#i wish i had had the strength to think for a second and report the tiktok | Explore Tumblr Posts and Blogs

bookworm551 · 6 months

Text

Take the Edge Off | Part 8 | Pillow Talk

You finally get a quiet moment of quality time with Miguel.

A/N: wooooooow It’s been a hot minute. I feel like I’m coming back to my neopets after abandoning them for years. Tbh I just needed to take a break, I’ve been working and going to school, so it’s been a lot. Anyways, I’ve come back to feed you before disappearing again for an unknown amount of time. Also, this is pretty self indulgent ngl, so this is for the praise kink girlies. Enjoy <3

Warnings: smut, overstimulation, the usual

Word count: 6.8k

Part 1 Part 2 Part 3 Part 4 Part 5 Part 6 Part 7 Part 9 Part 10

You woke up slowly the next morning. The soft light that flooded into the room caused you to stir lazily from your dreamless sleep. You stretched with a deep yawn, feeling a dull a soreness in your arms and shoulders that reminded you of all the things you had done with Miguel the night before.

You shifted under the covers and blinked your bleary eyes open. As your vision adjusted, you registered the figure of Miguel asleep next to you. He was positioned on his stomach with his face half-way buried in his pillow, and his back moved up and down slowly with his deep, even breaths. He had his arms tucked under his pillow, and there were some loose strands of hair that had fallen over his face. It took every ounce of your strength to not brush it aside for fear that you would wake him and break this quiet moment together.

You watched him for a second with a soft smile. Laying on your side, you admired his resting face. This was the first time you had ever woken up with him still there next to you. Every other time he had either left immediately or after you had fallen asleep. It was a nice change, and as you lay there quietly, you couldn't help but wish you woke up like this every day.

"I can feel you staring," Miguel grumbled quietly, startling you out of your reverie. You smiled sheepishly as he blinked his eyes open to look at you. They were still bleary with sleepiness, and his soft gaze warmed your chest.

"I didn't realize you were up," you stated, your own voice hoarse from sleep. He let out a little huff before closing his eyes again, not saying anything in return. "How long have you been awake?" You asked quietly. He sighed, not opening his eyes. "I woke up with your tossing and turning about 20 minutes ago," he replied finally.

You hummed and offered softly, "Sorry." You had gained a reputation in your life as a restless sleeper, and apparently, it didn’t matter how much he had worn you out the night before. "It's fine," Miguel grunted as he shifted and rolled onto his back. "I should've been up earlier than that."

You smiled. You were glad he had chosen to stay here, to let you see him like this. Knowing he was a busy man, it meant a lot to you. "Full schedule today?" you asked.

Miguel sighed, running a hand down his face. "The briefing for our mission is at noon," he said. "After that, I've got a stack of reports I need to review." That sounded boring to you, but you couldn't help but grin at his words: our mission. You had almost forgotten that he added you to the team, and the notion of working with Miguel again excited you.

"Who else is on the team?" You asked casually, fighting a lazy yawn as you stretched out next to him.

"I don't think you know all of them," he stated. You hummed and replied, "Well, who would I know?" He paused a second to consider. "Me, a handful of Peters," he began. "Malala, Jess, and she's been asking to bring Gwen, too."

You rolled over onto your side, resting your head on your hand with a smirk. "Me," you added smugly. Miguel rolled his eyes. "You," he conceded. "And I think that's it."

You gave a short, thoughtful hum. There was one name you noticed was missing from the list, someone you thought deserved to be on the team as well. You knew trying to change the roster would upset Miguel, but you couldn't ignore the gut feeling you had telling you that there was one more person who should be added to the mission.

Miguel seemed to notice that you were thinking about something. "What?" He questioned, an eyebrow raised suspiciously. You looked up at him and smiled reluctantly. "You're not gonna like it," you told him. His dark eyes narrowed. "What?" He repeated, sounding even more suspicious than before.

"Promise you won't be mad?" You asked. "No," he responded evenly. "You probably piss me off more than anyone here."

You chuckled at that. "That's probably true," you admitted, moving closer to him as you did. He had a few faint scars that were littered across his shoulders and chest, and you began absently tracing your fingers over them.

After a quiet second, he prompted gently, "What is it?"

You didn't reply for a moment as your fingers danced over the faint lines on his skin. Finally, you looked back up at his face and found he was gazing down at you expectantly. With a sigh, you finally said, "You need to add Ben to the team."

Miguel's face hardened immediately. "No," he replied sharply. You sighed again. "I already know what you're gonna say," you stated. Miguel huffed an irritated breath. "He's the reason we're in this mess. He's the reason this anomaly has been able to cause all that damage."

"That wasn't his fault," you defended gently. "It could have happened to anyone, and I know how badly he wants to make it right." Miguel scoffed, and he sat up from the bed. "Nothing he can do will bring back Earth-2319," he stated sharply. "All those lives are gone forever."

He turned his body to step out of bed, and you sat up with him, allowing the covers to slip off your bare torso. You had known he would to be upset by your suggestion, but you didn't want this to turn into an argument.

Reaching a hand out, you gently grabbed his shoulder to keep him from leaving. "And don't you think he knows that?" You pointed out softly. "Can't you imagine how terrible he feels?"

Miguel felt tense under your palm, and he didn't reply. You were afraid that he was going to shrug you off, and you wouldn't have blamed him. You could still remember his haunted gaze when he came to you after the loss of Earth-2319. This mission was personal for him, and you knew Miguel wasn't going to do anything he thought would jeopardize it.

After a silent second, he sighed heavily, and his stiff shoulders sagged under your hand. "I don't have to imagine," he muttered quietly.

A taut silence followed his words. The air around you suddenly felt fragile, and you were afraid of breathing for fear of breaking it. You didn't know what he was referring to, and you wanted desperately to ask, but it seemed almost disrespectful to do so. So instead, you waited.

Miguel seemed to sense your curiosity and breathed out another sigh. "When I first traveled across the multiverse," he began slowly, "I found something I wanted—badly. I thought it was harmless, so...I decided to take it for myself."

You closed your eyes regretfully, understanding that what he was implying broke the canon of that universe. You shifted your body closer to the edge of the bed so you could see his face. His eyes were downcast with the memory replaying in his head, a faraway look on his face.

"I didn't know what would happen until it was too late," he finished softly.

You let his words hang in the air for a moment before taking the hand that was still resting on his shoulder, raising it up to cup his cheek, and turning his face toward yours. His eyes were still fixed downward, but he allowed himself to be guided by your hand.

"You didn't know any better," you said finally. "You can't blame yourself for what you didn't know." He let out a small huff and turned his face away from you again, pulling away from your hand. "It was reckless and stupid," he muttered. "I was stupid."

"You weren't stu—"

"I destroyed a universe," he snapped, his eyes finally flashing up to your face. Grief and anger were etched in his face, and in his eyes, you saw the same pain the night after Earth-2319 was lost. You realized now how much worse it must have been for him that day, and your chest ached for him.

"I understand," you whispered softly. "And I’m sorry, I didn't know." He scoffed. "It's not exactly something I brag about," he stated darkly. "And it's not something I ever plan on repeating. I can't afford to be wrong. Being wrong costs lives."

You didn't say anything for a moment, and Miguel’s shoulders slumped in defeat. There was that quiet openness again, the subtle vulnerability that seemed to be showing more and more. He obviously meant what he said, and you understood that his words came from painful experience.

Your hand raised up to rest on his bare chest, and your thumb brushed his skin gently. "You can't put it all on yourself," you whispered to him. "Nobody is that strong." Miguel didn't reply for a second before whispering back, "I have to be."

You sighed quietly and shook your head. "No, you don't," you insisted. "That's why you have all of us. Jess, Peter, me, everyone—we're all here for you."

Miguel had been staring at the ground as you spoke, but his eyes moved up to meet yours at your last sentence. His gaze was piercing, almost overwhelming. It made you almost nervous to say what you were going to say, but you held his stare as you emphasized your next words: "I'm here for you."

Your statement hovered in the air, leaving the silence that followed to rest heavy around you. Your chest tightened anxiously as Miguel stared at you wordlessly. His eyes were impossible to read. Had you gone too far? You knew he didn't want a relationship. Were your words too close to a confession?

Finally, your worries were allayed when Miguel leaned in and pressed his lips to yours in a tender kiss. It was different than the passionate way he usually made out with you when you were fucking. This was slow, like he was taking his time just to appreciate how your lips felt against his. It almost felt like a token of gratitude.

"You make it easier," he whispered when he finally broke away from your mouth. Your chest swelled as you smiled softly at him. “Good,” you replied quietly. “That’s what I’m here for.” A small smile cracked the grave expression he wore, and you kissed him again.

When you pulled back again, he studied your face for a second. “You still want me to add Ben, don’t you?” He guessed.

You sighed softly and nodded. “Wouldn't you do anything to make it right?” You asked him quietly. His eyes were still fixed on your lips, but you could tell he was thinking about your words. Without replying, he simply nodded his head.

“So would Ben,” you continued. “Please let him come.”

He still didn’t say anything for a moment. He sat quietly for a few heartbeats before letting out a deep sigh. “I'll think about it,” he said finally. You smiled at him, knowing that even him contemplating your plea was victory enough. “Thank you,” you told him, closing the space between you with a kiss. He hummed against your lip before murmuring, “You know, I thought I said I don't want you to talk about Ben around me.”

You smiled mischievously. “Well, we're breaking my rule about not discussing work in bed,” you pointed out. A faint smirk appeared on his lips. “Well, maybe I don't care about your rules,” he stated with a hint of humor in his voice.

“Then why should I care about yours?” You shot back. Miguel shifted from off the edge of the bed to lean forward over you, forcing you to lay down slowly under him. “Because there are consequences to breaking my rules, remember?” He said in a low voice, his eyes darkening with desire.

Your heart began to race as he trapped your body under his. “No,” you replied coyly, “I think I forgot.” Raising a hand to his head, you pulled his face down just above yours. “You'll have to remind me,” you whispered to him before pulling him down into a hard kiss.

You brought your hand around his head to run your fingers through his hair as he deepened the kiss. After a second, he moved his lips down to your neck while one of his hands traveled up your stomach to palm your breast, earning a quiet moan from you. Even after all the things he had done to you last night, you were ready for more.

You pushed yourself up off the mattress, forcing Miguel to roll back over onto his back as you straddled his waist. The seriousness from his face had disappeared when you settled on top of him. A smug grin pulled at his lips as the covers slipped off of your body, and his eyes drank in the sight of your bare body before him.

"Not too tired after last night?" He asked in an amused tone. You leaned forward and planted your hands on either side of his head as you brought your face close to his. "Baby, I could go all day," you purred before pressing your lips to his and slipping your tongue between them.

Miguel's hands gripped at your thighs, and his breathing deepened as he shifted under you. You brought one hand up to run your fingers through his hair, and when you broke away from his mouth, you moved your lips down to kiss under his jaw. He tilted his head back with a soft sigh to allow you better access to the soft skin of his neck.

Before you could go any further, Miguel's watch began beeping, disturbing the growing anticipation you both felt. You groaned, and he sighed regretfully as he raised his arm up to read the message he had received. You lifted your head up slightly to look at his face. He was clearly irritated by the interruption, and his eyes flicked back and forth as he quickly read the message.

"It's Jess," he explained. "She's asking about the meeting later." You rolled your eyes. There was always somebody or something that demanded his attention, and you were sick of it. You didn't want to let him go this time.

"You know," you began slowly, "there's this cool feature on these gizmos." You grabbed his arm and raised it up so you could see the screen. Miguel watched in amusement as you pressed the screen until you found what you were looking for.

"There," you said proudly, pressing the 'silent' button in his watch's configuration. "Much better." His eyes moved from your face to the watch and then back to your face with a raised eyebrow. "Is that why you never respond to my messages?" He asked suspiciously. You gave him a sly smile. "I just like it better when you tell me in person," you defended innocently.

"Mhmm," he hummed in response, a subtle smirk pulling on his lips as you kissed them again. You were eager to pick up the momentum you had lost to Jess's message, and you quickly returned your mouth to his neck again.

"We can't," he murmured, the bass of his voice vibrating against your lips. "I need to get up."

You hummed softly before whispering against his skin, "No."

You heard him breathe out a chuckle, and his hands came up to pull your arms gently off his body. "I know," he replied, sitting up as he did. "But people are going to notice I'm missing."

A spike of determination shot up in you, the frustration at his constant leaving finally showing. With both hands, you shoved him back down against the mattress by his chest, using most of your weight to keep him down. "Let them notice," you told him. "You're not going anywhere."

Under your hands, Miguel's breathing deepened, and his eyes flashed with lust at your assertion. His desire for you was clearly painted on his face, but with a clenched jaw, he sighed regretfully. "I can't stay," he insisted. "There's too much to do."

Despite his words, his fingers were gripping at your thighs, and he shifted under you restlessly. His resolve was hanging by a thread, and you knew exactly how to snap it.

Your mouth curled in a wicked grin as you lowered your face to hover over his own. "You're gonna stay right here with me until I'm through with you," you whispered to him. "You know why?"

Miguel was obviously fighting to keep his breathing steady, and his eyes were fixed on your lips when he managed to ask, "Why?" You lowered your face just above his, your eyes locking and noses brushing against each other. Then, softly, smugly, you said, "Because this pussy is yours, and I know how much you love it."

Miguel's jaw clenched at your words, and when you pressed your lips to his again, he was no longer holding back. His tongue pushed its way into your mouth aggressively as his fingers dug into your hips. From beneath you, his body shifted as he propped himself more upright and pushed your hips down to where his hardened cock was waiting.

You smiled deviously as he kissed you. The feeling of power rushed to your head at being able to distract him from his work with only a few words. Your heart was pounding in anticipation, and with the soft breathy moans you were both making, the ache between your legs was growing almost painful.

You allowed yourself to be guided back by his hard, gripping hands. A thrill ran up through your body when you felt his cock brush against your hot entrance. You could see the unfocused look in Miguel's eyes, like the only thing he could think about was being inside you.

To be mischievous, you teased your pussy around his length. Miguel groaned ever so softly, and his eyes burned with lust. "I don't have time for your fucking teasing," he growled. You smirked, always enjoying getting him riled up. He was even better when he was frustrated.

"You're so impatient," you observed with an amused voice. "I'm gonna have to teach you how to wait nicely one day." Miguel wasn't so amused. "I don't have time for this," he replied, shifting under you to try and align himself to you. You laughed. "That's the point," you said. "You need to learn how to—"

You cut yourself off with a sharp gasp. Miguel clearly had enough of your lecture and finally slammed himself into you, causing you to fall forward so that your head rested against his. The sudden feeling of him stretching you out so unexpectedly had made your mind freeze, and for a second, you couldn't speak.

"You were saying?" Miguel muttered smugly when you opened your eyes again. You couldn't even remember what you were saying. The only thing on your mind now was how badly you needed to fuck him.

With Miguel's hands still on your hips, you began moving eagerly along the length of his cock. You rocked your hips against his, grinding your pussy hard against him. Quiet whines began to rise up from your throat as you raised yourself up and down, slowly at first, but you soon increased your pace as he began grunting from the feeling of you riding him.

Miguel was gripping your waist tightly and gasping quietly as he helped you move up and down his length. You fell forward, planting your hands on his chest as you moved your hips against his. His eyes met yours with an electrifying gaze that only encouraged your movements.

"Fuck," he muttered under his breath, his eyes fixed on your face with a lustful sort of reverence as his hands slowly slid up the sides of your torso. "You're so fucking pretty."

Damn him and his words that sent your heart fluttering. Even there, in the midst of riding him, you felt your face grow warm from his praise. Of course, you had heard him say things like that before, but for some reason, it hit you in a different way that turned you into a blushing mess on top of him.

Miguel apparently noticed the effect his praise had over you because his lips twisted in a half-smirk, and he sat up off the bed to bring his face up to yours. "My pretty girl," he murmured, his voice deep as he spoke the words against your lips.

You seemed to forget how to breathe. Your heart was pounding furiously in your chest as you locked eyes with him. His dark, piercing gaze that once seemed like an impenetrable wall was now soft and warm. The way he was staring at you made you feel like he could see into your soul, like he knew what you felt for him, what you wanted from him. And in his eyes, you could almost swear that you could see it, too.

His strong arms wrapped themselves slowly around your torso to hold you against him, and his lips pressed against yours gently. You didn't even realize that he was rolling you over until you were on your back beneath him, and he began driving his hips into yours.

You let out a soft moan and broke away from his lips. Miguel's head fell to your shoulder as he moved steadily inside you, his cock pumping in and out of your soaking cunt. His hot breath fanned against your collarbones, and you could hear how he grunted softly with each thrust.

"God, I can't get enough of you," he panted, his voice hoarse and quiet. "Fucking you is—it's like Rapture."

You nearly came apart right there. His words and his cock had you completely at his mercy. One of your hands gripped at his muscular back while the other slid up the back of his neck to run through his dark hair. It took most of your effort to even form a coherent thought, and speaking felt next to impossible.

"Only you—," you started, cutting yourself off with a moan. "Only you can m-make me feel like this. You fuck me so good."

Miguel groaned quietly at your words. Lifting his face up from your shoulder, he rested his forehead against yours. "You know why?" He asked quietly. You opened your eyes to meet his, not even bothering to respond. "Because you're my pretty girl," he asserted. "And this pussy is mine." As he spoke, Miguel's hand slipped down between your bodies until he found your clit with his thumb.

You cried out in ecstasy as he circled his thumb around while still driving his cock deep inside you. Your hand moved from his back to grip the headboard above you as he fucked you relentlessly. The sounds of his hips slapping against yours were in-time with each whining moan you made. You barely had time to register that you were cumming until it took over your whole body.

You were practically screaming his name as your body shook uncontrollably. You pulled him close to you while his hips continued thrusting into you ceaselessly. Bliss completely overtook your every faculty, and the only thing your mind could process was Miguel.

His eyes never left your face as he watched you completely unravel under him. He gave a long, deep moan at the feeling of you clenching around him. His lips brushed against yours as he slowed down his pace for you, aware of how your body was beginning to grow overstimulated, and he murmured your name under his breath softly.

As you finished riding out your high, your body was still alight with pleasure, and your heart was still beating wildly in your chest, but you finally managed to breathe properly again. Blinking your eyes open, Miguel's dark gaze was hypnotizing. He was clearly proud of how he had caused you to come so undone, and he whispered, "You're so pretty when you cum."

All you could do to respond was moan softly. He never failed to get you off, and he never failed to praise you when you did.

With one hand still entangled in his hair, you pulled his face down to yours in a sloppy kiss. As Miguel's tongue danced against yours, he pulled himself out of you. You were still breathing hard when he sat up off your body. Taking advantage of the fact that you were still recovering from your high, he turned you over so that you were on your stomach and lifted your ass up to him.

Even if you had wanted to resist him, your mind was still hazy from all the pleasure buzzing through your body. Following his prompts, you obediently propped yourself up on your knees, your back arched as you held onto the sheets.

"What a good girl you are," he murmured, running his hand down your back. You hummed softly at his touch and turned your head to look at him from the corner of your eye. "Only for you," you whispered. You heard him give a heavy sigh, and you felt the head of his cock teasing the entrance of your soaking cunt.

"That's right," he purred. "You're my good girl."

That was the last thing he said before slamming his cock back into you. You gasped sharply, startled by his sudden movements as he picked up an eager pace. Still sensitive from your orgasm, you whimpered softly against the sheets.

"It's too much," you whined, gripping the comforter to try and pull yourself forward to escape the sensations overpowering you. "You can take it, babygirl," he assured you gently, his cock moving faster and harder inside you. "I know you can."

You couldn't say anything in response. You were high on his words and drunk off his cock. Your eyes were clenched shut as he pounded into you. The sound of his hips slapping against your ass filled the air, and with each thrust into you, he hit against your G-spot over and over again. Your body felt weak, and you were completely at his mercy.

"Miguel," you moaned, unable to say anything else. He cursed softly under his breath, and his hands gripped your hips tightly to keep you steady. "You're doing so good, cariño," he told you, his fingers digging into your skin. "Just a little more."

His gentle tone contrasted sharply against the almost savage way he was fucking you. Your breathing came in shallow gasps, and your legs started to give out from under you. Miguel dropped one of his hands to support himself on the mattress. His large body seemed to envelope yours, and you could feel the heat from his skin warming your back. His panting breath tickled your ear as he continued ramming into you relentlessly.

You turned your face toward his, your noses brushing against each other. His lips were grazing the corner of your mouth in feather-light touches. Your eyes, blurred and unfocused, met his, and in that moment, a three-word phrase entered your mind that you had sworn to yourself you would never say to him.

"Miguel, I-I—"

You couldn't finish your sentence before your body was racked by another orgasm. You hadn't expected it, and it hit you hard and fast. A strangled cry emerged from your throat as your body trembled under his.

Miguel became desperate when he saw you were cumming again. With each thrust, he grunted loudly, overpowering the sound of your quiet gasping. Your whole body was shaking, and just when it was getting to be too much for you to handle, Miguel grew still with a ragged moan as he came inside you.

For a moment, there was just the sounds of your rapid breathing as you were both lost in the intoxicating feeling of finishing together. His head rested against yours, his skin hot to the touch. The sounds of his panting still tickled your ear while his hand slowly roamed from your waist up your back. Finally, with a gentle kiss to your shoulder, he pulled out of you.

Your hands released the vise grip they had on the sheets as you slumped down against the bed. Your mind was still flooded with the pleasure you felt, and you didn't have the capacity to do anything besides lay there and try to recover your breath.

Turning onto your back, you looked up at Miguel. His hair had fallen into his face in a messy way that made him even more handsome. Raising your free hand up to his face, you brushed his hair back so that you could see him clearly. His eyes seemed unfocused as his mind was clouded with pleasure. After a quiet second of staring at each other, he lowered his face to place a lazy kiss on your mouth.

God, how you wanted this to last. You wanted him to fuck you senseless every day. You wanted him to kiss you every hour, to think of you every minute, to be with you every second. Being together like this, open and vulnerable and comfortable with each other, it was the first time you felt a sense of connection with another person since you became Spider-Woman.

When he broke away from your lips, he slumped down beside you with a deep sigh. You glanced over at his face, a faint glimmer of sweat shining on his forehead, and admired for the millionth time just how good he looked.

As your breathing was finally evening out, you closed your eyes and felt like you could fall right back to sleep next to him again.

"Don't even think about it," Miguel mumbled, breaking the silence between you. "Hmm?" You questioned, opening your eyes to look at him.

"You're not falling asleep again," he said with a pointed look.

You groaned, rolling onto your side to face him better. "Why not?" You asked innocently. Miguel stretched his arms before answering, his muscles flexing in a way that made you crave another round with him. "Because I need to go," he sighed. "And that means you do, too."

You raised an eyebrow at him. "You can't just fuck me like that and expect me to be able to get up and leave after," you told him wryly.

Miguel huffed out a laugh, a cocky smile on his face. "I'm serious," you insisted, unable to suppress your own grin. The rare sight of Miguel's smile paired with the high you were still feeling made you giddy. "I'm sure you are," he replied, "but I'm also serious about needing to go."

You rolled your eyes. "Then go," you told him theatrically. "I won't beg for your company." Despite your words, you did indeed want to beg for his company. Every time he left, it was harder and harder for you to let him go.

He huffed again. "I'm not going to leave you alone in my room," he replied dryly.

You smirked at him. "Afraid I'm gonna steal your stuff?" You joked. Miguel's eyes turned to you with an amused gleam. "It's a possibility," he said evenly. "You still haven't given me my shirt back." You closed your eyes for a moment with a sigh. "Oh, yeah," you mumbled as you stretched out like a cat. "I definitely meant to do that."

Miguel hummed his disbelief, but there was humor in his subtle smile. "If I didn't know any better," he began slowly, reaching over to wrap his arm around you and pull you closer to him, "I would say you're lying."

Your own smile widened as you looked up at him mischievously, and you rolled over so that you rested on his chest. "Oh, you think you know better?" You asked in a sly tone, hovering your face over his.

His mouth was pulled in a crooked grin as his fingers brushed lazily across your bare back. "I know I do," he replied with a deep voice, his eyes fixed on your lips.

You hummed thoughtfully. "Well, maybe you're wrong," you asserted.

"I'm never wrong."

"I don't believe that."

"Name one time."

You paused, trying to think of a time when he did or said something incorrect, but unfortunately, nothing came to mind. You rolled your eyes. "I don't know," you admitted finally, earning a smug look from Miguel. "But one day, you'll have to admit you were wrong about something," you insisted, "and I'll make sure I'm there to see when you do."

"You may be waiting for a while," he remarked. You hummed thoughtfully, tracing a finger over the outlines of his face. "I’m a patient person," you stated simply. "And you never know. That day could come sooner than you think."

He stared up at you in amusement. "If you say so," he replied. "Though, I wouldn't use 'patient' as a word to describe you." You raised an eyebrow in interest. "Oh? And what would you use?" You asked smoothly.

Miguel pretended to think as he slowly stroked his fingers up and down your back. "There are a lot of words I could use," he began. "Stubborn is probably at the top of the list." You rolled your eyes, trying and failing to suppress a smile. "And?" You prompted, feeling genuine interest in how he perceived you.

"And..." he thought for a second, "passionate."

You smirked at him and raised an eyebrow. "Oh, yeah?" You said smugly. Miguel's lips also turned upwards in a subtle smile. "Not just sex," he clarified. "You're passionate about being Spider-Woman, and you care about the people around you. You're...kind."

Your stomach fluttered a little bit. You could tell he wasn't just saying that. The sincerity in his voice as he spoke was perfectly clear.

You smiled softly at him. "Keep going," you urged, though you were still trying to seem aloof at his words. He hummed thoughtfully. "You're strong," he listed. "You're fast. You're smart."

"Don't forget funny," you added.

Miguel gave you a skeptical look. "I didn't," he said. "It's just not on the list."

You couldn't stop yourself from laughing at that. "Shut up," you chastised, lightly smacking his chest as you recovered from his joke. His eyes gleamed as he stared up at your laughing face. There was a brief moment of silence as he looked up at you with half a smile on his lips before he murmured, "You're beautiful."

Two words and your heart was beating furiously in your chest. You were struck dumb, unable to think of what you could say to appropriately respond to him. He had called you pretty a dozen times, and you logically knew that he found you attractive based on your many encounters, but it wasn't just the words he spoke, it was how he said it—softly, earnestly, like it was something too precious to be said aloud.

And there was that three-word phrase again whispering in your mind. You could never say it, you knew that. It would be awkward, uncomfortable, and even potentially ruin your standing in the Society, but none of those reasons could stop you from thinking it when he was gazing up at you with his soft, brown eyes with a subtle smile on his full lips.

Miguel must've realized you were having trouble coming up with a response. Breaking the half-awkward silence around you, he said, "But you know what word I would use to describe you right now?"

You were pulled out of your stupor by his question, your face growing warm in embarrassment. "Hmm?" You hummed curiously.

"Treacherous," he replied simply.

Your eyebrows scrunched in surprise. "Treacherous?" You repeated. "How so?"

He lifted his head up just enough so that your lips were barely touching before whispering, "Don't think I don't know what you're doing right now."

You blinked down at him innocently. "What am I doing?" You whispered back, your lips grazing his softly.

He let you place a ghost of a kiss to his lips before finally replying, "Stalling." With that, he began sitting up off the bed, forcing you to roll off his body. "We have to go.”

You draped your arm over your eyes with a groan. He knew you too well. You had hoped he wouldn't notice you trying to drag on the pillow talk to keep him there with you. Now, it seems you’ve run out of time.

Miguel sat up off the bed and stretched. You watched how the muscles in his back flexed tightly before he stood to get dressed. Sighing, you also sat up, grabbing your underwear from off the floor where Miguel had discarded it the previous night before walking to the bathroom.

When you came back out, Miguel was already dressed in his suit, his hair slicked back in his typical fashion. He noticed you emerging from the bathroom and tossed you your web shooters. Catching them, you placed them on your wrists and watched as your suit enveloped your body.

He must’ve seen the wonder on your face because he said, “I told you it’s cooler than nanotech.” You smiled at him. “It is,” you conceded, stepping over toward him. “I don’t think I ever said thank you.”

He smirked down at you, his gaze flickering back and forth between your eyes and your lips. “I don’t recall that you ever did,” he replied. You placed one hand on his chest and let it wander up to his neck. Even on your tiptoes, he was too tall for you to kiss, so he had to follow your prompting hands and lean over to kiss you.

When you broke away from Miguel, you whispered, “Thank you.” He wore a soft smile on his lips as he whispered back, “You’re welcome,” before pressing them back to your mouth. Kissing him was so addicting, and you regretted having to leave once again.

Pulling away from you, Miguel sighed. “Listen,” he started, “finding the anomaly needs to be our first priority now.” You nodded in agreement, but you could sense there was more he was going to say. “That means,” he continued slowly, “no distractions.”

You studied his face for a second before you understood his implication. “You mean this?” You asked, your stomach tightening anxiously as you thought about him cutting you off. “Yes,” he replied before quickly adding, “until the anomaly is caught.”

You frowned. You had no idea how long that could take. The anomaly, ‘Ghost’ as he had been nicknamed, had already been at large far longer than any of you could have guessed, and he could stay in hiding between universes for far longer.

Miguel apparently could tell what you were thinking, and he raised one of his hands up to hold your chin gently. “You are a distraction for me,” he told you. “Now, I put you on the team because you can be useful, but I can’t be here lounging around with you when I need to be preparing for this, understand?”

You sighed in resignation. It made sense. As much as you didn’t want to admit it, it made sense. He was trying to run this whole operation by himself, and even though you wanted him to stay with you, you knew that you were just being selfish.

“Yes,” you replied reluctantly. He nodded, his thumb running back and forth along your chin gently. “Good,” he said. “I’ll see you at the meeting at 12.”

You sighed again. “Alright, I’ll see you there.” You turned to walk toward the door, but when Miguel called out your name, you paused and turned back around. He stepped toward you purposefully, and your heart leapt as you thought he was going to let you stay a while longer.

With his body hovering close to yours, he reached a hand out to grab your arm gently. You let him lift it up, your eyes never leaving his face as you noted how close his lips were to yours, but he wasn’t looking at you. He was looking down at your gizmo and was tapping away at the screen.

Confused, you looked down to see what he was doing. You watched as he pressed the button marked ‘silent,’ effectively disabling the setting you had it on. “No more of that either,” he told you with pointed look.

You gave a guilty smile. “Fair enough,” you conceded, taking back your arm. “But just so you know, I think this new rule of yours is a good idea, because now I’m going to catch this anomaly so fast, it’ll make your head spin.”

He smiled in amusement at your statement. “If you do,” he said, “I’ll fuck you until you can’t speak.” You raised an eyebrow at him. “You already do that,” you pointed out. He shrugged. “Not anymore,” he countered evenly. You shrugged back at him and replied casually, “But soon enough.”

With that, you turned back to the door with a smirk on your face and the determined notion that you were going to be the one to catch the anomaly.

271 notes · View notes

imagines--galore · 1 year

Note

HIII can I ask for an imagine with Spock x a short fem reader who has a big chest and he gets jealous one day because Kirk keeps staring so Spock just straight up goes over and stands beside her (shocking a lot of people because they don’t know they are together) and holds her hand and it’s just super fluffy and soft

Sincerely your happy friendly 🐱 xoxo

Pairing: Spock x Reader Rating || Genres || Warnings: T. Romance. Fluff. None. A/N: GAH!!! Meeting someone who loves Spock as much as me is so rare!!!! And I loved writing this so much! :3 Thank you for the request!

If there was one thing you abhorred more then anything, it was sparring. It probably stemmed from the fact that most of your opponents were always bigger, taller and stronger then you were. Though you were quick on your feet, it still didn't make the situation any less daunting.

And as you faced-off against the Captain of your Ship, you couldn't help but feel that the universe was probably against you. At least for that day.

To encourage residents aboard the USS Enterprise to be familiar with varying degrees of strength and fighting techniques, the Captain had decided that everyone would benefit from a little friendly competition. The fight pairs were generated using the computer, so there was no chance of cheating, though you wished you had asked one of your more technology inclined friends to take your name off the roster.

Aboard such a big Starship, you doubted anyone would notice that you hadn't participated.

Now, here you were, lying flat on your back after Captain Kirk had managed to trip you over. Sweat lined your forehead, and your chest rose and fell in pants as you tried your best to regain your breath.

A light smattering of applause followed your defeat, maybe they were impressed with a few of the moves you had pulled?

Moves that had been taught to you by your T'hy'la, Spock.

A well kept secret between the two of you, you had begged him to teach you a few Vulcan moves to better help you during combat. As a full-bloodied human, you were sure no opponent would expect something of the sort from you, giving you an element of surprise.

Spock had taught you a few of them, in the privacy of your rooms. It was a blessing that your room were right next to one another, though you had a sneaking suspicion that Spock had something to do with such an arrangement. You weren't complaining. It made it easy for the both of you to go and meet the other during your downtime.

Had he been one of the people watching? Did he see you using those moves?

A hand appeared in your vision, prompting you to take it as it hauled you up. Kirk gave an excited grin, his own body covered in sweat. "Damn, I didn't expect it to be quite the workout Y/n." You raised an eyebrow at him, another characteristic you had learned from your lover.

"Is that a dig on my size, Captain?" You asked, crossing your arms over your chest as you did. His eyes seemed to follow your movement, lingering just a tad bit longer at your chest. Rolling your eyes you snapped your fingers in front of his face, breaking his staring.

"Do I need to report you to HR, Captain?" You said, in jest, knowing he didn't mean anything by it. You had learned early on that Jim Kirk had the affinity to flirt with anyone of the opposite gender. It did not matter if they were of the same species or not.

He grinned back, reaching out to pat your shoulder in an affectionate manner. "No need, Y/L/N. We're all friends here." His words were followed by a teasing wink.

You opened your mouth to respond, when you felt a familiar presence coming to stand just beside you.

"Spock! Is it your turn next?" Kirk asked, thinking perhaps that the Second-in-Command was up next on the roster. They still had a significant audience around them, waiting for the next fight. You glanced at him out of the corner of your eyes.

To anyone else Spock would look the same. But you knew better. There was a certain tension around him that made hims grip his hands even tighter behind his back. Worry gnawed at your heart, but you kept quiet, waiting for him to respond.

"No, Captain, I simply came over to inquire about your opponents physical state of being. You did manage to hit her during your sparring session." Kirk frowned in confusion, just as your heart began to race as Spock turned his attention towards you.

And right there, in front of everyone, he reached out and gently took your hand in his. Silence echoed all around you as people stared gobsmacked as Spock locked your fingers with his. Though not before he managed to sneak in a brief brush of his fingers against yours in a Vulcan kiss.

If anyone were to know just how affectionate the half-vulcan could be when it came to you, they wouldn't believe it for a second.

"Are you well, Y/n?" He asked, his eyes drifting over your frame to check for any obvious injuries. He towered over your significantly, yet neither of you minded the different in height. Spock had once claimed it only added to your already endearing nature.

Translation: He found it adorable.

A smile bloomed across your features as you gave his hand a squeeze. "I am fine, Spock." You reassured him. Whatever trace of worry lingered in his gaze vanished at your assurance, though the tightness around his mouth remained.

"Is this what I think it is?" Kirk's voice came from beside them. The two of you turned your attention to the dumbfounded Captain. Spock, still holding your hand gave a small nod. "If you are referring to the nature of relationship I share with Y/n, then yes, you assume correct."

Knowing Spock wouldn't want Kirk asking anymore questions, at least not in front of an audience, you gently tugged at his hand. "Love to stay and chat Captain, but I'm starving and Spock promised to have lunch with me today."

With that you managed to pull your boyfriend away from the crowded gymnasium and out into the empty corridor.

Neither of you spoke, not until you were within the safety of your room. Turning to him with a bemused smile pulling at your lips, you voiced your thoughts. "What was that about? I didn't realize we were going to go public yet."

Spock, having recovered a little from what had transpired stood with his hands at his side. "I apologize, Y/n. I cannot seem to understand what overcame me." He admitted, to which you gave a small frown. "Overcame you? Spock you're not making any sense."

A small stretch of silence followed your words, as you recalled what had happened just a few minutes ago. Your mind replayed the scene, trying to pinpoint what had made Spock act the way he had.

Suddenly it clicked and your eyes widened. "Spock? Were you jealous when Kirk looked at my chest?"

The reaction to your question was instant. His entire body went rigid and panic flashed in his eyes. Unable to help yourself, you let out a small laugh, mirth shining in your eyes as you shook your head at you boyfriend.

Spock seemed to be struggling to say something as his cheeks tinged a slight green at having been caught so blatantly. "I admit, I did feel a surge of negative emotion when he did that. Which is what compelled me to announce the nature of our relationship."

His eyes met yours. "I hope you are not upset with my blatant disregard for secrecy." Your heart softened at the obvious nervousness that was in his tone as you smiled at him.

Stepping closer to him, you held up your hand, sighing softly as he took your initiative to instigate a Vulcan kiss. With your other hand you reached up to cup the side of his face, smiling as you felt him lean into your touch.

"I am not Spock. I am happy. It only means we do not have to hide from everyone anymore. And it was rather flattering, to have to step in when you did to show Kirk that I belonged to you."

Your last three words seemed to act as the trigger. Whatever self-control he had left hanging by a thread snapped, as he surged forward and pressed his lips to yours in a deep kiss. Raising yourself on your tiptoes, you returned his passionate embrace, arms moving to wrap loosely around his broad shoulders. His hands settled on either side of your waist as he pulled your body flush against his own.

Though it only took a few seconds for him to slide his hands down the side, to your thighs and help you wrap your legs around his waist. Neither of you broke the kiss as he gently pressed you against the wall. You shivered as his hands caressed the area under your thighs. He let out a deep moan as your nails, gentle yet sharp, scraped against the skin of his neck and the back of his head.

You were the one to break away first, panting heavily, as you gazed at him through lidded eyes. He still had his eyes closed as he began to press kisses along your neck, stopping to suck at a spot just under your ear, prompting you to melt against him as your very bones seemed to liquefy.

"Spock? I really need a shower." You whispered, remembering you had just had a sparring session.

"Then allow me to assist you."

You bit back a groan as your lips found his once more and you cradled his face between your hands as he carried you to the bathroom.

————————–

A/N: I feel sooooooooo evil stopping it here. Mwahahahahaha!

#spock #spock x y/n #spock x reader #spock x oc #star trek #star trek aos

326 notes · View notes

dailycupofcreativitea · 1 month

Note

AHHHHH you're playing kingdom hearts? Please report back with your thoughts when you feel up to it it's my special interest 👀

Okay here are some thoughts I've spammed to my friends in the last few days! (BTW I read the manga already for the first game so I basically spoiled it but I was still equally as shocked when these things happened in the game lol)

By the way, spoilers below for anyone who hasn't played!

General thoughts:

SORA IS SOOOOOOOOOO CUTE 🥺 The voice actor voiced him PERFECTLY, he's exactly the perfect combination of hopeful, friendship, little kid, strong heart, over confident at times, stubborn, sweet. 😭💖

Told a friend I love Sora in a different way than I love Gohan, here were my thoughts: Gohan is more quiet, sweet, gentle, burdened with a lot of power that he seems hesitant to use and slowly builds his confidence throughout the show, I relate to Gohan a lot, sweet cinnamon roll that must be protecc, but forced to protecc others, etc etc Sora is sweet and gentle but loud, has a HUGE heart and he uses it to protect his friends with 100% confidence (he's more like Goku in that way), his heart is just unwavering and he doesn't seem to doubt himself often (at least in KH1), funny and goofy and his stubbornness can get him into trouble sometimes but his bonds with his friends give him strength, I don't relate to him but I would love to draw inspiration from him

"Shonen protagonist done by Disney" vibes (as put aptly by @genisflyingkites)

Riku is so insanely jealous of Sora it's hilarious, he's overall kind of a jerk and even Kairi said she wanted to leave the island without him, but also Riku is 15 and hormonal and Maleficent got to him so I don't really blame him for it

Donald and Goofy are way less annoying than I assumed they would be, I like that they seem refreshingly mature?? Donald is stubborn and beefs with Sora a lot and Goofy seems like he has a good head on his shoulders and is a deep thinker

Also I keep seeing memes of Donald constantly getting knocked out in game and being useless but for me Donald ALWAYS comes in clutch with the elixirs and ethers

That scene where Maleficent tells Riku that Sora replaced him and Kairi with Donald and Goofy was sad in both the manga and the game but what REALLY made my jaw drop was that SORA LOWKEY FELT THE SAME:

(Yes he was fighting with Donald at the time too but LOOK AT HIS FACE!!! 😭🙏)

If Riku talked to Sora for more than 10 seconds at a time literally all of this would be resolved XD LIKE!! Sora is literally trying to find them! Riku please!

This scene had my sister and I's JAWS ON THE FLOOR:

It was low blow after low blow! I read this in the manga too but somehow it hit harder in the game!

Hollow Bastion is a great OST and I've been listening to it on repeat. The map is also pretty nice but I wish I could explore more without heartless appearing every 5 seconds

Actually I also liked the OST "A Day in Agrabah"

I beat Riku's ass in 10 seconds and it was glorious (Ansem is a whole other story...still working on it)

DID I MENTION SORA HAS SUCH A KIND AND SWEET AND STRONG HEART!?

Every single cutscene had the words "light" "darkness" "friendship" "heart" "memories" repeated over and over again to form a cutscene (I saw this in a Youtube video and thought it was incredibly accurate XD)

My sister and I were CRACKING UP during this cutscene because it made NO SENSE

It just kept getting more and more non-sensical XD

I think Aladdin was my favourite world so far but tbh they were all pretty cool (Sora's Halloween Town fit was so cute! Also I loved flying around by Big Ben, and then getting the glide feature)

The Maleficent Dragon boss was really hard, cool, and fun; Tinker Bell really came in clutch

Also I gotta say this game is really hard to play because the control are so annoying, the jump function is annoying (I keep falling off and misjudging his jump), it keep glitching cause it's connected to the cloud or something, the directions are too vague so I have to follow a walkthrough while playing, and I have to keep stopping between plays because I get motion sickness from the wildly spinning camera really easily -- despite all that I am indeed having a blast

I think that's all my thoughts for now :3

#kingdom hearts #kingdom hearts 1.5 #kingdom hearts 1 #sora #does sora have a last name?? idk #riku #kairi #idk how else to tag this #asks

40 notes · View notes

letsquestjess · 2 months

Note

Hello it's me again! I have another request for Tech if it's not a bother.

Ok, so it's based on my habit of reaching out to my best friends hand for like comfort or just because I feel calm with them. So WHAT HAPPENS WHEN (in some senerio you can pick) WE REACH OUT FOR TECH'S HAND. Just imagine we're out here holding his hand, not even realizing it, and Tech is just confused or a bit panicked/flustered because it was out of nowhere.

Just a little idea I've come up with, so no pressure to actually write it.

I hope you have a good day see you later!

Hello again!!! This idea is so sweet. Thank you for sending it in! 😊💜

Your Hand in Mine (Tech x GN!Reader)

Summary: Tech misses Echo, and all you want to do is offer him some support.

Word count: 1.2K

Warnings: None.

-- -- -- -- --

With a grunt and sweat dappling your brow, you exerted all your strength to turn the wrench one last time until the final bolt resisted beyond your might. “That should do it,” you said, your grip tightening on the rails as you descended the wobbly steps braced against the side of The Marauder. “Try it again.”

A few rhythmic taps on the datapad set the capacitor unit into motion. The inner workings clattered, and a momentary panic washed over you. After a minute, the mechanism settled, the pipes trilling to mock your initial worry.

“How are the readings looking?” you asked, stepping back a pace to admire your handiwork. It wasn’t too shabby, if you said so yourself.

On your homeworld, you had only been able to work on practice builds, never experiencing the thrill of fixing up an actual ship until your swift escape with the Batch. Eager to repay the clones who had saved your life, you insisted on helping them maintain their craft. Tech had welcomed the assistance and wasted no time in creating detailed lists and charts, keen to pass on his expertise to a willing listener.

“Everything works as expected,” Tech reported. “You are a quick learner.”

“It was my second try,” you said with a disappointed shrug.

“Echo used to say that a second attempt meant a lesson truly learned.”

At the mention of your missing team member, you spotted the involuntary twitch by Tech’s right eye and the shadow over his expression. You may not have noticed the subtle changes if you hadn’t been by his side almost every waking hour for the past few months. Echo had only ever been mentioned in practical terms, if a communication had come through or if providing vital intel. This time, however, you could tell it was different. Tech missed him. Not as an asset to the squad or for his contributions, but as a brother. As a treasured part of their family.

He cleared his throat with a short cough and worked his fingers on the screen. “While I cannot vouch for the sentiment’s accuracy, I will include your second attempt in the records.”

When he lifted his gaze, a reticent look pinched at your features as though something unspoken idled on your lips. Assuming you were still downplaying your work, he stood up from the makeshift table. “Please do not think poorly of your efforts. You are progressing well and your assistance is appreciated. I am confident that you will be capable of making repairs on your own soon.”

You went to assure him you would always welcome his presence, but the comment snagged in your throat. Despite your reluctance to admit it outright, you couldn’t deny that you secretly enjoyed his company. His calm demeanour and sincere words of encouragement helped ease the anxiety of your escape, and you itched to reach out to him. There were moments when you had got close to sweeping your hand over his, when that saddened look burrowed so far into his usually softened expression that you were forced to make the conscious effort not to soothe his apprehension with a supportive touch. You had no way of telling if that was what Tech wanted, and the last thing you wished was to make him uncomfortable and risk damaging the bond you had built.

“Thanks,” you said, collecting the tools scattered on the lowered steps. “I can put the panel back myself. I know you have other tasks to get done.” Without waiting for a response, you ascended the ladder and secured the metal bulk, the deafening shriek of the drill drowning out all other sounds.

He blinked up at you and analysed the intense concentration on your face. Not wanting to disrupt your work, he quietly entered the ship to carry on with his daily duties.

* * *

Omega’s giggle infused the air in the seconds before she appeared from behind The Marauder, Wrecker in quick pursuit. Just as he reached out to catch her, she evaded his grasp and hoisted herself onto the front turret, perched like a little assassin waiting to strike.

“You’ll have to be faster than that,” she called down to the brawler.

“You don’t think I can climb up there?” he challenged.

“Don’t even think about it,” Hunter yelled from beside the smouldering ashes of the fire. He stacked the cleaned plates and cutlery into the storage boxes and propped them on the steps. “Back inside.”

“Five more minutes,” Omega pleaded over Wrecker’s huffed groan.

“No. Come on.”

With a nimble leap from the turret, the girl retrieved the box of dinnerware on her way aboard. Wrecker followed her inside the ship with a whispered promise to continue their game when they next landed. He was, after all, still winning, and he wasn’t about to lose because of his brother’s overprotective nature.

Hunter swung to you and Tech, one foot on the ramp. “I want you both ready to go in ten. Okay?”

Attention glued to his datapad, Tech responded with a half-mustered salute, and you reciprocated with a nod of your own.

Once you had finished clearing the rest of your equipment, you wriggled the slim crates into their designated spots in the storage hold underneath the ship and locked the hatch. Dust clung to your jacket, and you wiped off the dry specks as you made your way towards the intelligence clone.

“Need any help with the receiver?” you asked, gesturing to the small device plugged into his datapad. The disc hummed as the blue light traced its perimeter, scanning and collecting data.

“That will not be necessary,” he assured you. “I have a strong enough signal for incoming transmissions.”

You positioned yourself next to him, your hands resting in your lap as you took in the view of the tundra and plateaus. The setting suns painted the horizon with fire and from the growing shadows, nighttime animals stirred. With sunlight fading fast, you wouldn’t be able to remain outside for much longer, but Tech persisted with his personal mission, resolved to make the most of the remaining light.

“Still waiting to hear from Echo?” you questioned. As he lowered his head, your eyes followed the motion, drifting along the peeling bark of the log where his hand rested. Guided by instinct, you gravitated towards him and brushed against his knuckles.

Tech stared transfixed at your connected hands, lips parting and a verbal response dithering on his tongue. Before you could retreat, the fluster within him relaxed into an appreciative peace, and he entwined your fingers.

A warmth flooded your cheeks as you met his eyes. Sincerity swelled in the amber and erased the furrow between his brow.

He held onto you like a lifeline, like an anchor keeping him grounded when worry clouded his thoughts and the fear that he may have to face a tomorrow with one less brother haunted him. “Thank you,” he said, barely a whisper amongst the rising coos and whistles of the wildlife.

“What for?” you asked.

He cradled your palm to his chest, and a reverence came over him, a surety that wrapped him up safe, and warm, and secure. “Everything,” he whispered, thumb rubbing the back of your hand. “Thank you for everything.”

#fic asks #fic request #tbb #the bad batch #tbb fanfic #tbb fanfiction #the bad batch fanfiction #tbb tech #tbb tech x reader #tbb tech x you

42 notes · View notes

pencil-peach · 3 months

Text

G Witch Onscreen Text: Episode 22

Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.

<< If you forgot, Episode 21 will remind you of What You Can Do Now Or you can go to the Masterpost.

It's the dawn of a New World.

After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.

TEXT: (Lefthand side) - Link Strength with Aerial currently

(Middle) System Report -Permet Inversion Reactor STATUS:

Permet fluctuation reduced to [???]

Topological heat exchange catalyst replenished

Permet inversion reactor output decreased to 61%

Permet field stabilization in progress

(Righthand side) - Link Strength with Gundnodes currently

Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...

I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.

It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....

The news report Rouji presents is from PNB, and the headline is:

Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero - Assembly League fleet devastated, evacuation warnings issued over wide area. - Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."

It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.

The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).

We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.

Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force. In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.

I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.

Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.

But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.

And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).

On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.

Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)

Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.

Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.

In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.

At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.

Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.

In the end, it's not violence that allows Suletta to rescue Miorine. It's love.

And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.

When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.

Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.

And sometimes, he's still your dad.

Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.

It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...

It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.

Rolls up my sleeves

(Left, Top to Bottom) Quiet Zero - Current status summary

MOBILITY - After restart, movement velocity of enemy basepoint is predicted to increase - Velocity of each enemy MS also predicted to increase by average of 37% - Evasive Maneuvers of main unit will be complex

DEFENSIVE FUNCTIONS - Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach - Defense barrier strength 67942049 - Very difficult to invade domain while mutual defenses of basepoint and MS are linked

(Right, Top to Bottom)

WIDE-AREA DATA STORM CONTROL FUNCTIONS - Expands data storm domain and stabilizes it over a wide area - Domain is predicted to expand further in future

DATA STORM DOMAIN - 60%

PERMET DISPERSAL SYSTEMS - Permet dispersal index exceeds 200 - Permet density x 27.1 - Density increase is accelerating

REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES - Increases interconnectedness of overall enemy - Each MS appears to become a sub basepoint - Basepoint and all Gundnodes are linked - Link multiplexing confirmed, jamming impossible

A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.

In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links

(Baori Pack) - Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions. - Can also be separated from the main unit...

The 'Daedalus' multi tool system...interessante...

In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).

When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.

If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.

I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.

Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!

Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions

I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.

The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.

If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.

In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.

'CGG' functions as a blank space between words.

So, for example, if you wanted to write, "I love you, Suletta." The code would be:

GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT

In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)

I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.

You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.

But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice. (The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)

Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.

Sibling fights....

It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...

To find out, Click here to go to Episode 23 >> Or maybe the Masterpost could remind you.

#g witch #gundam the witch from mercury

31 notes · View notes

no-where-new-hero · 5 months

Text

✣ Blake Wrapped: 5 Star Reads 📖

The first half of this post can be found HERE, and these were my 5-star reads for the second half of the year (in rough order). Tagging @batrachised, who was interested in recommendations!

Some Desperate Glory by Emily Tesh I posted a lot about this when I read it because in my opinion it’s one of the best SFF novels I’ve come across in a while. It reminded me of DWJ’s Hexwood, which is already high praise, but it’s a fabulous character study with incredible dynamics. It’s another new book with truly horrible marketing, imo—the whole “queer sci-fi” angle gives the impression of a Gideon the Ninth rip-off, but there’s much more political and social commentary with fabulous world-building. Highly, highly recommend this one.

He Who Drowned the World by Shelley Parker-Chan I loved the first book in this duology, but this one was exquisite to new heights. Even though it was never that overt, it did a lot of great meta-commentary work on the chosen one trope vs the doomed by the narrative trope, especially their intersection with gender expectations. The prose was simply gorgeous, occasionally philosophical, always sure-handed. I recommend the whole duology, though mostly so that you can get to this one.

The Haunting of Hill House by Shirley Jackson I picked this up in my library’s for sale room, and it was the best choice I made this year. I can’t believe I had been missing out on Jackson for so long. It’s a ghost story and a Gothic novel and a girl book and feels a bit like the shadow side of an LM Montgomery story. The language and characters are rich and strange and is so thoroughly a Blake Book of all time. I want to be able to write something like this someday.

Yellowface by R. F. Kuang The reports of its readability are true—I went through this in three hours. I get why people complain about certain elements in this, but it also lives up to the hype, in my opinion. I might be the target audience as an aspiring author (who got throughly traumatized by the portrayal of terminally online author culture lmao) but I do think those dynamics and circumstances are its strength, more so than the social commentaries on Asian American tokenization, etc.

How Long ’Til Black Future Month? by N. K. Jemisin I don’t often read short fiction, but I was in the mood for some good SFF shorts to learn from, so picked this up. Jemisin is a master of form—her ability to depict a world in such a brief span, to make such deep characters with such clever scenarios is unmatched. Certainly, there are some better examples than others, but the best makes me wish there were a whole novel set in that world.

Hangsaman by Shirley Jackson This one is a slight cheat because it’s not Jackson’s best, but it’s also a Blake Book of all time, so how could I not give it five stars? I wish I had discovered it in college, if just to be able to be insufferable and call myself “irl Natalie Waite” everywhere. It’s such a Tumblr book too—the veiled queerness, the Plath vibes, the dark academia setting, the unhinged vibes. The prose is gorgeous and unsettling and is such a good portrayal of a character.

#bookblr #book review #book recommendations #reading recommendations #some desperate glory #he who drowned the world #hangsaman #the haunting of hill house #yellowface #how long til black future month #nk jemisin #rf kuang #emily tesh #shirley jackson #shelley parker chan #blake's last braincell #immortal poets society #blake wrapped

34 notes · View notes

roses-dreams-andthorns · 1 year

Note

Hi Author-nim! Could you please do my request? If you don't want, you can ignore it.

If yes, could you please do GN!MC as Lock from "Trash of the Count's Family"?

(sorry if i have grammatical mistake)

Have a good day/evening Author-nim ♡

oooh! Is that a webcomic? Trey's never heard of it before but Trey will do their best! Trey did some reasearch beforehand so it should be acurate? if it isn't I'm very sorry! You didn't specify what characters to do, So I'll just do the Riddle, Azul, and Jamil if thats okay!

GN! Reader!

HE LOOKS SO CUTE THO!!! AWWWW!

Riddle

When he had first saw you, he figured you'd be just like Ace and Deuce, he was slightly correct, in a sense, as you weren't the brightest, and were quite naive, but when he spoke to you for the first time, he now realized you were more on the shy and timid side, you tried your best to follow the Heartslabyul rules, but you find it hard to memorize all 810 of them... the only one you only slightly remember well is "If you eat a steak on a full moon, a cat must play the violin."

He finds your naiveness slightly adorable, and how shy you get while speaking to him, because of this, he never thought that you had another side to you... Prior to Leona's overblot, during a fight with Jack Howl of Savanaclaw, you had entered your berserk mode and you shine out as a more delinquent like version of yourself, being stubborn and courageous, and insanely strong, you swung at Jack with your hands, which now had claws, your presense was threatening now, and he began to grow slightly scare of you... but after the fight you began to grow far too exhuasted to even move, Ace and Deuce carried you to the infirmary while dragging Jack with them so he could spill the tea on what the hell was going on with all the injuries happening around campus.

Azul

Oh dear... you poor, poor unfortunate soul... your naiveness is hilarious, falling for his tricks almost immediately, thinking he's trustable in the first place, but he also finds your shyness quite adorable, stuttering when speaking to anyone you come across like a shy little puppy... a perfect oppertunity for blackmail, pre overblot, he only saw you as a means for easy business, but post overblot, he's grown quite attached to you, praising you for your efforts and for helping him around the lounge, he feels so lucky to have someone as kind, yet so naive as you. He's at least lucky you've never used your berserk form on him, though the tweels say otherwise when reporting back to him...

Jamil

You're similar to Kalim... very similar. Besides the fact you can actually take care of yourself instead of relying on others, he first took advantage of your naiveness and weaknesses, luring you in to become a part of his plan to overthrow Kalim from his position as dorm leader, though it was quite difficult to get you under his unique magic, as you hardly ever make eye contact due to shyness, but the second you do, he's got you right where he wants you.

Post overblot, he treats you more like a close friend, if you're sick, he'll help treat you, you got injured and can't cook today? he's already got some dinner made for you and ready on your table. You do the same for him as well.

He only saw your berserk form once, and he never wished to again. The durastic change in your personailty and actions... he couldn't handle them well, especially since this was pre overblot. He had underestimated you and your strength. He still probably has a few scars and bite marks from when he fought you in full berserk mode, you tend to feel guilty about that, but he always says "No, no, I deserved it, really."

You always tell him to treat himself, and if he doesn't? You're treating him. You don't care how packed his schedule is, you'll deal with it later, right now, you're taking him to a nice resturant for dinner and treating him like a sultan for a day, which makes him quite happy.

#twisted wonderland #disney twst #riddle rosehearts x reader #azul ashengrotto x reader #azul ashengrotto #jamil viper #jamil viper x reader #twst jamil #twst azul #twst riddle #riddle rosehearts #twst x reader #trash of the count's family

126 notes · View notes

blood-orange-juice · 11 months

Text

Now that everyone is also in awe of that twitter thread about Childe being Smart I want to rebutt half of it.

Personally, I think he's perfectly average/a bit smarter than average, or rather good at some things and bad at others.

He's a quick thinker, proven by his character stories (people are indeed not assigned into vanguard just for dumb strength) and by how he used Traveler to check whether the forged sigil worked and sow some discord in the process (obviously his own plan and a good one at that. and he came up with it in a matter of minutes). Being able to lie through omission is no easy feat either.

He's quite poetic and it's usually a sign of intelligent person. (modern AU untraumatized Childe would 100% be a literature major, don't @ me. he'd also like Manowar)

However, he is also young, had no proper mentor and no formal education. Also brash and too self-confident at times. You *need* to be comfortable with doubting youself to be smart, it's thinking 101.

For starters, not suspecting Zhongli to be Rex Lapis was... an accomplishment in and by itself. The city breathes of this story. There are at least three books on the topic, it's told in every tea house, the traveler learns it through a single conversation with a trader in port. A golden-eyed person with excellent taste is always Rex Lapis or at least should be suspected to be him.

Childe somehow missed it, while being able to analyze intricacies of Qixing politics. This is bizarre and means that either he's extremely narrowinded (he doesn't show signs of that, quite the opposite), or that he was simply repeating someone else's ideas. His subordinates obviously bring him news and reports. So… how do we know his ability for political analysis is his and not someone else's?

He does look like the type who would repeat another person's good idea as his own (I'm imagining that's exactly how Zhongli tricked him into that whole sigil of permission thing).

Having said that, being able to listen to information brought by your subordinates is a rare and precious trait, I wish some of my bosses were more like that, haha.

(alternative option: that is in fact his own skill and one of the few skills where he did get actual mentorship. Pulcinella drilled attention to politics into his brain because otherwise things always got too messy when Childe got involved

it would also mean that nothing can drill attention to cultural stuff into Childe's brain because fuck it we ball)

Being able to copy sigils well enough? First, it's the job for the r&d team (can we have some appreciation for the Fatui r&d team, please)? Second, I'm not sure anyone truly copied those. Maybe Zhongli just enchanted every single one.

I they were actually succesfully copied, we have a problem of fatui being able to mass-print them and I don't want to think of the consequences. I hope Zhongli didn't let that happen.

Manipulating Traveler to do what he wanted in the Liyue arc? It's not like the Traveler had a lot of options or any personal loyalty to the Qixing. Did anyone really trust him to be our friend? What other choice did we have though but to follow his lead.

That's 10/10 for opportunistic thinking but it's not really a showcase of his manipulation skills (I'll keep thinking his social skills are abysmal until proven otherwise).

Being able to tell you just came from the blacksmith? Please, it's not him being observant, he just had you followed.

So, yeah... he's smart but he's also, what, 19? 20? (I hc him on the younger side because it helps me overlook his bad traits). It's amazing he got this far and he'll become smart one day but that day hasn't happened yet.

In other words he is far from dumb but the fatui do treat him as dumb muscle because what do you expect.

#I also hc him as having good intuition about people #proof: he's still alive and in one piece #and so are his siblings #so if childe says something about a person I believe it with very few questions #not his interpretaton #just the vibes he's getting #imo he's more about intuition than actual thinking #childe #tartaglia #fatui #genshin impact

40 notes · View notes

dreamyfanfix · 8 months

Text

Chapter 6: Strength is for the weak

Updates (AGAIN): Please note I made a few major changes to this chapter. Read it again!

Past:

As Violet walked with Kate and Anthony through the party Kate was surprised by just how much she was able to keep such a stoic face. Kate on the other hand was petrified, she held onto Anthony's hand for support. Anthony looked at her and smiled but it did nothing to calm her nerves.

Kate and Anthony are led to a room with a patio view of the party. It was a stunning view. On the patio, Kate can see Lady Ledger seated with documents in her hand.

"Hi gran. What's all this about?" Anthony asked.

"Kate, I've only known you a short time, but it's clear you're a very smart woman," Lady Ledger spoke and Kate smiled up at Anthony and then at her "But, I will not permit you to ruin my grandson with your ambition,"

"Gran!" Anthony exclaimed. Anthony held her hand a little stronger.

"I'm sorry to tell you but Kate has been lying to us about her family and her father," Violet spoke now. Kate could finally see the resemblance between Violet and her mother.

"What? What are you talking about?" Kate asked.

"I hired a private investigator to look into her past," "Mother don't you dare," Anthony interrupted but Violet continued, "She said her father passed away 3 years ago from cancer but that's not true,"

"What?" "Mum stop!" Kate and Anthony interjected but Violet continued undeterred.

This time speaking directly to Kate "Your birth mother's husband is very much alive. During her marriage, she cheated on him and ran away with a mechanic, and before she could be located, as she was pregnant, she ran away to England,"

Kate could barely hear the words Violet was saying "No. No. No," Kate for the first time in her life had no words.

Kate tried to take the pages from Violet who was trying to hand them off to Anthony and took a look at them. She saw the marriage certificate, the missing person's report even the attempt to dissolve the marriage all with her birth mother's name on them. Kate could barely breathe.

Violet took the pages from Kate with little fuss and tried to hand them to Anthony "It's all right here,"

Anthony looked furious "You had no right!"

"We had every right!" Violet exclaimed.

"No, you did not!" Anthony said.

"Do you know what kind of scandal this would have caused for Kate to be hiding something like this?" Violet asked Anthony.

Kate was now just feeling so small. She did not care about Violet or Lady Ledger anymore she looked up at Anthony "I didn't know,"

Anthony looked at her in the eyes and then back at his mother with fury. Before he could say anything though Violet spoke "We cannot be linked to this sort of family,"

Kate was now tearing up. It reminded her of her childhood when she had been scolded by her parents, she was both ashamed and embarrassed. She wished the ground would swallow her whole. She glanced at Lady Ledger and she had a smug smile on her face. Kate felt like she was going to be sick for the second time that day.

Violet spoke "Anthony we could not even be sure her father is her actual father. Can you imagine that? The scandal of it all!"

Kate took a step back while Anthony and his mother went back and forth yelling at each other. Kate thought about all the times people would say she and Edwina looked nothing alike. It stung because Edwina was stunning but Kate always thought that she just took after her mother's side of the family. It hurt Kate in a spot of her heart that she had spent her whole life guarding so strongly: her family.

"Mother I do not care what you think about her family. I love her!" Anthony said.

Violet tried to grab his hand and said "In our lives, family is everything, Anthony! How can you be with someone who might have been keeping this from you?"

"Cause I already knew!" Anthony hollered.

"What?" Kate said and Anthony looked at her.

"Don't worry Kate, I already knew about all of this before this ambush," Anthony said in a soothing voice.

Anthony took a step towards her but she took a step back "Why did you know all of this before I even did?"

Anthony looked confused "Kate I do research on most people in my life,"

"You do realise how messed up that is, right? Were you just gonna hold that information about me forever? At what point in the 8 months we have been dating do you think of telling me about this? You have no right to even be mad at your mother then!" Kate exclaimed. Anthony tried to respond but Kate held her hand up and looked towards Violet "You don't have to worry about me messing up your family reputation Lady Bridgerton, because I want absolutely nothing to do with your family,"

Kate hated feeling small, she hated people who tried to drive a wedge with her family. She had spent years feeling insecure with Mary as a stepmother especially after Edwina was born but Mary had treated her like nothing less than a daughter even after her father died. Mary mourned for a good month and then resumed getting her Edwina prepared for schooling. Reminding Kate to eat while she studied, called her and always tried to keep her close. Mary had run away from her family so Kate understood that her mother just wanted to keep the family she had left close. Mary was not the best at organisation and planning but Kate loved it and was good at it so she stepped up. Kate always had at least one loving parent in her life and she was not going to let Violet & Anthony Bridgerton take that away from her.

Kate ran away from the scene. If you asked her how she ended up being escorted out of the party by Simon then you would not get a straight answer. There was a ringing in her ears, a lot of shuffling and bumping into people and then she was in a car with Simon holding her as she cried.

----

Present:

Kate loved 'Nailed It' on Netflix. The premise was simple: Under a time limit, amateur bakers have to recreate often elaborate cakes to the satisfaction of the judges. It was simple enough that Kate could mindlessly watch while she ate popcorn for dinner cuddling her corgi puppy Newton. Popcorn was not Kate's usual choice of meal but between her long schedule and her inability to open her spice cupboards without getting an overwhelming sense of nausea, popcorn had to do.

Living alone was not something Kate ever sought. She loved being with her family or friends in uni. The only time she ever thought about living with someone else was when she was with Anthony so it came as a shock to everyone when she decided to move out after her breakup. There was something about living at home that felt claustrophobic, between Mary and Edwina's knowing and pitying eyes and the constant reminders of not just Anthony but other people she had lost, Kate had spoken with her therapist and decided that maybe a change of scenery was what she needed.

She started looking for flats in and around the area, and then she went to viewings but it wasn't until 'Moving Day' did it all feel real. Kate remembers how mad Edwina had been about her decision and on that day she had refused to come out of her room because she felt like Kate was making a drastic change in their lives. Kate was sad but Edwina eventually peeked out to give her a goodbye hug. It wasn't until she went to leave that she saw the sadness in Mary's eyes and even though she was able to make until she got to her place. She broke down. It was supposed to be the Sharma women vs. The world and Kate felt like she was letting them down and she felt guilty.

2 weeks later Kate was feeling a bit better about her new normal when Mary showed up at her door with a sad smile, Butter Chicken (because it was one of the only dishes she knew) and a corgi puppy. Mary explained that they weren't mad that she had gotten her own place, they were sad because they felt like she was running away from them and she did not think it was a good idea for Kate to be alone so soon after her breakup. Kate explained herself and that it was not an easy decision for her either and Mary agreed so in an effort to calm Mary's mind and for Kate to still have company she adopted a corgi puppy for her. Kate named him Newton, her father would have loved that, if he ever let her and Edwina get a dog that is.

Kate was hesitant about taking care of a dog but Newton was so cute at times it caused a deep yearning in her she tried to ignore. When her therapist suggested she join dog groups online for advice or socialising, Kate was hesitant but her therapist reminded her about being more social and finding avenues to be fulfilled outside of work and her family. Kate joined a dog group that met at different local parks and from the suggestion of one of the other dog owners, she joined other Facebook groups like one for painting, horseriding and swimming.

Kate had made quite a few friends through the activities and was surprised at her popularity among young active men. It turns out that once she opened her horizons outside her field there were nice and like-minded men. She went out with a few, some bad, some good, some good in one aspect only (Pav was overall enthusiastic but not that bright) and then there was Ryan Bagwell.

Ryan was not Kate's usual type, he was relaxed, artistic and spontaneous. He was one of the volunteer instructors for the painting group and Kate felt a bit turned off by it at first that was until he showed her what he did. He was an architect, more alternative than the average architect but he also owned galleries. It was through him that Kate had her first run-in with a Bridgerton since the breakup. Benedict was there viewing Henry's work (Kate's fault for not getting Henry's last name) and they bumped into each other. The interaction was stilted but when Kate mentioned she was with her boyfriend Ryan, Ben relaxed and said Anthony was also seeing someone. It hurt but only for a moment. Benedict tried to exchange numbers but Kate was not interested and he was nice enough to leave it at that.

It was after the show that Kate had to tell Ryan about her history with the Bridgertons. Ryan was understanding and told her that he liked her and wanted to be in it with her for the long haul so Kate was happy. Edwina loved him and Mary found him interesting so it seemed pretty simple. For once her dating life was stable. Her and Ryan would go out dancing and hiking and Kate had never felt more alive than when she was with him. He was good about her friendship with Simon he also encouraged her to make other friends and that is how she reconnected with Sophie from Law school.

So to have to break up with Ryan was not easy. She did not want to lead him on and things in her life were not going to slow down any time soon. She told him that she did not want to ask him to wait for her to get her life in order and he understood. He told her he was always going to be here for her and told her to not feel weird about attending painting classes because he would still like to see her. I mean they were friends before they dated so it was easy to slip back into it. Still, Kate wondered how Ryan had gotten so well-adjusted and if she could steal his personality.

So it was a Thursday night and Kate was on her couch cuddling with Newton and eating popcorn when she heard thundering knocking on her door. Kate checked her phone and saw the time (10.30 PM) but also that no one had called or texted her in the past few hours that would warrant such urgent knocking and that's when the knocker spoke.

"Sharma, open the damn door! I know you are in there!" It was Simon.

Kate went to open the door and Simon walked in aggressively "How nice of you to drop by unannounced Si," Kate closed the door behind him.

Simon had sat at her kitchen island but was turned to her with a scowl "Don't treat me like an acquaintance, you know why I'm here,"

Kate's blood froze "Who told you?"

"What do you mean who told me? You didn't think I would notice you haven't been working at the firm for the last month?" Simon asked.

Kate visibly relaxed and went to get some wine glasses and a bottle, she placed the glass in front of Simon and poured him a bit and then one into her glass but she did not move to drink it "I'm sorry it has been a chaotic time, I meant to tell you the last time I saw you but things were tense after the news around Anthony. I forgot,"

Simon took a sip from his glass and then said "I need this. Between Daphne and the baby and the mess with you and the Bridgertons, I have not had a good moment's rest,"

Kate could not help her curiosity "What's going on with the Bridgertons?" Simon looked at her with a look that said 'Do you truly want to know?' and she continued "Oh please, you so came over here to vent,"

Simon sighed "Things have been a bit messy. Daphne and Benedict have tried to step up and take over some of the responsibilities that Anthony was dealing with but it is becoming clearer and clearer that the family had no clue of what it took to maintain them," Simon sighed.

Kate scoffed "They are a smart brood they will get it eventually,"

"Well eventually cannot wait. Benedict has been so stressed out that he spaced and missed the payment for Eloise's second semester at uni and she almost lost her spot. Luckily, she decided to take it over because Ben then ran into issues when Colin almost got arrested in the Phillippines for smuggling drugs luckily the ambassador in Manila is a friend of Violet's and was able to get the prescription we faxed over for the drug to the police. It has been one thing after another, there are too many Bridgertons and not enough hands. It's stressing a very pregnant Daphne out, which is stressing me out," Simon took a rather large sip of wine after his rant.

"I'm sure you guys will get a handle on it. I feel bad for Ben, handling the family like this was not something he ever thought he would do..." she added the next part in quieter "...or even wanted to do,"

Simon eyed her oddly at her statement "Yes... Well, I'm tired and I need you right now," the last part came out as a bit of a whine.

Kate reached across the table and grabbed Simon's hand "I'm here if you want to talk,"

"That's not what you said last time we spoke,"

Kate straightened up her position and sighed "I was tired and overwhelmed. I'm feeling a lot better about it now. You are my friend and you made me godmother to that little Basset baby and I'm not going to let you down," she said with a smile.

He returned her smile "How does Ryan feel about all of this? Are you guys still taking that break?"

Kate sighed. How much was she going to tell Simon? Honesty is the best policy "I'm pregnant,"

For about 10 seconds all you could hear was the mindless chatter of the TV in the background until Simon reawakened and asked "It's Ryans, right?"

Kate was taken aback "Why did you ask me like that?"

"Is it Benedicts?" Simon asked in such a hushed tone Kate grew concerned.

At first, she thought he said the wrong name but then she looked at his face and realised he was serious and began to laugh.

Simon stood up and exclaimed "Kate this is not a laughing matter,"

Kate said wiping her eyes "Except it kind of is,"

"How far along are you?"

Kate did not answer so Simon came around the kitchen island and lifted her shirt "Jeez Simon, that is a violation. You don't go around lifting women's shirts,"

"You do when they are your friend and they refuse to answer straightforward questions,"

"I was going to answer you if you had given me the chance. I'm about 4 months," Kate said.

Simon took Kate's wine glass and the bottle of wine to the other side of the island and finished all of Kate's glass, immediately pouring another glass and said "Well, you are barely showing,"

"Yeah, small pregnant bellies run in the family," Kate said with a shrug.

"You never answered my question though. Are you and Ryan back on?" Simon asked all his attention on her.

"Well, no actually we broke up," Simon's eyes widened and took a sip of wine but a thought popped into Kate's head and she asked, "Wait, why did you think the father could be Benedict?"

Simon's eyes widened but he sighed and spoke "Well, I've seen how close you guys have been since he had that art show. Ryan might have expressed concern that Benedict might be a problem but I shut him down..." Simon took a breath and continued "Then Anthony also expressed he felt you and Benedict are close. Benedict is single and a bit reckless when picking partners,"

"Hey, I liked Henry and seriously Simon, that's it? That sounds like you're slut-shaming Ben which is rich coming from you and Anthony," Kate said incredulously.

"That's what I thought too until after the baby shower," Simon said with a shrug.

"What happened after the baby shower?" Kate asked.

"I saw you leave with Ben, Kate. After you told me about taking a break with Ryan, what else was I supposed to think?"

"That I got pregnant with my ex-boyfriend's brother's baby? What do you think of me?" Kate said with what she hoped was massive amounts of sarcasm.

"You forget that I was the one who picked you up after 2 one-night stands," Simon said gesturing.

"That was months ago before I even met Ryan," Kate said incredulously.

"The night of the baby shower Ben and Anthony got it a huge fight. More blows were exchanged than that night Ant caught me with Daph. Ben told Anthony that he was ashamed of him,"

Kate's heart constricted as she sighed "That's not good. The last thing I wanted was to come between them,"

"Well, the week after that, we got the news of Anthony being in the hospital so it's not been easy,"

Kate covered her face with her hands, she needed to speak to Ben soon "Ben only helped me because he knew I was pregnant already," She sighed and then closed her eyes before saying "He knew the baby was Anthony's..." Simon looked shocked and ready to speak but she continued "That's why I took Anthony aside to speak to him at the shower, he had been ignoring my calls. Ben told me I had to tell him but then Anthony yelled at me so terribly and Ben heard so he took me home and comforted me. He's more like a brother to me, like you,"

"When did this happen, Kate?"

"I just said at your baby shower," Kate answered.

"What?! Did you get pregnancy brain? I meant when did you and Anthony hook up?"

"Hook up? Grow up," Kate said as she rolled her eyes but she continued when Simon gave her a stern look "During your engagement, me and Anthony realised we could not ignore each other forever so we agreed to be friendly,"

Simon scoffed "You two only have two gears: at each other's throats or madly in love. No in-between,"

"Yes well, Ryan noticed that as well and that's when we decided to take a break. When you guys were coming back from your honeymoon Anthony and I thought it would be a good idea to host a lunch for the day you got back so we met up and well one thing led to another and we ended up staying in his bedroom for most of the day," Simon took a healthy sip of wine and she continued "Ben caught me in his apartment later in the day so when Ben, Anthony and I got together to organise your baby shower, he saw me throwing up and he put two and two together,"

Simon took a few seconds to ingest all she had told him and then asked "So I'm going to guess you are keeping it?"

Kate nodded and Simon stood up and came around the kitchen island to embrace her. She was not sure if it was pregnancy hormones but she got teary-eyed.

"Thanks, Si," Kate patted Simon's back "I'm guessing you are no longer angry with me for ignoring you all this time, huh?"

Simon chuckled "Oh no I am. Only now I'm mad at you for stealing my thunder," Kate giggled and Simon leaned back and said "Congratulations Kate. You'll be a banging mum,"

"Thank you," Kate said definitely crying now.

----

Kate telling Simon about her pregnancy started to make the whole thing real. At this point, more and more people who were not the father were beginning to know.

Before he had left her place last night, in a super expensive Uber, Simon had scolded her for keeping her pregnancy news for as long as she did but Kate had concerns, especially after Anthony's outburst and then hospitalisation. She wanted to visit him but she was afraid if she did then she would blurt it out and the idea of being vulnerable to him like that was unnerving. Her therapist had told her that if she had Anthony's baby she would be tying herself to him and his family for life and that there was no way of escaping it. It was a scary thought.

Kate thought long and hard about it, seeking advice from Sophie on it. Sophie tried to leave her Family Law self at home when advising her. Reminding her that at any point something could make her a single mother and that she should only have the baby if she wanted to be a mother, with Anthony by her side or not. Sophie did sneak it in that Kate should draw up documents to leave her parental rights to her stepmother Mary and Kate asked if she would consider being second after Mary and Sophie hesitated but accepted. It was a gloomy conversation that ended with laughter and tears.

Kate did not want to be one of those women who never allowed their baby's father in their life but Kate could not help but feel hesitance whenever she thought of the Bridgertons and the idea that her child's grandmother was going to be Violet Bridgerton. It was a hard thing to deal with but Simon was right, Kate was 4 months along, and the moment to keep Anthony from the fact was coming to an end.

Kate was not Anthony's mother, she was not going to baby him, she would tell him about the baby and if he wanted to be a part of the child's life then they could do that but if not she felt ready to deal with it on her own. She would set ground rules about his mother and other family members and make it clear through a co-parenting relationship contract on what it meant if he went against it.

When Kate spoke with Simon, Simon was ready to villainize Violet but Kate said there was no point. The contract was all she needed. A long time ago Kate actually forgave Anthony for not knowing any better but forgive and forget were two different things.

After their day in the bedroom, Anthony had called her to talk and they met at a cafe. Anthony told her he had broken up with Sienna. Anthony thought they would get back together but Kate told him that she was not interested. She was not angry with him anymore but the reality of who he was, was just not something she could easily forget. She emphasised that it was important they remained civil for the sake of their relationships with Simon and Daphne.

Kate thought Anthony might be too fragile to hear the news but Simon informed Kate that Anthony was doing better. At first, Simon did not want to bring up Anthony at all but since Anthony is involved he told her about the progress he had made since he left the hospital.

Anthony had gone no contact with his mother which caused issues because the younger siblings (Francesca, Gregory & Hyacinth) missed him but Daphne had been reassuring them that it was important for Anthony to get better.

Anthony had been seeing a therapist regularly and set up a treatment plan that did not include medication for the time being as they figured out what he needed and what caused his issues.

Anthony had decreased the hours he worked at the company to do other things outside of investments and property development.

Kate was happy for Anthony, she knew better than anyone that bad habits are hard to break.

----

"Come along Katie," Mary said as they walked up the steep road to Anthony's place. Mary was accompanying her to give Anthony the news.

Kate had told Edwina and Mary that she was going to tell Anthony about the baby at breakfast the day before and the whole kitchen had gone silent.

Edwina was of the mind to leave it be but once Kate brought up the fact that Ben and Simon now both knew it was only a matter of time before Anthony did and that would be worse.

Kate made it clear that she was not asking them for permission, she knew that she was opening the door for the Bridgertons to be back in their lives again and Edwina was not a fan. Although she had gotten on with the younger Bridgerton siblings, Edwina felt them and their friends at school to be stuck up and Edwina had never felt comfortable, she was so excited to be graduating from high school soon. So when Edwina heard about the real reason Kate and Anthony had broken up she was far from happy.

Edwina insisted on coming with Kate for backup which Kate found cute considering Edwina was almost a foot shorter than her and, maybe Kate was biased here, but Edwina was too cute to pass for intimidating. If it wasn't for Edwina's exams, she would have come but Edwina then insisted on Mary going with her. To which Mary agreed. Kate told them she could do it on her own but Mary was already making plans to move her shift and Kate had gotten a fresh wave of emotion at the solidarity in the room. It made her wonder if her dad would have been proud.

Any way Kate and Mary made their way to Anthony's place around noon and Mary insisted Kate walk, as Kate had taken a break from her many activities due to the pregnancy.

Kate and Mary stood outside Anthony's gate for a bit before Kate was able to gain enough courage, she saw that a car was parked in the driveway so she pressed the buzzer. The intercom had a bit of static but she thought she heard someone say hello "Hi, it's Kate. I need to speak with you, Anthony. I can leave if you are busy," Kate had to give herself an out, at the end there.

There was static on the intercom and then the gate opened.

Kate took a breath and then she and Mary walked up the steep driveway and she regretted not driving again, once they made it to the top of the driveway the door to Anthony's flat opened and there stood Violet Bridgerton.

#the crazy rich viscount who loved me #kathony fanfic #anthony x kate #kathony #kanthony #kate x anthony

18 notes · View notes

feroluce · 6 months

Text

Some off the cuff 1k of Skirk & Tartaglia (skirtaru???) hcs before 4.2 proves me wildly wrong, they are very much a dynamic in process to be changed as we see more of them and as I think and consider them more, but I wanna see them interact so BAD.

Anyway. Tartaglia is an idiot who develops a crush, or at least something like a crush, on anyone who can give him a good fight. Obviously there are plenty of people who can just kick his ass- he's ranked at the bottom of the Harbingers. But they all suck, and there's no passion when they fight! They don't appreciate it the way Tartaglia does! So it's not a good fight and those assholes don't count!

So I think little Tartaglia was doomed the second he saw a very very pretty lady with a very very sharp sword and she immediately beat the shit out of him. Like she awakened something in him right then and there, unfortunately for the rest of the world haha

And then! Not only could she beat him one handed! But she took the time to teach him! And this! This was exactly what Tartaglia had wanted when he ran away from home with nothing but some food and his sword! He'd wanted an adventure! He'd wanted something new and different and wild!

And he can have that now, with Skirk and the Abyss! So his crush could have instantly dissolved right there, but it didn't, because Skirk was weird and interesting and Tartaglia adored that.

((Wheezing imagining Tartaglia trying to show off because he wants to impress his shifu, and she genuinely is impressed because Tartaglia progressed so fast, but then she pops his teenage boy ego with a pin and he deflates sjzjnskdkz))

He develops such an endless amount of respect and admiration for her. He's so happy and so proud of himself when he masters the Foul Legacy, because this was a goal laid by his shifu and hell yeah, he blew it out of the water!! And I'd like to think this was when Skirk said those words in his profile-

"You shall ever be the eye of the storm,"

"And the clashing of steel shall ever accompany you."

"The pitch-black memory of stepping into uttermost darkness,"

"Shall, at last, become the strength by which you will overturn this world."

-with Tartaglia knelt before her and her sword at his cheek, as though she were knighting him. And Tartaglia realizes then that oh. He likes it here. He likes being in the Abyss. He likes being with Skirk. He likes hunting and killing and surviving here in the Abyss with Skirk. Morepesok is and will always be home, but it was stagnant there. Too much of the same. No room for growth.

But the Abyss is boundless possibility to explore in every direction, and Skirk has never flinched away from him even once. Tartaglia can be as violent and bloodthirsty as he wants; Skirk is worse. She gives zero shits. She loves to fight and hunt and kill and make things bleed. Tartaglia is free to explore and revel in all of his worst inclinations and instincts and that is what the Abyss and Skirk become to him. Freedom.

And then he falls out of the Abyss just as suddenly as he had fallen into it. He didn't even get to say goodbye.

And it's not all bad or anything. Tartaglia isn't miserable. He's plenty capable of making his own happiness. He brings his own joy everywhere he goes (derogatory, unfortunate for everyone else ndkdjdjkd) and he genuinely likes being around other people. He would have missed a lot of things if he'd been permanently trapped.

But now there is an itch that he can't scratch. And it's driving him nuts. And he misses Skirk. She was fun to be around. He liked her.

He finds himself seeing things in everyday life and wishing he could show her. He pulls out ingredients in the kitchen for dinner and wants her to eat his special dish and show off how good he can cook. He reads through reports about the Abyss and he never finds what he's looking for (a swordswoman, an entrance, anything-), but he wants to ask her her opinions about them. He sees a really nice sword and wonders if she would like it. Little things.

Tartaglia decides he's going to find her. Even if it's just for a chance to thank her. Even if it takes years, decades. He just wants to see her again.

And then, it finally happens! They really do get to reunite! I have no idea what will happen in the archon quest of course, but like. I really like the idea that after things settle down, Skirk decides to stay for a while. She doesn't really want to live here or anything, but she's curious. She wants to see what Teyvat is like. She especially wants to see Snezhnaya, like Tartaglia used to talk about. And Tartaglia decides to go with her, he's an experienced traveler, a man of the world after all! He'll take her wherever she'd like to go.

And I'd love for them to say goodbye to The Traveler and Paimon and depart from Fontaine on a classic will-they-won't-they sort of vibe, where it's obvious that Tartaglia has Some Feelings about Skirk, but it's not clear how Skirk really feels about him yet. But it's the kind of thing where it's hopeful, and you want to root for the guy to get his love interest haha.

(The Traveler and Paimon bump into them a few months later and Paimon chides Tartaglia because Childe have you seriously not confessed yet the hell have you been doing all this time, which he responds to with hey, Skirk is a classy lady, give me time to do it right! and meanwhile The Traveler can see around Tartaglia to where Skirk is sitting at their campfire, manspreading on a fallen log, eating raw meat with blood on her face and dripping down her arms BNSKXJSMKDMD)

#genshin impact childe #genshin childe #genshin impact skirk #genshin impact tartaglia #skirtaru #I think I saw some post somewhere on here or twitter that said something rude about how people are going to ship them once Skirk releases #buddy I've been sailing this little ship single-handedly for a while now bold of you to assume I need to wait for canon dkxjdkkfkd #what the fuck do I even call this #i like skirtaru because tbh i never even call Tartaglia by his actual name he's always Taru to me haha #just had to get this all out of me before 4.2 drops and kills all my hcs instantly tomorrow nzksndkd #Skirk and Taru are one of those pairs that like. i think I could love them no matter what.#Romance? LOVE IT. Qpr? WONDERFUL. Found family? HELL YEAH.#tbh I don't have a lot of high hopes that we'll see them interact a ton in canon...#but I at least hope they get a good reunion that isn't just glossed over #they deserve it. taru has been searching for her for years. he's earned it.#I think as long as they care about each other I'll be happy ♡#I'm so excited to see what Hoyo will do with them!!#genshin impact #tartaglia #skirk

13 notes · View notes

rose-of-pollux · 6 months

Text

Questions for Fic Writers

Tagged by @knickynoo, thanks!

(Tagging @belphegor1982, @threephantomrey, and @radarsteddybear and anyone else who wants to do this!)

How many works do you have on AO3? Including the selection of ancient fics I just brought over from a dying FFN, 527.

What's your total AO3 word count? 1,836,538 words

What fandoms do you write for? Currently, my main fandoms are 13 Ghosts of Scooby-Doo, The Man from U.N.C.L.E., and Back to the Future, with some Haunted Mansion, Hogan's Heroes, Hades, Pokémon, Super Mario, and Legend of Zelda thrown in. And I've dabbled in other fandoms, as well.

What are your top 5 fics by kudos?

“Heroic Resolve” (Man from U.N.C.L.E., light slash)

“A Devil Put Aside for Me” (Super Smash Bros, gen)

“If Wishes Were Cats” (MFU, light slash)

“Desperate Times” (MFU, light slash)

"Some Things are That Simple" (Super Smash Bros, gen)

Do you respond to comments? Why or why not? I try to, but between real life and my ADHD, I don't often get to them as quickly as I'd like to. Also FFN has completely stopped sending notifications in the last several months, so I genuinely have no clue if anyone has left a comment there. :/

What's the fic you wrote with the angstiest ending? ...I haven't written it yet, but one of my future 13 Ghosts fics is going to be an angsty semi-resolved resolution that carries over to the next fic. Currently, however, the angstiest ending is probably “All Dead, All Dead” (Legend of Zelda: Breath of the Wild/Super Smash Bros)–it’s about BOTW Link realizing that the events of World of Light in Smash Ultimate makes this the second time that he failed to prevent a disaster, that he’s lost more this time than last time during the Calamity, and is now carrying even more survivor’s guilt as a result. I normally don’t write such angsty fics with no resolution, but as this is World of Light, and everyone’s restoration is a foregone conclusion if you’ve played the game, I felt it was fine as is.

What's the fic you wrote with the happiest ending? Most of my fics have happy endings, but the happiest is probably "O, Brave New World" (13 Ghosts of Scooby-Doo)--just that ending scene of everyone hugging in the rain after Daphne casts her first successful spell during her magic training... Yeah.

Do you get hate on fics? Not really, but I do get people who either complain that the fic makes no sense after admitting they jumped in the middle of a multichapter fic without any context, or I get someone who does not understand dramatic irony and wonders why Marty is acting the way he is when he's extremely stressed and not thinking things through as a result.

Do you write crossovers? What's the craziest one you've written? Love them! Craziest one is probably the MFU/Haunted Mansion crossover I did earlier this year ("The Grim Grinning Ghosts Affair"), but the BTTF/Hogan's Heroes one I'm planning is going to be right up there.

Have you ever had a fic stolen? Yes, one of my Super Mario fics was stolen along with other writers' on FFN back in 2020; thankfully a friend of mine in the fandom AND a kind stranger both alerted me to it, and I and the other victims reported the thief and got the stolen fics removed.

Have you ever had a fic translated? No, but I have had one transcribed as a Podfic by someone else–“You Can’t Judge a Book” (Hogan’s Heroes, Gen).

Have you ever co-written a fic before? Yes, once, on LiveJournal a long time ago; it was a Hogan’s Heroes fic with an otherworldly spin; I’m not entirely sure if it still exists.

What's your all-time favorite ship? Napoleon Solo/Illya Kuryakin!

What's a WIP you want to finish, but doubt you ever will? Most of all, the Monkeesfic I left hanging, because it was the literal final installment of the arc I was writing.

What are your writing strengths? Characterizations, or so I’ve been told–I can jump from fandom to fandom, and have everyone remain perfectly in-character. Also, dialogues. My writing has always been dialogue-driven.

What are your writing weaknesses? Descriptions. As improved as I am when compared to 2008 when I started posting stories online (and you can tell by looking at some of those that I brought over from FFN to AO3), I yearn for the ability to pull off the whole “Show, don’t Tell” as good as certain people I could mention (Vincent Price and Paul Frees, mainly).

Thoughts on writing dialogue in another language for a fic? It can be tricky depending on the language, but rewarding if it all works out. In Hogan’s Heroes, LeBeau switching between French and English happens nearly once per episode, so I endeavor to do that (with plenty of help from Bel, I will admit). For Illya speaking Russian or Ukrainian in MFU, I throw it into Google Translate and pray it comes out coherent. His dialogues are the most challenging by far since I’m on my own. For Flim-Flam speaking Nepali in 13 Ghosts, I have a much easier time since Nepali is similar enough to Hindi (which I am decently fluent in).

First fandom you wrote for? Pokémon, way back in 1999 (though those fics will never see the light of the internet, ever).

Favorite fic you've ever written? Going to do this for my main three fandoms–

Man from U.N.C.L.E. -- the aforementioned Haunted Mansion crossover, "The Grim Grinning Ghosts Affair" (mostly gen, but established Napollya bickering and canonical Hatbox Ghost/Beating Heart Bride going on in the background); The Ghost Host and Madame Leota draw Napoleon and Illya to the Mansion under admittedly false pretenses in the hopes that the mortal duo can help the Hatbox Ghost wrangle the mad spirit of Constance Hatchaway.

13 Ghosts of Scooby-Doo -- "Class Reunion" (gen); Vincent brings the gang to his school reunion, and as Daphne, who's been learning magic from Vincent, is determined to prove herself to the assembled witches and warlocks, there is trouble brewing as a nefarious plot involving the Forbidden Arts underway.

Back to the Future– “‘Cause I Might Not Make It Back” (Gen). Marty is pursued by a renegade scientist to be used as leverage against Doc, resulting in him getting stranded in 1932, stricken with amnesia. As 1986 Doc searches for Marty, the ripple effect fails to kick in as his 1932 counterpart finds him, and is tasked with trying to figure out how to get Marty’s memory back, as well as keep him out of the clutches of his renegade pursuer.

#quiz #random #don't mind me #my writing

6 notes · View notes

holly-fixation · 1 year

Text

Another Thing to Hide

Summary: When the public notices a reaction from Sephiroth only around Genesis of all people, Shinra has to deal with the public nightmare from the one piece of the Silver Soldier they couldn’t control. Because he couldn’t control it either. He didn’t even know it was happening. Could Sephiroth really…purr?

Inspired by this ask to @altocat

Please enjoy!

…

Oh gods. What was it now? His last appointment was three days ago. There was absolutely no way they needed new samples or tests or a new examination. What they needed was to leave him alone. He didn’t care about the ‘urgent’ emails clogging his inbox. He had way too much work to get done on his desk to worry about this.

Nothing in this god awful science department was ‘urgent’ enough for this.

He was barely in the examination room for ten seconds before the slimy scientist slithered his way in, clipboard in hand and black glasses blocking his eyes as always.

“What do you need of me now, Hojo?” He did not waste a single moment. “This better be quick.”

Good. The scientist wasn’t looking to waste any time. “I need you to purr.”

He blinked at the asinine request. “...Have you lost your mind?”

“I think it’s a simple request. It’s just purring.”

“I am not an animal, Hojo. If you wish to mess with me, at least make it believable.”

“Believable?” He echoed.

“That is what I just said, yes.”

“Snippy today, aren’t you?”

The soldier ignored the comment and questioned again, “What is this urgent request?”

The scientist moved his clipboard to his side and scanned the soldier inquisitively, slowly raising his hand to his mouth in thought before clenching it in a soft fist once realization struck. “You truly have no idea what I’m talking about.”

The taller man scoffed, crossing of his arms. “Was I not clear enough? Did you call me in here just to mock me for my eyes?”

The look in his gaze hardened, and the soldier visibly straightened to gain the slightest shred of distance when a pen was pointed at him. “I have told you a thousand times your appearance is perfect, Sephiroth. You’re clearly spending too much time around the wrong people if you even think otherwise.”

The soldier went quiet, his body tensing ever so slightly by instinct.

“Now follow me.” With a single wave of his hand, he gestured to the door he came through, and both of them walked down the hall to a desk.

Sephiroth watched silently, trying to discover what the scientist was looking for through the various seemingly disorganized folders on the multiple monitors.

The scientist adjusted a speaker before finally clicking on a video.

On the screen was an old tape of some interviewer that caught him and his red haired friend in the city on their way back to HeadQuarters. But what did this have to do with today? It was so long ago, his hair was half of its current length.

“Sephiroth! Genesis Rhapsodos! A word please!”

Though Sephiroth was clearly annoyed, his glare instantly sharpened to perhaps draw blood from the annoying reporter, Genesis lit up and pulled him along. It was the first time someone recognized the Crimson Soldier, and Genesis was ecstatic.

The interviewer asked them both a few questions, but Genesis took the lead by answering almost all of them, occasionally giving him a playful nudge. Sephiroth truly had no idea what was going on. “What does this prove?”

“Listen,” Hojo insisted.

There seemed to be a deep rumbling beneath the talking, perhaps a car that happened to be idling too close. But Hojo said something about…

…purring?

The scientist closed the video and opened the next one. And the next. And the next. And each one was cursed with the same rumbling, soft and deep but ever present. Each video showed years of broadcasted appearances with him and Genesis together, sometimes with Angeal as well but never just him and Angeal. The final video was posted only a few days before, but that false white noise still persisted.

That’s impossible. His ‘inhuman’ strength and speed were trained into him for years. The only abnormal things about him were his hair and his eyes, but… he never produced such animalistic sounds.

Worst of all, he had no idea he made them in the first place.

“Public Relations is currently working on a fluff piece to deter any assumptions about your character.” The black glasses reflected the light back at him. “But you need to get a hold of this. And if you can’t, I’ll take control.”

Sephiroth stared at the open monitor, at the frozen image of him and his closest friend. Instead of the smiles he saw and the warm memory they came with, his heart sunk. Had this truly been happening for so long? And neither Angeal nor Genesis mentioned it or joked about it once? How did this stay silent? How did he not know it?

He was terrified. His own body betrayed feelings he would never admit to himself or the public. He didn’t know it was happening, didn’t feel a single vibration in his throat. Or at least he assumed it was his throat. He couldn’t control this. He couldn’t control this. And after so much silent deliberation, his traitorous mouth opened to a soft whisper, “...what would you do…?”

“Well,” Hojo was far too prepared for that question, “If the vocalizations are coming from around your chest, we can update your uniform and pretend the added armor is purely aesthetic. Possibly a chestplate. But if it’s coming from your throat, which is much more likely-”

His head slowly fell, his bangs blocking his eyes as he stared at the floor.

“I believe a simple collar should be enough to dampen the noise. Placement and thickness are critical, of course. And then there’s the issue of design, matching the uniform, making sure it represents the company in a positive light, dealing with the marketing department, manipulating public opinion- ”

“Do it…” His voice was broken, his shoulders low and his body dropping in defeat. Hojo needed confirmation before moving forward, and Sephiroth didn’t give him the chance to ask. “Make the collar… do it…”

Well, Hojo absolutely wasn’t passing up this golden opportunity with his son being so compliant.

* * *

Sephiroth obeyed every order, sitting like a statue for measurements of his torso and neck, his coat and armor somewhere on the floor to allow perfect access. He hated it. He hated it all. He understood exactly what a collar would symbolize. He prayed that whatever rattled inside him only forced him into more armor, not kept him inches away from a leash.

But he still couldn’t purr on command, which meant not only could they not find the epicenter of this uncontrollable call, but they couldn’t test their products without stimuli. They needed something that worked, but no pill or injection triggered the reaction. Only one outside force guaranteed the sounds.

They needed Genesis.

Sephiroth wanted to hide in a hole, but that didn’t stop him from sending his friend a message to come to the lab. He wanted this over with. It certainly didn’t stop Hojo from inviting the Crimson Soldier as little more than a resource required for his tests.

With such a silent cry for help unseen to Sephiroth, his friend rushed into the room in minutes.

The look on Genesis’ face only pulled the ache in his friend’s chest higher.

The sight before him was so rotten the redhead struggled not to attack the scientist nearby.

Sephiroth couldn’t even meet his gaze, sheer embarrassment clogging his heart. But at a soft touch on his arm, his inhuman eyes lifted to the other mako blues.

“What did they do to you? Are you alright, Sephiroth?” Genuine care bled through his words, infecting the tense breath of his friend like a virus, yet with a calm he couldn’t describe.

“I’m alright…” He answered slowly, weakly.

“What happened?”

Gods, why did he have to look at him like that? Like he could tell him anything? Like this was a safe place? Why couldn’t he keep his walls up around him? Why did that intense gaze make him feel warm and safe? Why did he-

Barely a few seconds. It was barely a few seconds since Genesis entered the room, and Sephiroth’s tainted purring began.

Genesis’ gaze even softened at the sound. He knew. He knew all along, but he said nothing because he knew what it meant… didn’t he?

Their moment of peace shattered when a cold stethoscope slid along his open chest.

The Crimson Soldier’s eyes burned as he stared daggers at the scientist currently moving the instrument up and down the bare skin, but Sephiroth stopped him, almost grabbing him.

“It’s just a test,” He explained quickly, deliberately avoiding why Genesis was necessary. “They just need data. I’ll be back on the SOLDIER floor soon.”

“Data for what, Sephiroth?” The concerned care twisted to a caring sternness, and with everything happening, the Silver Soldier just looked away like a disobedient child. “Data for what?”

Still, the rumble didn't stop. Sephiroth never got the chance to speak before Hojo retreated and scribbled on a clipboard. He found the source. Good.

“Just some control data. Nothing more,” Sephiroth lied. “It'll take a few hours. I'll talk to you soon…”

Hojo interrupted them, incessantly tapping his pen on the paper. “Yes. Get out of my lab. We have work to do. Your presence is no longer needed.”

Genesis almost growled, but the puppy-dog look in Sephiroth’s eyes convinced him to stand down. “See you soon, okay?”

“See you soon…” He repeated softly, and just like that, he was alone again, free to every touch and prod of the technicians around him.

However, this visit required no samples, no needles, no extensive physical examination. The worker bees of the lab simply spent their time making and testing the fabric that would stifle his neck to protect him from yet another thing in his life he could not control.

When Sephiroth eventually returned to his office on the SOLDIER floor, with a leather collar ordained with the SOLDIER logo, the only thing that stopped Genesis from burning every lab in this building to the ground was Sephiroth himself.

He was so, so sad, his cat-like eyes thin and ashamed, dark and sunken. Painful.

Genesis dropped the rage and immediately trapped his friend in a hug. He knew he’d never admit to needing one, but he knew this helped him, ever so slightly.

His arms were warm and safe.

Sephiroth tried to return the embrace, his hands shaking ever so slightly. He wanted Genesis to know he appreciated the gesture, but the single quirk that let him reveal his silent truth was now muffled by the band around his throat.

Thanks for reading!

Author’s Note: If you think this is bad, you should read ‘Another Part to Hurt’. Thank you again to @altocat for letting me steal her ideas!

#sephiroth purrs but it's SAD #this is ANGSTY #sephiroth #hojo #ff7 hojo #genesis rhapsodos #ff7 genesis #sephiroth ff7 #sephgen #ffvii sephiroth #catboi but sad

28 notes · View notes

tishinada · 1 year

Text

Admittedly, I’m only about halfway through the post-Endwalker patches, but I’ve been thinking about some of the relevant lore we have already.

(SPOILERS FOR POST-ENDWALKER)

I’m collecting a lot of this about the major Voidsent and the 13th here so I can find it in one place, and it’s a bit long because we know more than I realized until I began putting it all down:

Obviously, the lore from the reaper’s quests (I really wish we knew more about Drusilla’s grandfather and his encounter with Emet-Selch and who the voidsent was that possessed her grandfather.) The higher level red mage quests also involved a major voidsent. (Are those two actually dead or just banished back to the 13th? Zero’s not a great one to judge by because she seems to be unique in some way, but she survived Zenos’s death and returned to the void, so it seems as if the main villain in the reaper quests probably did too? Are either of them one of Golbez’s lieutenants? I’m guessing not since the names don’t match...) (apologies if any of that is answered in or past the first trial in post-Endwalker, I’ve only read quick summaries, lol.)

The white mage 60 - 70 quests involve voidsent wanting to possess a young padjal who had not been trained from birth and lacked control.

I haven’t gotten all that far with the thaumaturge quests, but they do seem to be leading that way.

We’ve also had encounters here and there with voidsent and people have talked a bit about them, but most of the others are fairly minor (though the magical dps quests in Shadowbringers seem related.) We also know there are two “survivors” of the 13th, though you only find out the details and who the second one is if you’ve done the allied job quests for Shadowbringers.

While there are some hints about voidsent connected to Sil’dah (or that era at least) and other past civilizations, Allagan seems to be the significant one for voidsent lore. We know that the conflict on Mericidia in which Vrtra’s sister was lost involved Allagan using voidsent against the dragons, resulting in Vrtra’s sister being lost to the void. And I realized there was a major voidsent from post-ARR, the Cloud of Darkness, connected to Allagan. So I went to talk to Rammbroes.

NOAH Report: Within the void, chaos reigns supreme. Strength is the sole measure of order amongst the voidsent; he who rules is he who claws his way upwards, and tramples all beneath. NOAH Report: Scholars who study the voidsent have long striven to categorize the fiends by brawn rather than species. The result is popularly known as the twelve-tiered voidsent hierarchy. NOAH Report: The voidsent known as the Cloud of Darkness is doubtless in the highest tier of this hierarchy─hence why Emperor Xande entered into a dark covenant with it. NOAH Report: In both strength and size, the Cloud is unmatched. A voidgate of monumental proportions would be necessary for it to enter our realm. Opening such a rift would, in turn, require a power as massive. Enter, then, the Crystal Tower, and the energy it could produce. NOAH Report: Were the Cloud of Darkness to break loose, it would devour all aether and extinguish all light. The world would become as the void. NOAH Report: Indeed, all would have been lost were it not for the actions of valiant adventurers, and the sacrifice of two Allagan clones, who annulled Xande's dark covenant.”

“NOAH Report: The World of Darkness is an otherworld thought to lie adjacent to our physical realm─in other words, what we often call “the void.” NOAH Report: The fellowship of NOAH came upon the World of Darkness several times, but only once did it venture inside. The future of the very realm was in jeopardy, and thus was a band of adventurers dispatched to rescue three comrades imprisoned amongst the shadows. NOAH Report: How are such things possible, when wise men hold that the world is the world, the void is the void, and never the twain shall meet? It would seem abnormal events can weaken the veil between worlds, and tear them asunder. When such rifts appear, men can walk between realms. NOAH Report: The mages of Allag could create rifts at will. Dubbing them “voidgates,” they used them not only to enter the void, but also to harness the dark powers therein─the voidsent. NOAH Report: The voidsent, however, make ill allies. The fiends have a depraved appetite, and seek this world merely to sup upon the aether it contains. Were they ever to enter our realm in force, destruction beyond imagining would follow. NOAH Report: Therefore, any and all dealings with the voidsent are now seen as forbidden. Even the Thaumaturges' Guild, devoted to studying the void, conduct research on a limited scale under strictly enforced regulations.”

And of course this passage, including Amon/Fandaniel (I’m wondering if his resurrected “Xande” was either an Ascian or a voidsent now. Either could possess a dead body and would want to trigger a calamity, etc.)

“NOAH Report: No account of Allagan history may be considered complete without mention of its founding father and first emperor, Xande. NOAH Report: Ancient records that have survived paint the man as a great ruler. By his hand the Allagan Empire was born, and for more than a thousand years it flourished. NOAH Report: However, the empire's star eventually began to wane. The selfsame prosperity that made the Allagans great gave rise to decadence. The citizens grew content in their complacency, and technological advance ground to a halt. In a matter of generations, the civilization became a pale shadow of its former self. NOAH Report: Lamenting the pitiful state of affairs, the technologist Amon sought to restore Allag to greatness via an unprecedented method: the resurrection of Emperor Xande. NOAH Report: Amon exhumed Xande's body from his tomb, situated in what is now known as Mor Dhona, and proceeded to conduct numerous experiments. With equal parts perseverance and ingenuity, he succeeded in bringing the emperor back to life. NOAH Report: So began Emperor Xande's second reign, a thousand years removed from his first. Through masterful leadership, he swiftly brought his ailing empire back to the path of greatness. Even the southern land of Meracydia, which had long defied Allag, was finally brought to heel. NOAH Report: Xande was a great emperor, it cannot be denied, and ancient records rightly speak of him in reverent tones. However, those selfsame records are silent on the subject of the man's inner workings. NOAH Report: It has recently been revealed that, ever since returning from the grave, Emperor Xande was constantly tormented by the memories of his death. NOAH Report: Driven by reasoning that no mind but his own may comprehend, he sought to return all to nothingness. Whatever may have compelled it, Xande made his choice, and its consequences have been passed down through the annals of history. NOAH Report: A lust for power which grew into a desire for nihility─such was the dark seed that brought about the Fourth Umbral Calamity. By Xande's hand the Allagan Empire was built, and by his own hand it was destroyed.”

And this one, which had some info I don’t remember at all, again invoking Amon/Fandaniel:

“NOAH Report: The Crystal Tower is comprised of a multitude of spires. Rising high above them all is Syrcus Tower, the heart of the majestic structure. NOAH Report: It must be noted that the name Crystal Tower originated as a sobriquet. Ordinary Allagans coined the term, which over time came to refer to the collective structure. NOAH Report: Although the tower is referenced in various ancient scriptures, up until the end of the Sixth Astral Era, the scholarly community largely doubted its existence. Aside from Professor Erik, it had scant few proponents. NOAH Report: How is it possible that such a colossal structure could be kept hidden from mankind, and for so long? The answer was to be found amidst the ruins of the Fourth Umbral Calamity, which took the form of a great earthquake. NOAH Report: During the final years of the Allagan Empire, the lesser moon Dalamud harvested the sun's energy, which it then transferred to Syrcus Tower below. However, that energy proved too much for the tower to contain. It escaped into the land, causing the earth to collapse into itself. NOAH Report: In mere moments, the Allagan Empire was laid to waste. Yet even as the Crystal Tower was sinking, Emperor Xande's most trusted aide, the technologist Amon, invoked powerful magicks and halted the flow of time within the structure. The tower and its denizens fell into a deep slumber. NOAH Report: Three eras later, when Dalamud began its descent, the Crystal Tower stirred to wakefulness. Shortly thereafter, the cataclysmic arrival of the Seventh Umbral Era saw the tower returned to the surface. NOAH Report: The fellowship of NOAH ventured into the Crystal Tower, its first visitors in millennia. Awaiting them at the apex was Emperor Xande, the legendary founder of the Allagan Empire, who had awakened alongside his minions.”

This one names another Voidsent:

“NOAH Report: A stalwart band of adventurers led by the indomitable <WoL’s name> was tasked with conquering the perils of the Labyrinth of the Ancients. NOAH Report: The base of the Crystal Tower is nestled within this deadly maze, the entire structure designed to confound entrance to the spire proper. NOAH Report: As we had feared, the halls of the labyrinth were further protected by fantastical foes. Our adventurers faced nightmarish opponents, the king behemoth and the voidsent Thanatos among them. NOAH Report: Through our research we have learned that the ancients were most skilled at the binding of void-born entities─occult servants that were compelled to serve alongside augmented beasts and chimerical monstrosities. NOAH Report: After battling such fiends, none could argue that the approach to the tower was a simple one. And though the labyrinth's hazards have been overcome, one cannot help but imagine what devilish enemies await within those unbreached crystalline walls...”

All of this is mostly for reference, so I won’t have to try to remember where I read any of this and then have to click through each bit one by one lol. I’ll edit or reblog to add other bits as I remember or find them.

#ffxiv #post-endwalker spoilers #ffxiv lore #endwalker spoilers #ffxiv reference #the void #voidsent #major voidsent #reference

10 notes · View notes