bother me is just how low quality this genre switched album feels.

To my understanding, this album sounded like an homage to many famous classic rock and rollers, which is fine, that's cool and all. But it walks the line of "Nostalgic Tribute" too clumsily and at many points just feels *generic*, due to most songs just sounding like the concept of "rock and roll" in your brain. MCR who I mentioned earlier changed their sound with each album, not just their instruments and drummers, but jumping genres and themes pretty drastically, but never really having a substantial quality drop. Even Fall Out Boy who've also switched up their sound every album, managed keep up a pretty consistent amount of production quality in their work. Whether or not you actually enjoy the newer songs as much in comparison to their old work is up to you, but in terms of budget and effort, their discography has a pretty good track record (especially considering how many years they would release albums in succession).

I'm not upset that this doesn't sound like a Panic! At The Disco Album

I'm upset that it doesn't sound like Panic! At The Disco made this album. The key distinction between those two statements is the former is comparing the stylistic sound, while the latter is comparing the artistry. In the same vein of how this is the first album to actually just sound like a guy made it in his basement, this is also the first album to feel like there isn't any ounce of Panic! left in it. It's just Brendon.

#panic! at the disco #brendon urie #viva las vengeance #this ain't it chief #not mad just disappointed #there's always next time #even if i didn't like it i hope you or someone else did #imma make some folks angy bout dis one

[liquidstar]

If my mom sees a significant amount of blood she gets lightheaded, and has fainted on some occasions. Once it happened when we were kids, I wasn't there to witness it but I heard the story from my dad. Basically my brothers, around 7 or 8 at the time, were playing outside while my mom was making their lunch, and she accidentally cut her finger. It wasn't anything serious, but it drew a fair bit of blood and she passed out. My dad saw this and rushed over, but he didn't really know what to do so he just sort of started slapping her to wake her up (not recommended, but he had no idea and panicked)

At that exact moment my brothers both came in from playing, and all they saw was our mom unconscious on the floor and our dad slapping her. So, like, without even saying a word to each other they both just INSTANTLY start whaling on him, like, full blown attack mode to defend our mom. Which obviously didn't help the situation, but she did wake up and everything was fine.

Now our dad says that he's actually really glad they attacked him over what they thought was going on, because it means he raised good boys. And I still think that's true, they're very good boys.

#i think about this story sometimes like yeah I'm proud of them for that too actually. good job baby brothers #they're not babies anymore of course they're turning 20 next year which is crazy #but they're still the type of people who'd do something if they saw something of this sort happen for sure #respectful of women and everyone else too. they're good guys #I'm glad I ended up with them living in my house against my will for like 14 years #anyway i have no idea where i was for all this but my best guess is probably a friends house given the time period #i was always at my besties house lol #i hope she's doing well too actually. haven't spoken in forever... #bestie from greek elementary school... if you're out there... let's get muffins and fanta at the bakery across the street again someday 💜☮️

[cahrolinehasmoved]

me realizing how summer it is and i haven't blasted NKOTB .

#im still bitter i didnt get to see them in concert in atlanta months ago #there's always NEXT TIME #𝐢𝐢𝐢. ⠀𝐎𝐔𝐓 𝐎𝐅 𝐂𝐇𝐀𝐑𝐀𝐂𝐓𝐄𝐑 ⠀ 、 mun speaks ⠀!

[floccinaucinihilipilificationa]

#selfie bee #good evening friends!! how are you doing! C: #I'm very very sleepy I got a new ikea office chair and I build it all myself #I think it went okay! I don't think I pulled the back screw tight enough and now the back is a bit loose #I can probably fix it but I can also ignore it for the next 18 years #thats how long the old chair held up!! in germany it could now drink vodka and drive a car!! #not at the same time that is illegal! not at the same time!! (❁´▽`❁)*✲ﾟ* #but the day is not over yet my uncle asked me for a big art quest and I do not want to disappoint #he wants a muppet tattoo and asked me to draw it #my uncle has started to get tattoos a few months ago #as far as I know he has now gotten 3 note clefs 3 stars a flower and multiple birds #he also started getting piercings but so far I managed not to know exactly where #I think tattoos are super cool (´｡･v･｡｀) I wish I had a good idea for a tattoo but the last time I was very sure about getting a tattoo #it was heath ledgers face as the joker #at that point I was 12 and would not see the actual movie for two more years #a muppet tattoo is a way better idea!! he asked for the count van count! that is also one of my top 3 muppets ₍՞◌′ᵕ‵ू◌₎♡ #I always thought I knew a lot about muppet lore but since I started looking up muppet pictures I think there are still a lot of secrets #can the muppets from the Sesame Street actually leave the Sesame Street? #I think Kermit is both on the Muppet Show and on Sesame Street but he is also like the boss muppet #he might have special abilities #I hope you're having a good day friends!! C: #I think I'll post a Sherlock comic later this week #miss you!! ♥♥♥

[crumb-crumblet-s-crumbington]

uagauauaaaagaauagauauga

#denki kaminari #hanta sero #kamisero #mha #bnha #rewatchjing the show #they like #dont even have any scenes together #HELLP #like #idk where 14 year old me got anything from #like yeha they r always standing next to each other but sero has so little screen time he doesnt even do anything 😭 #crumb cuptoast forever doomed to always like characters who r sidelined

[attleboy]

sorry for making them so miserable lately.... here i can still be nice to them see!!??!!!

big fan of the seamstress ragatha headcanon so here's some buttonblossom with it <3

#i love the hc that pomni has no clue how to dress so its like comfy solid color tshirts and hoodies #and ragatha let her pick but if she had her way pomni would've been dolled up like crazy... oh well... there's always next time #(very unsubtly setting myself up for a pomni in cute clothes post) #buttonblossom #the amazing digital circus #tadc #pomni x ragatha #ragapom #pomni #ragatha #my art

[quarks-pussy]

Remade this post of mine

#and this time i actually spelled his name right 🫣 (tho in my defense it's not like canon always gets it right either lol) #noonien soong #data soong #lore soong #(it is my personal conviction lore is also fully functional. with no ulterior motives whatsoever of course) #star trek the next generation #tng #ah heck it. gonna also tag the misspelling since it's so common #noonian soong #dr soong #star trek #original posts fresh from quark's pussy

[basketobread]

a little warrior to help brighten your dashboard ⭐⚔

ive never animated something like this before so forgive me if its a bit wonky HAHA but i love drawing lil lae'zel so its okay this was really fun huehue <33 shes hugging her favorite sword!!!

#baldur's gate 3 #bg3 #bg3 fanart #bg3 art #baldur's gate iii #baldurs gate #baldurs gate fanart #baldurs gate 3 #lae'zel #bg3 lae'zel #lae'zel of k'liir #baldurs gate laezel #dnd #dnd art #bob the artist #dungeons and drawings #dungeons and dragons #im sorry lae'zel i wish i couldve animated u better but its ok... there is always next time!!!

[royalarchivist]

Over 6 years ago, Technoblade and Etoiles played together on United UHC. Although they never got to meet each other on the QSMP, it's nice to see that they already had some nice banter and a fun dynamic developing during the brief time they knew each other. Here are some highlights from the video where they played together!

Subscribe to Technoblade! Technoblade's United UHC video

[ Part 1 || Part 2 || Subtitle Transcript ↓ ]

-

Technoblade: Bonjour, mis amis! (Hello, my friends!) Oh god, we already have a zombie on us. No! It's targeting me 'cuz I have subs!

Etoiles: Excellent teammates.

Technoblade: Do trees spawn in these worlds?

Etoiles: [Laughing at a screenshot of Technoblade saying "deforestation has gotten pretty bad"]

Technoblade: It's gotten pretty bad, man. What is this?

Etoiles: B-bonjour.

Technoblade: Stop speakin' Chinese.

Etoiles: You're the best Skywars player, dude. That's why.

Technoblade: That doesn't mean much.

Technoblade: Oh my god, I found diamonds!

Etoiles: Oh, whoa.

Technoblade: Subscribe to Technoblade! I'm suddenly a UHC god.

Etoiles: Oh, I got diamonds too! :D

Technoblade: ...Wow, way to ruin my moment. Wow. Can I just have this one moment?

Etoiles: Yeah.

Technoblade: Does everything- does everything need to be a competition? First diamonds I've ever mined in Minecraft.

Etoiles: Let's redo it, Techno. Let's say I don't have diamonds. I don't have diamonds, you have-

Teammate: I found diamonds!

Technoblade: Oh my god.

Technoblade: I have seven diamonds! And I'm not saying that to one-up you, but- I mean I am, but I mean I'm- I'm also tellin' the truth.

Teammate: Nobody knows which one of you guys is the mole.

Technoblade: Yeah, that's gonna be very awkward.

Etoiles: Maybe Technoblade is already-

Technoblade: I'm right behind you.

Etoiles: Technoblade is already saying to his friend-

Technoblade: I'm already in the Mole chat, plannin' your death.

Etoiles: Like, I'm kind of scared of Technoblade, actually.

Technoblade: I'm not even good, why would you be scared of me?

Etoiles: Because you're the King of Bedwars.

Technoblade: Alright, ok, ok, so here's how it works- I get paid per episode, right? So I'm not gonna betray you on Episode 2.

Etoiles: [Laughs]

Technoblade: Now let me enchant.

Etoiles: I'm so bad at hearing sound because when I'm hearing lava-

Technoblade: Nah, it's 'cuz the sounds are in French, isn't it?

Etoiles: [Laughs] I'm gonna kill you, bro.

Technoblade: No!

Etoiles: [Laughs] I'm gonna kill you.

#Technoblade #Etoiles #QSMP #Untitled UHC #Edited #I'll have to upload the next part tomorrow #I decided to add subtitles and that always takes a little bit longer #If it sounds like there's a mic echo it's because there IS a mic echo in the original audio #As always if you have a hard time reading the subtitles please let me know! Happy to adjust the font for the next iteration #been using this one for a hot minute but might switch it up sometime if I find something better #Subtitles #I'll upload the rest tomorrow I've got a few things I gotta wrap up #Portfolio

[nmjackson]

To be honest, I've let my WIP simmer on the back burner lately. I was excited for NaNoWriMo, but I forgot that this is also around the time finals comes around.

#welp shit #I tried #there's always next time #authorblr #writers of tumblr #writers of wattpad #author thoughts #author things #nanowrimo #venting