#yeha...

[chiptrillino]

I think you don't take commissions, and I don't want to pressure you, but...

You really draw the best Jee, and I would pay to see more of him. There's so little content. T_T

sorry! a full-time job steals lots of time and energy ;;; there is really not much jee content, generly the middle-aged and elderly get overlooked in atla. but this is fine it happens. i can't promise it any time soon. but i love jee and i have maybe a few doodles lets see if i find the time to draw him!

#chip!ask #jee and his back will have one day a come back! #or maybe his tatoos #-looks at the sketch- #yeha... #btw for me! jee is still alife by the end of season three! #(i know i am kidding myself #just like i am kidding myself that they got along after 2 and a half years at sea) #but i can dream!!!

[hole-in-the-bottom-of-my-brain]

CHAT IS THIS REAL

#matpat #game theory #INSANE. #IM FJDLHFJVBD #destiel meme #i should tag that. yeha

[crumb-crumblet-s-crumbington]

uagauauaaaagaauagauauga

#denki kaminari #hanta sero #kamisero #mha #bnha #rewatchjing the show #they like #dont even have any scenes together #HELLP #like #idk where 14 year old me got anything from #like yeha they r always standing next to each other but sero has so little screen time he doesnt even do anything 😭 #crumb cuptoast forever doomed to always like characters who r sidelined

[commedessgarcons]

Yeha Leung Ph. by Isabel Malia/ smoltog on Tumblr & Instagram

#yeha leung #isabel malia #p #2023 #neoclassical

[rendevok]

Silly little narumitsu kiss based on something vicky tweeted

[Screeenshot ID: A screenshot with the text “When I leaned in to kiss him and he threw his hands in the air and said “yay” before we started making out” quote tweeted with the addition of “Phoenix Wright” from twitter user vanilla_mp3. End ID.]

#narumitsu #why YES edgeworth’s cravat IS a mood cravat because he’s a silly guy #phoenix wright #miles edgeworth #wrightworth #SMOOCHES #MY FAVORITE FCKING TAG YEHA BOI #fan art #aa #rendoodles

[julietjardin]

Yeha Leung Photographed by Isabel “Bee” Malia 🕊

#creepy yeha #yeha leung #fashion #art #photography #pearls

[meowfountain]

(draws them again) im so sick of them

#deltarune #kris #kris dreemurr #susie #susie deltarune #krusie #fanart #geo art #i used a different brush for the sketch and did not feel like lining it with my normal brush so ermm yeha #i like how it turned out though ...... might do that more often #aaauauaugh they've been in my brain way too much lately

[clay-pidgeon]

new pfp

#yeha #transgender #coelacanth

[woolydemon]

oh I. havent posted this ,

#sillay scribbles #feeling hesitant on maintagging butm.. yeha ok I'll do it #ace attorney #apollo justice #simon blackquill #yes this is based on simons That Queer Power seems to have offended my bird moment. that's my fav moment from aa5

[chiptrillino]

ID: three drawings showing a sequence of sokka and zuko from avatar the last air bender. Aged up rather soon after war. sokka is leaning over zuko, you see them mainly on the left side waist up. The background is kept plain withe. On the left side the artist signature "chiptrillino . 2023" on the right side isthe request to "please don't repost"

The first drawing shows sokka looking down with slightly zoned out expression. zukos hands are reaching up.

The second image shows sokkas surprised face held between zukos hands, who raised up his face inches away from sokkas.

The third images shows sokka leaning into zuko. Both of them kissing. zuko holds on to sokkas shoulder and neck. Both look happy. End ID

Small shoutout to that person that tagged, once upon a time (last year), the sketch with "mermaid zukka". And would you look at that! Its meremay! And this is not really mermaid themed, but... it remained me to finish it! -sweats-

oh shoot! also happy zukka week! i guess whops...

---- if you want to deal with all my reblogs may I direct your attention to my side only my artworks blog?

@chiptrillino-art

#chip!art #atla #zukka #sokka #zuko #before anyone says something... they always had pants on! #also fuck shading... like proper shading #i kdin of needed this... #like... yeha... #can you belive it that this is sort of my first drawing officially posted here this year that is not an ask or anything else? #me neither #gosh how the time flies #also the finger was always there and never missing!!! #oh yeha it was always. ment to be a sequence

[ilovejuzi]

Jbzi

#murder drones #murder drones fanart #murder drones uzi #murder drones j #sorry for the jzui famine on this account lol #i would post more picture but im limited to 10 #and the freaking website wasnt working #so ummm yeha hey guys juzi #myart #juzi

[incredubious]

#one piece #sabo #yrha. yeha. chew on this one for a sec.

[theorphicangel]

imagine being a receptionist at a partner company and having to deal with CEO!satoru’s flirting with you each and every time he steps into the building

“I wonder when they could afford a pretty girl like you here?”

“you’re five minutes late, mr gojo.”

“eh tomato tomate?”

“that’s not the—“

“I’d love to stay and chat with pretty girls at the desk all day but I do have a meeting to get to unfortunately, don’t miss me too much.” he leaves with a wink.

and when he brings his so-called ‘business partner’ getou with him, you play the teasing fool for them.

“Oh lemme guess! dumb 1 and dumb 2?”

“hey that was mean, princess.” satoru replies.

you’d be lying if that pet name didn’t get to you.

not to mention the constant pestering of dates each and every week.

“say…when will you let me take you out for dinner, pretty girl?”

“never.” you mutter, eyes fixated on the screen, typing loudly at your computer.

“please—“

“if your meeting’s done I’m signing you out.”

“is that a yes then.”

“No.”

“I’ll pick you up at seven.”

“you don’t even know where I live.”

“I’ll find out, pretty girl.”

In reality he’ll just wait outside the building till you finish your shift

#YEHA #that’s it #Angel writes #random idea #gojo satoru headcanons #jjk gojo #jujutsu kaisen fluff #jujutsu kaisen fanfic #jjk headcanons #jujutsu kaisen x reader #jujustu kaisen #satoru gojo x reader #gojo satoru fluff #satoru x reader #gojo satoru x reader

[commedessgarcons]

Yeha Leung Ph. by Isabel Malia // Smoltog on Tumblr and Instagram

#yeha leung #isabel malia #2023 #p #exquisite #grandeur #ethereal #neoclassical

[sirpoopepic]

I'm back!! This is my First black parade art ever!!

#mcr #art #my chemical romance #fanart #gerard way #drawing #my chem #my chem romance #mcr fanart #mcr art #mikey way #yeha okkay... garage arther wey is smoking weed... #im back after exams!!! more art inkoming!! #babdyfjshgsjsh #im so proud of the first oen #the black parade #the fabulous killjoys #killjoys #party poison #danger days #welcome to the black parade

[hollowterrain]

Yeha Leung in Chains of Metal by Isabel Malia

#yeha leung #isabel malia #chains of metal