Tumgik
#regina prime
vestaclinicpod · 9 months
Text
Audio Drama Sunday - 23rd July ✨
This week has been such an amazing week of listening! I’ve found three new shows that I absolutely adore and I can’t wait to tell you all about them ✨
Spoilers ahead!
🌲@hellofromthehallowoods (126) FIRST OF ALL 🚗🚗🚗 BEEP BEEP GET IN LOSER, WE’RE GOING TO GET MOTH 🚗🚗🚗 So glad to hear from you again, Ray!! This line: “the devil’s a better man than I am” had my eyebrows disappearing into my hairline and that’s all I’m going to say at this time. It’s always a risk listening in public, because the scene on the beach made me want to cry a little. I hope in my heart that they’re all going to make it out of there but I have no idea how right now! 
📻 @monstrousagonies (106) the first letter this week made me laugh so much! I was fully expecting the ‘moocher’ to be a brownie or someone like that, so it was a fun surprise to hear of a demonic midnight snacker! I may have to use that excuse when my baked goods don’t turn out so baked or good . . .  
🎞  Tiny Terrors (021) What a welcome VA jumpscare from Mx Wellman!! I loved the story (I, too, would feed the mega-toad to make it happy) but the surrounding footage was really creepy... I sure hope the gang goes to investigate the Riverside Institute. What’s the worst that could happen?? 👀
🌍 OOH the most recent episode of @lastechoespod was genuinely empowering! The political pressure the Archivist is under seems to have ramped up this ep, and reading @skyfullofpods’s thoughts on it last week makes me want to listen to it all again with fresh ears! 
🧛‍♂️ @re-dracula What a great week! Alasdair Stuart nails it as the Captain of the Demeter. His voice in the first ep is the calm surface of the sea, hiding the teeming mass of life and death below. The Renfield arc honestly unsettles me so much, but I, too, would love a kitten if there’s one going spare … 
🧬 Regina Prime (ep 4) The revelations!! I loved the sound design of the getting ready montage in this ep but I loved the lore drop even more! 300 clones?! And cloning is something that’s happening commercially? Damn. The last line actually made me grin, Epsilon is quick-witted and brave (or stupid!) and I like her a lot. Every episode I get more enthralled by this show and everyone needs to be listening! 
 💫 Wolf 359 (20-22) Hot damn. The tension aboard the Hephaestus is something else… the paranoia is written so well, you’re listening with your most suspicious face trying to unpick it and getting nowhere. I love how I have no idea where this is going but I know the ride is going to be BUMPY. 
🎩 I started @ethicstownpod this week and it deserves ALL the hype. The show uses a well-loved audio drama trope to bring us a very interesting new story. The writing and voice acting are spot on from the get-go, and the sound design choices feel fresh despite the radio format. Most podcasts make me feel, but this one makes me think as well! I really love it!! I’ve been following the development of the show on Tumblr for a while and I remember the creator being so excited about January’s VA and yeah, I totally get it. Amazing. Hard to believe the role wasn’t written for him. 
SPOILERS: I love how the main ethical issues are presented while January currently seems oblivious to the ethical quandary of keeping important information from someone and who has the right to make that decision . . . ALSO Artemis and Grace are very close in age . . . imagine if they became friends . . . and then Artemis found out . . . . HOO BOY. 
🥾@doyoucopypod The first two episodes are very promising! In the first ep, the pod-within-a-pod recording leads to some fun & cheesy dialogue which contrasts well with the jaded but wary interludes from [REDACTED]. I love a spooky woodland mystery and I’m really hoping for a Blair Witch style descent into terrifying found-footage chaos! The second episode really tugged on the old heart strings. I need a Does The Dog Die for this show bc I’ve had Wilson for 8 minutes but if anything happened to him I’d make that Dead Zone REALLY much more dead-er. 
🏴‍☠️ @levianpod This show has dropped its anchor right into my heart!!! DAMN. I’ve listened twice this week. I can’t recall the last time I was so immediately ALL-IN for an audio drama. I mean, firstly, that cover art is GORGEOUS. I genuinely think this show has it all, there’s LORE, there’s spiciness, there are sea captains who are also sea monsters (a GIFT for the wlw, thank you 🙏), there’s a teenage romance gone WRONG. Then there’s the voice acting!! Incredible performances right out of the gate. It’s safe to say that I am OBSESSED. Why are you still here? Go fucking listen to Levian. 
🎧 In the most recent ep of The First Episode Of, W Keith Tims talks to Packhowl - a creator I greatly admire. I love these interviews! It’s so fascinating to hear how other creators came to audio drama and it’s shed some of the brilliant The Madness of Chartrulean in new light for me. I miss grumpy space Jesus. 
That's it from me! PLEASE go listen to Ethics Town, Do You Copy and Levian!!
62 notes · View notes
skyfullofpods · 7 months
Text
Happy audio fiction Sunday! Here are my thoughts about some of the podcasts I've been listening to this week, for my weekly Sunday blog post!
21 notes · View notes
fiction-pod-recs · 6 months
Text
For this weeks Fiction Podcast Rec Thursday: 
Regina Prime!
Tumblr media
[Image ID: The cover art for Regina Prime. On a purple background it shows many silhouettes of the same figure with shoulder length hair. As the silhouettes get closer to the front they fade from a bright indigo blue to a pale purple. In the center there is one silhouette that is a light purple, standing out from the rest of the figures. On that figure there is the simplified outline of veins in a bright green with dots of bright yellow wherever the veins meet or split of. At the top it says, "Regina Prime, A Sci-Fi Audio Drama Podcas.t" The words are all in caps, "Regina" is is bright green, "Prime" is in purple, and the rest is in yellow. The top corners have the feint outline of DNA strands in green. ./End ID]
Summary of the show, “Regina Prime follows the search for a 21st Century urban explorer who stumbles onto a disturbing discovery while vlogging an abandoned scientific research facility. This centuries-spanning story explores the sacrifices people make in order to leave an imprint on the world, even if it means hurting others along the way.”
The first season has been completed recently with 10 episodes averaging around 11-ish minutes  in length. From what I know, I do believe a second season is coming but I haven't found any information on that yet. Transcripts are available for all episodes and so are content warnings. Though I would like to add sudden/loud noises are prevalent in many episodes and aren't shown in the notes.
There’s not too much I can say without spoiling something but wow, just wow, the world building is amazing and the plot is so interesting. Like, so much information was revealed in only 10 episodes and it felt so natural it's so impressive! And the mystery! So much world building has been done and it still feels so mysterious in the best ways! The Va gives so much life to the characters and its just aaaa /pos.
You can get updates on this podcast here : https://twitter.com/reginaprime
And I believe this concludes the second installment of fprt! Tell me of anything you’d like to see in my recs or anything you think I could do better, I want to make these helpful. Have a slightly above average day!
17 notes · View notes
arthurdrakoni · 6 months
Text
Regina Prime is a science fiction audio drama, and the latest offering from Jessica Berson. This is my review.
Tumblr media
Regina Prime begins in the form of an urban exploration vlog. We follow a woman named Regina who is exploring an abandoned research laboratory. Everyone starts of pretty normal, but then strange things begin to happen. It also becomes clear that Regina is hiding something. Or perhaps she’s being forced to hide something. Oh, but we aren’t done yet. Each episode is split between Regina’s adventures, and the happenings of another woman. Well, multiple women, and they all have very similar voices to Regina. These women have been kidnapped by a shadow organization that is seeking Regina Prime. Just what is going on here? 
Regina Prime is created by Jessica Berson, who also created the audio drama @echoesinbetweenpod. It was an audio drama that was very much about slowly peeling back the layers of the central mystery like an onion. Regina Prime is very much cut from the same cloth. In fact, I’d argue that it is even more so. Most episodes of Regina Prime are only about half the length of a typical Echoes (in) Between episode. So, I had to be a bit coy with the summary. 
Now, back to the subject of Echoes (in) Between. Those of you who read my review will know that I felt immense guilt for putting off reviewing Echoes (in) Between. This is due to the tragic way in which the show came to an end. To make a long story short, Jessica Berson had a pretty nasty falling-out with her production partner. It is highly doubtful a review from me could have prevented this. All the same, I felt bad after I learned about what happened. However, towards the end of my review, I also expressed confidence that Jessica would one day rise from the ashes like a phoenix. 
My confidence was certainly not misplaced. Jessica has, in addition to Regina Prime, also started an anthology audio drama called Blue Rose Stories. I’m waiting til it has a few more episodes before I review that one. I will say that the episodes that Blue Rose Stories has out so far are really great. 
I first became aware of Regina Prime when I got followed by the show’s Twitter account. I was very pleased to see that Jessica was making another serialized audio drama. I made a note that I was going to be proactive and not drag my feet this time round. I had to take care of a few personal matters first, but here we are now. It seems that Jessica is taking a back to basics approach with Regina Prime. As I have previously noted, the episodes are about half the length of a typical Echoes (in) Between episode. Jessica also provides the voices for all of the characters. She manages to give them all distinct personalities, and that’s no small task, given how similar most of the characters sound. As for why that is, well, that would be spoilers. One of the characters is a computer AI. Jessica considered using an AI voice for the role, but ultimately decided against it. She felt it wouldn’t be the right thing to do.
Have you listened to Regina Prime?  If so, what did you think?
Link to the full review on my blog: https://drakoniandgriffalco.blogspot.com/2023/10/the-audio-file-regina-prime.html?m=0
3 notes · View notes
unesheet · 10 months
Text
Thoughts and theories on Regina Prime The fungus takes the shape and memories of people? Except no, because Delta had a family. It's like an infection/Corruption from TMA and Delta (and all the others) used to be other people and now they're not? And they look like Regina because she was the one who disturbed it? Supported by the series art on Spotify. I opened up the transcript to verify pronouns and found the interrogator is called Omega, which debunks my theory from the first episode that it was a police officer. So is Omega looking for the original to stop the spread?
2 notes · View notes
amongthestackspodcast · 6 months
Text
This week while we're on break, we're recommending a show we think you'd like: Regina Prime from Jess Berson
How much of yourself can you give away before there's nothing left to give?
Regina Prime follows the search for a 21st Century urban explorer who stumbles onto a disturbing discovery while vlogging an abandoned scientific research facility. This centuries-spanning story explores the sacrifices people make in order to leave an imprint on the world, even if it means hurting others along the way.
Here's their first episode: Strangers When We Meet
You can find them on Twitter @ReginaPrime or visit their website for more information
https://ReginaPrime.com
If you have any questions you can email [email protected] or [email protected]
Regina Prime is available everywhere podcasts are found
1 note · View note
aquarterasian · 3 months
Text
Mana prime minister arc lets gooo
Tumblr media
13 notes · View notes
help-the-horse · 1 month
Text
This Mission Just Got A Lot More Complicated
Tumblr media
AO3 Link Summary: Regina Shepard has been posted to the Normandy. She is tasked with reaching the beacon on Eden Prime, even if she is less than thrilled. Pairing: future Kaidan Alenko/Regina Shepard/Ashley Williams Words: 7,218
            “Drift… just under fifteen K.” The pilot spoke from down in his chair. The thought crossed her mind again that he looked far too young to be chosen to pilot the cutting-edge vessel. She was unfamiliar with the lingo.
         “Fifteen is good. Your captain will be pleased.” The Turian Spectre stood next to her. It was hard to tell if he was impressed or not. The tall alien stepped away from the flight deck, seemingly satisfied with what he had seen. Shepard stood stock still as he walked away. Having such a powerful individual on board left her feeling like there was something she wasn’t being told about this mission.
         “I hate that guy.” The pilot spoke, flat. If she could see his face she was almost sure he rolled his eyes. She couldn’t remember his name, or the one from her debriefings at least. Shepard would have to read her files again later to try and memorize more names and faces.
         “Nihlus gave you a compliment… so you hate him?” The man co-piloting glanced over. His question seemed genuine, but his face showed his irritation. If she remembered correctly, he was a lieutenant. She wondered what his story was.
         “Remember to zip up your jumpsuit on the way out of the bathroom, that’s good. I just jumped us half way across the galaxy and hit a target the size of a pinhead.” Joker was what she had heard some of the crew call him, the ones who seemed to remember names and faces, or care enough. “So that’s incredible.” His fingers flew across his screens, the glow of the orange light attempting to warm the cold, metallic space. “Besides, Spectres are trouble. I don’t like having them on board. Call me paranoid.”
         “You’re paranoid.” The lieutenant responded without missing a beat. “The council helped fund this project, they have a right to send someone to keep an eye on their investment.” His argument was convincing at least. He was the biotic she had heard some of the crew talking about. Had thrown a cup at a corporal or something in the mess.
         “Yeah,” Joker scoffed. “That’s the official story. Only an idiot believes the official story.”
         “That’s enough.” Shepard was tired of hearing the two stubborn men argue. “You’re soldiers, act like it.” The irritation in her voice was stronger than she thought it would be. They probably thought she was one of the no-nonsense types. At least it covered up the nerves she felt, her feelings affirmed since the pilot felt something was off too.
         “Sorry, Commander.” Alenko was his name, it finally came to her. He kept his eyes down to his screen. She wondered how he made it so far when he seemed so sensitive to harsh tones.
         “Joker, status report.” Captain Anderson’s voice came over the flight room comms. She had remembered his name correctly, at least. Someone with all his decorations stood out, even amongst the various commanding officers she had encountered.
         “Just cleared the mass relay, Captain. Stealth systems engaged. Everything looks solid.” Joker’s pride was unmistakable.
         “Good.” Captain Anderson didn’t comment on the tone of the report. “Find a comm buoy and link us into the network. I want mission reports relayed back to Alliance brass before we reach Eden Prime.” That was right, even the flight itself was considered a mission of its own on this ship. Shepard felt her regret at taking the assignment again, everything was too official, too political. She clenched her jaw. Trusting her gut had gotten her through her life, through her training, through Torfan. There had been too many politics involved with that mission too.
         “Better brace yourself sir, I think Nihlus is headed your way.” Shepard had missed what Joker had been saying, but the mention of the Spectre brought her back.
         “He’s already here, Lieutenant.” The harsh tone in the response made Shepard raise her eyebrows. Now his mouth had gone too far, she wondered how the pilot would react. “Tell Commander Shepard to meet me in the comms room for a debriefing.”
         “You get that Commander?” Joker turned his head to see her out the side of his eye. He seemed a bit more serious now, at least.
         “Great.” She frowned, sarcasm coloring her words. “You piss the captain off and now I’m going to pay for it.” She didn’t wait to finish her sentence as she turned to walk away.
         “Don’t blame me.” Joker lowered his voice, but it was loud enough for her to hear as she slowed her steps. “The captain’s always in a bad mood.”
         “Only when he’s talking to you, Joker.” The co-pilot was almost teasing. He seemed too genuine for a high class, heavily political mission. But she wasn’t the best choice either.
         She started walking again, past all the control terminals, hearing various chatter around her. The entire crew seemed to be in a buzz, the energy reflected in the urgent tones and hurried feet all around her. She had always hated being part of the rumor pipeline on deck, but the Navigator’s conversation caught her ear.
         “And we’re getting dragged right along with him!” He stood at his terminal, typing away as he spoke in front of the galaxy map.
         “Relax, Pressly.” An unconcerned voice leaked out of his earpiece. “You’re going to give yourself an ulcer.” Pressly turned his attention away from his work, saluting Shepard once he noticed her. He was on the older side of the majority of crewmates she saw, might have had a position during the First Contact wars. She was willing to bet he had made his career through trusting his gut feelings too, at least to an extent.
         “Congratulations, Commander.” he nodded as he dropped his hand to his side. “Looks like we had a good run. You heading down to see the captain?” Shepard couldn’t help but feel suspicious he was trying to get information to fuel the chatter on deck.
         “Seems like you don’t trust our Turian guest?” She had always liked to know everything she could about how the crew was feeling. Who agreed with her was important, maybe she was part of the gossip she hated so much.
         “Sorry Commander.” Pressly kept professional. “Just having a chat with Adams down in engineering. Didn’t mean to cause any trouble.” His eyebrows came together as he spoke. “But you have to admit, something’s odd about this mission, the whole crew feels it.” He was genuinely concerned now.
         “Info’s on a need to know basis, Pressly.” She diverted his probe for information outright. “Just follow the orders you’re given.” Shepard hated that she didn’t have much information to give, even if she wanted to. She walked on after a salute and confirmation. She could see the lead medic on board talking with a soldier, still in his on-board uniform, hat and all.
         “It’s not the kind of place Spectres visit.” the soldier continued, leaning against the wall. “There’s something Nihlus isn’t telling us about this mission.” Shepard remembered Nihlus had held an optional meeting for the crew once word got around he was on board. She didn’t have time to attend since she had chosen to gear up so early before landing. The armor and the guns were more useful protection than all the information in the galaxy.
         “That’s crazy.” The medic waved him away. “The captain’s in charge here, he wouldn’t take orders from a Spectre.”
         “Not his choice, Doc.” He shrugged, his arms crossed. “Spectres don’t answer to anyone. They can do whatever they want. Kill anyone that gets in their way.” He seemed dead serious. The medic laughed it off.
         “You watch too many spy vids, Jenkins.”
         “What do you think, Commander?” Jenkins saluted. It was odd when everyone on deck seemed to respect her only because of her rank. Maybe she was right to be worried about rumors. “We won’t be staying on Eden Prime very long, will we?” He sounded young. “I’m itching for some real action!” And he was naive.
         “I sincerely hope you’re kidding Corporal.” The doc had become serious now too. “Your ‘real action’ usually ends with me patching up crew members in the infirmary.”
         “Marines are meant to fight.” Shepard looked between the two, rolling her shoulders. “You just fix us up when we’re done.”
         “I know how things work, Commander.” Her irritation was not hidden. “I’ve seen my share of combat, but it’s foolish to go looking for trouble.” Maybe Shepard had judged her too quickly. Most medics spent too much time in books. “You could both take a lesson from the captain. He’s not afraid of combat, but he knows the value of restraint too.”
         “Sorry Doc.” Jenkins sounded persuaded by her words. Shepard was just angry a medic was trying to teach her what combat was like. “But this waiting’s killing me. I’ve never been on a mission like this before. Not one with a Spectre on board!” The excitement slowly creeped back into Jenkins’ voice.
         “The captain’s waiting for me.” Shepard started to walk away before Doc could even get out a goodbye. She took a deep breath to try and quell her frustration. She didn’t want to get off on the wrong foot and say something stupid, or dangerous. She stepped into the circular meeting room. The space felt strangely empty compared to the main deck, the hum of the ventilation replacing the hum of the crew. Nihlus was the only one standing before her, facing a large screen. The back of her neck prickled as she crossed the space separating them, leaving a comfortable distance in front of the Turian.
         “Commander Shepard.” he crossed his arms. His expression was hard to read, partly from the unfamiliar features, partly from the high contrast patterning over his face. “I was hoping you’d get here first. It will give us a chance to talk.”
         “What about?” She struggled to keep her voice and expression even. She hoped her eyes didn’t show her distrust.
         “I’m interested in this world we’re going to, Eden Prime.” Nihlus turned and took a few steps, starting to pace. “I’ve heard it’s quite beautiful.” He stopped in front of her.
         “I’m a marine, not some tourist on vacation.” Shepard’s shrug and biting response didn’t seem to bother Nihlus, who remained confident and cunning.
         “It’s more than a tourist destination, isn’t it Shepard?” His words felt patronizing. “Eden Prime is a symbol to your people. A perfect little world on the edges of your territory.”  He got more serious, glancing back at the paused video on the screen, showing some vaguely familiar flora of the habitable planet. “Proof that not only humans can establish colonies across the galaxy, but also protect them.” He turned his back to Shepard. “But how safe is it, really?”
         “Are you trying to scare me, Spectre?” She bristled, taking a few steps closer to the Turian. He faced her again, his movements rigid with practiced discipline.
         “Your people are still newcomers, Shepard.” Some sense of sympathy leaked into his tone, quickly replaced with annoyance. “Is the Alliance truly ready for this?”
         “I think it’s about time we told the Commander what’s really going on.” Captain Anderson took away her attention, walking quickly to stand next to her. How long had he been listening?
         “This mission is far more than a simple shakedown run.” Nihlus addressed her. Shepard was unnerved by the seriousness he now had.
       ��    “I already figured that out.” Was her flat reply. She hated when others assumed she was just a body with a gun. She had plenty of brain too, when it counted.
            “We’re making a covert pickup on Eden Prime.” Captain Anderson stopped her from glaring at the Spectre any longer. “That’s why we needed the stealth systems operational.”
            “I don’t like being kept in the dark, Captain.” She always made her voice heard to her superiors when it mattered. And secrets got people killed.
            “This comes down from the top, Commander.” Anderson pointed a finger from down at his side, warning her to watch what she asked for. “Information on a strictly need to know basis.” He marked his words with a gesture of his hand. “A research team on Eden prime unearthed some kind of beacon during an excavation. It was Prothean.” Shepard followed him with her eyes as Anderson moved to stand beside Nihlus.
            “What else can you tell me?” She understood from Anderson’s tone that the Prothean piece of information was important, but Shepard wasn’t sure why. She could trust intel from him though, and she was finally getting information.
            “This is big, Shepard.” He paused to drive home his point. “The last time humanity made a discovery like this, it jumped our technology forward two hundred years.” Anderson had a skill for making you feel informed, but not stupid. “But Eden Prime doesn’t have the facilities to handle something like this. We need to bring the beacon back to the Citadel for proper study.”
            “Obviously this goes beyond mere human interests, Commander. This discovery could affect every species in Council space.” Nihlus interjected.
            “We can handle this on our own.” Shepard bit back even harsher words. She didn’t answer to the Spectre, or care about what he was here for.
            “Unless something goes wrong.” he warned dangerously, walking to stand closer to her.
            “There’s more, Shepard.” Anderson spoke from where he stood, Shepard’s gaze still fixed on the Spectre. “Nihlus isn’t just here for the beacon. He’s also here to evaluate you.”
            She was getting tired of this ‘there’s more’ act. “Since when do we answer to the Spectres?” She couldn’t keep the anger from her voice.
            “You’re smart enough to know how things work, Commander.” Anderson wandered forward, shrinking the circle of space between the three of them. “The Alliance has been pushing for this for a long time. Humanity wants a bigger role in shaping interstellar policy. We want more say with the Citadel Council.” Shepard couldn’t help but feel cornered. “The Spectres represent the Council’s power and authority.” He punctuated his words, dropping a fist into his other hand. “If they accept a human into their ranks, it shows how far the Alliance has come.”
            “I was impressed when I studied the reports from Torfan.” The Spectre looked down at Shepard, studying her in a way that supported her caged animal sympathies. She couldn’t stop the way her face tensed when he mentioned Torfan. “A grim business… but you got the job done.” He let the words hang for half a second. “That’s why I put your name forward as a candidate for the Spectres.”
            Shepard could feel her ears getting hot with frustration. “I don’t like people making decisions about my future.” She was sure her anger was evident on her face now, and she didn’t care to hide it.
            “This isn’t about you Shepard!” Anderson’s sharp response drew her full attention, her eyes fixed firmly on her captain. “Humanity needs this. We’re counting on you.”
            “I need to see your skills for myself, Commander. Eden Prime will be the first of several missions together.” The prospect of working with Nihlus repeatedly nearly made her step out of the room. Anderson began, cutting off whatever she might have said.
            “You’ll be in charge of the ground team.” The knowledge she was in control of a team cooled the worst of her anger. “Secure the beacon and get it onto the ship ASAP. Nihlus will accompany you to observe the mission.”
            “Just give the word Captain.” She resigned herself to the orders. As long as the Spectre stayed in his lane, and she could control her team, she would make it through the politics.
            “We should be getting close to Eden-”
            “Captain!” Joker’s panicked call came over the speakers, cutting Anderson off. “We got a problem.” Anderson glanced up to the ceiling, questioning the pilot. “Transmission from Eden Prime, sir. You better see this.”
            “Bring it up on screen.” The tension in the air changed. They all turned their attention to the now changed screen, gunshots coming through the audio. The vid was low quality, shaky. A young soldier ran into center frame, throwing the person filming to the ground with a gruff order. The soldier remained in frame and shot off a few rounds, her white armor scuffed and dirty. Explosions seemed to go off, close, the camera continuing to shake and stutter. Shepard glanced over to Anderson, his face guarded. The camera seemed to be grabbed, an additional man in green gear speaking quickly.
            “We are under attack! We are taking heavy casualties, I repeat, heavy casualties!” The desperation made the blood start pounding in Shepard’s ears. “We can’t-” The soldier was cut off by an explosion, making the video feed little more than blurs of colors and static. “-need evac, they came out of nowhere! We need-” His repeated call for help got cut off, a sound of cracking armor and the soldier going limp, dropping the camera. It seemed to get thrown around for a moment, another soldier’s face coming into frame for a moment before turning to some great shape in the sky. The feed cut to pure static.
            “Everything cuts out after that, no comm traffic at all.” Joker seemed like he was a nervous talker. “Just goes dead. There’s nothing.”
            “Reverse and hold at thirty eight point five.” Anderson nodded his head to the screen like Joker could see him. There probably were cameras connected between comms and the flight deck. The shape in the sky came back on screen, looking almost like a divine hand. It was grainy footage, but there were seams and lights on the thing, deep reds glowing out from under reflective and metallic midnight purples. It wasn’t something Shepard had ever seen, and by the way Anderson went pale, and Nihlus’ mandibles twitched, neither had they.
            “Status report.” Anderson had his usual order giving tone. He didn’t betray his nerves if he felt any.
            “Seventeen minutes out, Captain. No other Alliance ships in the area.”
            “Take us in Joker, fast and quiet.” Anderson shared a look with Nihlus, the large brooding shape next to him. “This mission just got a lot more complicated.” The turian seemed concerned as he looked at Anderson, maybe. Shepard still couldn’t really read his expression.
            “A small strike team can move quickly without drawing attention.” Nihlus was all serious. “It’s our best chance to secure the beacon.”
            “Grab your gear and meet us in the cargo hold.” Anderson called after Nihlus as he walked away. He started to peel his eyes away from the video display. “Tell Alenko and Jenkins to suit up, Commander. You’re going in.” His voice dropped as he turned to Shepard. She found herself stuck staring at the larger than life thing still on screen, freeze framed. Her gut told her this was going to be bigger than she wanted it to be, and she was at the center of it all again.
            “Your team is the muscle in this operation, Commander.” Anderson spoke over the loud sounds of the ship’s drop deck. “Go in heavy and head straight for the dig site.”
            “What about survivors, Captain?” Alenko spoke up from behind Shepard. He had been the one in the flight deck with Joker earlier and was quick to suit up and report once she called him. Survivors were a valid concern.
            “Helping survivors is a secondary objective!” Anderson raised his voice even louder as the cargo ramps opened and lowered, natural light flooding the space, causing all of them to blink quickly to adjust. “The beacon’s your top priority!”
            “Approaching drop point one.” Joker’s tone had calmed down significantly from the last time she heard him, his voice coming through the deck speakers as well as her earpiece.
            “Nihlus, you coming with us?” Jenkins turned his attention to the Spectre, standing with his gun at the ready a few steps away from the four humans.
            “I move faster on my own.” Was his only response as he jogged out of the ship, the wind rushing around the cargo bay.
            “Nihlus will scout out ahead. He will feed you status reports throughout the mission. Otherwise, I want radio silence.” Anderson looked the three of them over, his dark eyes landing on Shepard.
            “I don’t like putting my life in the hands of a turian, sir.” This was another time to make her opinion known. The brass couldn’t blame her for something going wrong if all the reports said she was against the methods of the mission from the start.
            “Nihlus is on our side. He wants you in the Spectres, and he wants that beacon.” Anderson attempted to reassure her, again.
            “Ready and able, sir.” She nodded. The way Anderson looked at her said all the words he didn’t have the space to say out loud. He was choosing to trust her, despite her protests, and maybe even his own doubts. She would do her job and do it well.
            “The mission is yours now, Commander. Good luck.”
            Her feet hit the ground hard. Ash and embers floated through the air, plumes of black smoke scattered in the sky. She ignored the report from Jenkins, hoping the silence would give him enough of a hint to keep the chatter down. She drew out each of her guns before putting them back, landing on her assault rifle. One last check everything was in working order, at least for now. She began to jog forward, the green trees and grass around her looking sickly from the smoke tinted light.
            “This place got hit hard, Commander.” Nihlus’ voice came over her personal channel. “Hostiles everywhere. Keep your guard up.”
            “What the hell are those?” Alenko spoke up from behind her, his voice tense, his gun drawn and pointed at a small group of strange, floating, spherical creatures.
            “Gas bags.” Jenkins responded casually. “Don’t worry, they’re harmless.” Shepard shot one to be sure, making Alenko jump with a curse as it forcefully burst, bright green painting the grass around it. They continued past the creatures, keeping a wide berth, moving up a small hill.
            “It smells like smoke. And death.” Alenko’s voice was hushed, the three of them taking a knee as Shepard held them up, surveying the area below them. “Watch your targets,” Alenko kept his eyes trained on the terrain when Shepard turned to look at him. “Could be friendlies.” She nodded and motioned them onward with a hand signal. She moved to stand, but hesitated. Jenkins rushed ahead, but Alenko was uneasy too, his steps slow through the many large rocks dotting the small valley.
            Movement caught her attention. Shots were fired before she could aim properly or verify the targets, Jenkins collapsing with a pained sound. Alenko took quick cover, firing a few shots from his own weapon. They were three drones, the enemies that had shot at Jenkins. They were taken down with four shots, each blowing shrapnel out as they erupted in fire. Shepard rushed forward to get down next to Jenkins’ limp shape crumpled in the dirt. Alenko was already there, his hand over Jenkin’s eyes.
            “Ripped right through his shields.” He stood and turned to her, his strong features covered in remorse. “Never had a chance.”
            “Leave him.” She frowned down at the corpse, shifting her grip on her gun. A twisted part of her felt a muted sense of superiority over the fallen soldier. He had been careless and juvenile, and he had paid with his life. “We need to finish the mission.” Alenko only gave an affirmative and a nod. If he felt she was heartless, he didn’t show it. Still burning fires cracked at the edges of the valley as they continued up. The position was vulnerable, and she was down a man barely minutes after drop. At least Alenko could corroborate her story that Jenkins had been a fool. They crept their way onward, occasionally stopping to dispatch a few more of the drones. They were weak, but dangerous nonetheless. She kept them behind cover, only exposed for moments at a time as they progressed cautiously.
            “I’ve got some burned out bodies here, Shepard.” Nihlus’ graveled voice made her pause for a step. “A lot of bodies.” He was grim. “I’m going to check it out. I’ll try to catch up with you at the dig site.” He silenced the channel. The tree trunks around them grew thicker, hiding more drones. Alenko took one out that surprised her. He was a good aim, at least.
            They both focused their sights down field as they came over a small slope, a white form dashing across the opening below them, drones shooting in pursuit. The person, Shepard realized what it was, had gone out of view behind a rock, forced to the ground as their shields flashed around them. A few returning shots were fired, taking out the drones. The single moment of quiet was broken by a horrific metallic noise, a white spike erupting from a distant device, at least ten feet high. Shepard could feel her face fall as she realized a body was skewered clean through on the end of the spike, resting about a quarter from the top, arms and legs hanging limply. The person who had been running was now sitting on her heels, gun at the ready, behind the rock that had blocked her from view.
            Shepard dashed forward, taking cover beside the soldier. It was a woman, wearing the same uniform she had seen from the emergency transmission video. She wondered if it was the same person, taking aim and firing at the two hostiles she could see. The projectiles made them sound metallic when they hit humanoid shapes that moved strangely. They fell to the dirt quickly.
            “Thanks for your help, Commander.” The woman spoke, full of breathless relief.  “I didn’t think I was going to make it.” She stayed sitting, clutching her gun to her chest, her eyes turned to the hazy orange sky. Alenko slid in next to them, all three of them keeping in cover. “Gunnery Chief Ashley Williams of the two twelve.” Williams, that was the woman’s name. She swallowed hard and took a few more breaths. “You the one in charge here, ma’am?” Williams met Shepard’s stern eyes, a smile twitching on her lips. She must have needed rescuing if she was happy to see Shepard, it was rare for even the friendliest of people to greet her with a smile.
            “I need a status report.” Shepard saw Ashley swallow again, still panting. “Now.”
            “Oh man…” Williams coughed, wiping a hand across her mouth. “We were patrolling the perimeter when the attack hit.” she stood, motioning in a vague direction. “We tried to get off a distress call, but they cut off our communications.” Williams was finally getting her breath back. “I’ve been fighting for my life ever since.” She was truly desperate.
            “Where’s the rest of your squad?” Shepard asked, hearing Alenko walk behind her. He was staying vigilant, she could trust him to watch her back.
            “We tried to double back to the beacon.” Williams sounded like she was still in disbelief. “But we walked into an ambush. I don’t think any of the others…” She seemed to catch herself from saying something. “I think I’m the only one left.”
            “This isn’t your fault, Williams.” Shepard allowed herself a moment of sympathy, her face softening as she studied the woman before her. She knew she would have appreciated the words after Torfan. “You couldn’t have done anything to save them.”
            “Yes ma’am.” Williams nodded, her expression stern. “We held our position as long as we could. Until the geth overwhelmed us.” She seemed to have accepted that her actions were satisfactory, at least for the moment.
            “The geth haven’t been seen outside the Veil in over two hundred years.” Alenko’s eyebrows were drawn together in confusion. “Why are they here now?”
            “They must have come for the beacon.” Williams shrugged as the attention landed on her, like she could answer the question. “The dig site is close, just over that rise.” She motioned to the small uphill incline at the end of the valley. “It might still be there.”
            “You’re coming with us, Williams.” Shepard made the executive decision. “We need that beacon.”
            A harsh look came over Williams’ face, determined and angry. “Aye aye, ma’am. It’s time for payback.” Her tone was venomous.
            “Move out!” Shepard barked the command. Two capable soldiers at her side set her itching to reach the beacon, fulfilling their objective. Before they moved on, Shepard stopped to stare up at the hanging body on the white spike, bright red dripping down the seamless surface. The other two joined her, mesmerized and horrified by the gruesome sight. Shepard continued up the rise without a word.
            The dig site was cleared quickly. The geth were strange enemies, the glowing lights that seemed to replace their heads easy targets, their aim steady and precise. They were machines, but more complex than Shepard had ever seen. Even the few high security research labs she had visited had nothing compared to the construction of this new foe. She wished she could remember anything about them from her galactic histories classes, but she never was bookish enough to remember everything she learned. The squad stood gathered around a circular platform, loose dirt and rock still showing proof of excavation.
            “This is the dig site. The beacon was right here, it must have been moved.” Williams shook her head in frustration. Alenko met her with a level gaze.
            “By who? Our side, or the geth?”
            “Hard to say. Maybe we’ll know more after we check out the research camp.”
            “Let’s get moving.” Shepard wanted to keep their momentum, she knew time was against them. “Williams, where’s the research camp?”
            “Just on the top of this ridge, up the ramps.” Williams responded. She was easy to ask questions, always ready to give a clear response. Shepard appreciated soldiers like that. Nihlus cut through her thoughts as she looked around the dig site for anything useful.
            “Change of plans, Shepard. There’s a small spaceport up ahead. I want to check it out. I’ll wait for you there.” He silenced the channel again before a response.
            “Looks like they hit the camp hard.” Williams set her jaw as she surveyed the burning wreckage around her.
            “It’s a good place for an ambush.” Alenko kept his voice low, all of them with their guns at the ready. “Keep your guard up.”
            The large white spikes were plentiful now, a single body hanging from each one. There were at least a dozen, the corpses on them thin, the skin turned an inky blue, light markings in the same pattern on each. The trio snapped at the sound of one of the spikes retracting, telescoping back into its base. The corpse that laid there suddenly twitched.
            “Oh God, they’re still alive!” An edge of panic came through Alenko’s words.
            “What did the geth do to them?” Williams sounded appalled, the body twisting and jerking to life, the lighter blues on it glowing and sparking. The beast started running aimlessly, soon locking in on Shepard with its inhuman icy blue orbs where it used to have eyes, its jaw hanging open in a silent scream. She shot the thing, moving for cover as more of the spikes retracted. That wasn’t something human, not anymore at least. The groans the things let out as they died made the hair on Shepard’s arms stand up. The area was cleared, a single building across the small clearing catching all their attention once the threat of attack was temporarily set aside.
            “That door is closed. Security lock’s engaged.” Williams gave Shepard a knowing look. They both stood on either side of the door as Alenko brought out his omnitool, hacking the lock. Shepard looked inside first, lowering her weapon and stepping into the small room. The other two followed.
            “Humans. Thank the Maker.” The relief in the woman was clear. She seemed like some researcher from the badge on her arm and her lab uniform.
            “Hurry,” A nervous whisper brought attention to the man, hunched with his back to the wall in the corner. “Close the door! Before they come back!”
            “How did you end up in this shed?” Shepard docked her gun onto her back. The building really was little more than a shed, maybe ten by twenty feet. There were a few crates, a set of bunks, a small light. It was nearly empty, but the small space felt full with five people occupying the space.
            “We hid here during the attack. They must have come for the beacon.” The woman responded. “Luckily, it wasn’t here. It was moved to the spaceport earlier this morning. Manuel and I stayed behind to pack up the camp. When the attack came, the marines held them off long enough for us to hide.” The way the woman’s voice got thick bothered Shepard. “They gave their lives to save us.”
            “No one is saved!” The anguished words came from the man, fussing with his gloves, still huddled in the corner. “The age of humanity is over. Soon, only ruin and corpses will remain.”
            “What’s wrong with your assistant?” Shepard turned to the woman, annoyed.
            “Manuel has a brilliant mind, but he’s always been a bit… unstable.” The woman tripped over her words at the blunt question. “Genius and madness are two sides of the same coin.” She looked at him, concern tracing her face, speaking almost to herself.
            “Is it madness to see the future?” The man’s anxious ramblings continued. “To see the destruction rushing towards us? To understand there is no escape, no hope? No, I am not mad. I am the only sane one left!” His voice was hoarse, his eyes wildly scanning the floor as he wrung his hands.
            “I gave him an extra dose of his meds after the attack.” The woman looked him up and down, unsettled by his paranoia.
            “Say goodnight, Manuel.” Shepard couldn’t keep the sadism from her words. The man hardly had time to take in another breath before she knocked him on the side of the head, his body dropping limp with a dull thud.
            “Oh my god!” The woman cried in surprise. Williams and Alenko had both flinched back at the sudden movement. “What did you do?” The researcher mustered up the most anger she had probably ever felt into her accusatory question.
            “That might’ve been a little extreme, Commander.” Alenko seemed almost disappointed, wary even. Shepard felt her eyebrows draw together in frustrated thought as she looked away from him. She didn’t like how she felt at the thought of him disapproving of her actions.
            “You can’t just go around whacking people in the head!” The woman was still throwing a fit.
            “It was only a matter of time before he did something crazy.” Shepard pointed down at the unconscious man harshly. “And dangerous.” She had seen people turn hostile under stress, military and civilian.
            “I guess you’re right.” The researcher still looked frustrated. “At least by the time he wakes up, the meds will have kicked in.” Shepard turned to head for the door.
            “Williams, take us to the spaceport.” Shepard didn’t bother to hear what the researcher said as they all stepped back out into the smoking wasteland.
            A distant, powerful gunshot echoed off the rocks. They all moved on double time, standing on the crest of the ridge. An exclamation from Alenko made Shepard look up, her eyes going wide as dread settled in the pit of her stomach. The thing she had seen on the vid was in front of them, rising into the sky, a distant thundering sound reaching them even at their far distance. It was the largest mass she had ever seen take flight, and now she couldn’t blame the poor video quality playing tricks on her eyes.
            “It’s a ship!” Williams was as much in disbelief as Alenko sounded, as Shepard felt. “Look at the size of it!” They were all frozen, overcome with awe. The black smoke that billowed out from between its finger-like appendages looked toxic, a red glow suggesting some kind of burning thrusters. No ship of that size could run on combustion. Its narrow, upright body looked strangely organic compared to the straight lines and metallic surface. Shepard had seen space stations smaller than the impossible ship. They all stared until it disappeared from view.
            The space erupted into combat again. This time there were the geth in addition to the humanoid monsters, a dozen enemies scattered amongst the wreckage of whatever structure had been here. Shepard found herself satisfied with the performance of her crew, Alenko’s biotics used impressively. Williams knew how to shoot, the three of them spreading out and clearing the field efficiently. She couldn’t remember the last time she didn’t have to give her crew play by play orders. They advanced as a unit to the spaceport, a shape catching Shepard’s eye as they moved to investigate.
            “Commander…” Alenko knelt next to the shape. “It's Nihlus.” He looked up from what she now recognized as an armored Turian body, the contrasting white stripes lining his face making his identity indisputable.
            “A Turian?” Williams looked between Shepard, Alenko, and the corpse. “You know him?” Shepard only nodded as she gritted her teeth.
            “He’s a Spectre. He was with us on the Norm-”
            “Something’s moving!” Williams readied her gun, her alarm cutting Alenko off. “Over behind those crates!” Alenko was on his feet, all three of them focused down their sights.
            “Wait!” A panicked cry came from the man who was standing slowly, his arms raised in surrender. “Don’t shoot!” His voice trembled. “I’m one of you, I’m human!” He lowered his hands. It took Shepard a moment longer to lower her gun.
            “I like the way you hid behind those crates during the fight.” Sarcasm dripped from every word. “Really helped us out. Thanks a lot.”
            “Me?” The man was baffled. “But I’m just a dock worker! I don’t even have a weapon!” He took a breath. “My name’s Powell. I saw what happened to that Turian. The other one shot him.” He glanced at the body at Shepard’s feet, quickly looking away.
            “What the hell are you talking about?” Shepard was getting tired of feeling one step behind.
            “There were two Turians here, your friend and another one he called Saren.” The dock worker brought his hand to his mouth. “I think they knew each other. Your friend seemed to relax, he let his guard down.” A gaunt look took over the man’s face, his skin turning a faint green. “And Saren killed him. Shot him right in the back. I’m just lucky he didn’t see me behind the crates.”
            “Where’d Saren go after he killed Nihlus?” Shepard didn’t bother insulting the man for his cowardice, she needed to keep moving.
            “He jumped on the cargo train and headed over to the other platform. Probably going after the beacon.” His voice was unsteady. “I knew that beacon was trouble. Everything’s gone to hell since we found it. First that damn mother ship showed up, then the attack.” His tone turned to dismay. “They killed everyone, everyone! If I hadn’t been behind the crates, I’d be dead too!”
            “We need to find that beacon before it’s too late.” Her patience was growing thin with this sniveling dock worker.
            “Take the cargo train. That’s where the other Turian went. I can’t stay here…” The man started to walk away. “I have to get away from all this.” He disappeared between the crates again without another word. Shepard motioned for them to move out despite an asking look from Alenko.
            The geth had been plentiful as they fought their way to the cargo train, and then off of it. The cover was thin but plentiful, and the team moved efficiently. They had even watched over Shepard as she worked to disarm a handful of charges the geth had set up. She had managed to get the job done, despite her being mystified at the technology they used for their bombs. She had tried a few times to use her own biotics, but they still felt foreign and ineffective. They had even faced more of the strange human husks, one getting close enough to claw at Shepard before a biotic throw from Alenko had gotten her enough distance to shoot it. They had a moment of stillness now, the tall structure in front of the three of them a welcome sight.
            They had reached the beacon.
            It stood proud, almost humming with energy, a strange green field surrounding it. Its construction was strange, different from any alien architecture she had seen in any vid or textbook. She brought a hand to the ear piece built into her helmet, tuning the frequency.
            “Normandy, the beacon is secure. Request immediate evac.” Shepard looked to the sky, hoping to maybe see the Normandy on standby somehow. She was ready to get out of a hot zone and accomplish this mission, even if there were losses to contend with. She turned to see Alenko and Williams taking cautious steps towards the beacon.
            “Actual working Prothean technology, unbelievable!” Alenko looked on with astonishment.
            “It wasn’t doing anything like that when they dug it up.” Williams was casual as she turned away from the beacon. Her tone betrayed her uneasiness.
            “Roger, Normandy. Standing by.”  Shepard heard Alenko mumble something else to himself. Her eyes were trained on the smoke filled sky. Williams came to stand in front of her.
            “Commander?” Williams tilted her head to the side, drawing Shepard’s focus. “I’m glad you came along when you did.”
            “Just following orders, Williams.” Shepard dropped her hand from her ear piece. “You carry yourself well on the field.” The compliment seemed to surprise the other woman. A flash behind her distracted Shepard from what she was saying.
            Some force was drawing Alenko towards the beacon, the tall structure glowing and pulsing, his boots skidding along the floor. Shepard pushed Williams aside, dashing to tackle Alenko around the waist, pulling him back down to his feet. He held his head in his hands, doubled over. Shepard could still feel the force pulling them both, like she had an internal magnet drawing them to the beacon. She used what strength she had to roll Alenko away, trying to escape the pull. She heard shuffling of feet as she felt her pulse pound, panic overwhelming her.
            Dread choked the air out of her lungs, the muscles across her entire body going stiff against her will. She could feel her heart pound in her chest, unable to choke in any breath as her nervous system fought for oxygen. Pictures flashed across her vision, horrid and grotesque, unbelievably vivid but passing through her too quickly to process. The tinted sky of Eden Prime had been shoved away, leaving her stuck in an unending experience of terror and sorrow and pain. The experiences burrowed into her, leaving her in complete nothingness just as quickly as they had worked to fill every part of her.
2 notes · View notes
lesbicastagna · 2 years
Text
mi sono svegliata pensando a come da piccola "odiavo" le cose romantiche (perché avevo 12 anni ed ero una lesbica repressa) ma ci sono comunque delle scene in film o libri con cui ero ossessionata e che sono così romantiche in realtà. ossessionata con l'amore da sempre
3 notes · View notes
themnmovieman · 24 days
Text
Movie Review ~ Música
Spinning the struggles of self-discovery, romance, and family dynamics into a sonically rich celebration, Música is the kind of film you’ll happily turn the volume up for.
Música Synopsis: A young man, plagued by the music in his head, has to come to terms with an uncertain future while balancing love, family and Brazilian culture in Newark, New Jersey.Stars: Rudy Mancuso, Camila Mendes, Francesca Reale, Maria Mancuso, J.B. Smoove, Andy Grotelueschen, Camila Senna, Regina SchneiderDirector:  Rudy MancusoRated: PG-13Running Length: 91 minutes Review: Filmmakers…
Tumblr media
View On WordPress
0 notes
vestaclinicpod · 10 months
Text
Audio Drama Sunday - 9th July ✨
For a good long while now, I've been sharing my weekly thoughts on the fantastic audio drama I've listened to each week on Twitter... I think it's time to start sharing them here too!
I’d love to start by shouting out @tellnotalespod’s S2 crowdfunding campaign. I need to know what happens to these characters like I need air to breathe and I have a specially vested interest as I’m going to be playing a really sweet ghostie this season. PLEASE let’s make this happen!!  
🌲Happy birthday to Mx Wellman, the @hellofromthehallowoods creator! I listened to this week’s episode while cycling to and from work and happened to be wearing leggings with lightning bolts on them…. You can imagine how FAST I got home during Olivier’s affirmations! 
📻 (104) The first @monstrousagonies letter made me so sad for the writer but really raises such a good point about how to cope with people doubting the authenticity of your identity. I especially feel that this is important when people enter more diverse (often online) spaces and meet people who have identities that you may not have met otherwise. If a new identity resonates with you, you can explore that! “And if you do decide that transformation is right for you, well. Welcome home.”
🌒 (S4E17) OUGH I don’t want to spoil anything because today’s Moonbase Theta Out (@monkeymanproductions) episode isn’t out at the time of writing but oh my GOD. BRACE yourselves. You’re going to cry, you’re going to laugh, you’re going to wish you could act HALF as well as Tau Zaman and Cat Blackard!! I am SO excited for the season finale - I’m sure it’s going to be … explosive. 
🧛‍♂️ @re-dracula Renfield time! I was so confused about this part of the story when I first read it, but the team are doing an amazing job of bringing it to life! 
🧬 Ep 3 of Regina Prime was great! Poor Prime, she’s wandering into something far greater than she could have ever anticipated and I love the contrast between her cheerful exploration and the jaded additions from Omega. I’m enjoying this so much!! 
 💫 This week I listened to episodes 7-9 of Wolf 359. I love Doug and Hera’s relationship. I’m not sure if the genre of the show is going to shift over time, but I’m really enjoying how it’s falling in the same weird place as WTNV where the events are strange and a little uncomfortable, but you’re always waiting for the punchline. 
Hope everyone has a lovely week! I’ve told myself that I’m going to wrap up writing S2 of The Vesta Clinic by the end of the month and it’s looking like that’s going to be possible!! Sending only the finest creative vibes to everyone else who’s working on something they want to be proud of! 
63 notes · View notes
skyfullofpods · 6 months
Text
R is for Regina Prime!
Regina is an urban explorer, who posts vlogs of her explorations online. Her exploration of an abandoned building begins to uncover a conspiracy which has huge ramifications on the entire world.
7 notes · View notes
allaboutealeonieva · 1 month
Text
Tumblr media Tumblr media
Alejandra's agency confirmed that she will be in the next season of the series La Regina Del Sud. Her character will be called Sheryl Tarasky. Despite being in the Netflix catalog, the agency states that it will be shown on Amazon
0 notes
cinemedios · 2 months
Text
¡El musical "Mentiras" llegará a la televisión!
La música de los 80s en compañía de crimen y risas ¡Llegará a la TV! 🍿
El pasado lunes, 11 de marzo de 2024, se anunció la llegada del exitoso musical “Mentiras” a un formato televisivo gracias a la plataforma de streaming Amazon Prime Video ¡entérate de los detalles! Una de las obras musicales con más éxito en México es “Mentiras” creado por José Manuel López Velarde y estrenado en 2009, ya han pasado 15 años desde su primera función y la obra sigue manteniéndose…
Tumblr media
View On WordPress
0 notes
unesheet · 6 months
Text
OH!!!!
0 notes
hellsitegenetics · 2 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes