#regina ask blog | Explore Tumblr Posts and Blogs

Visit Blog

Explore Tumblr blogs with no restrictions, modern design and the best experience.

Fun Fact

In 2020, Tumblr had 29.4 million users in the US.

townbully-hatzroy · 15 days

Note

Oh right! Regina really wanted me to do this when I offered!

*pours water on Roy and runs away*

(@helpmydaughterplease )

He jumped and then shaked his own head to the sides, his body a little aswell afterwards.

" HEY!! YOU FUCKING PUNK! "

#OOC: I don't think Regina is with us rn.....#spooky month #spooky month roy #spooky month hatzgang #spooky month roleplay #spooky month rp #ask blog

9 notes · View notes

dailycircuscharacters · 3 months

Text

DAY 23!

Regina Berry from Ace Attorney Turnout Bigtop

#dailycircus #regina berry #ace attorney #regina ace attorney #ace attorney turnout bigtop #rpg #rpg game #game #ask blog

4 notes · View notes

askthejourneysgang · 2 years

Note

Chloe, write a letter to Regina (10 dollars)

Do you miss her?

Chloe: Letters, eh? Well as long as you're going to continue being this generous, I can hardly refuse... plus, I write to Regina all the time!

"Dear Regina, how are you and Mirche today? I was encouraged to write to you today.

So you're getting more into pokémon battles, huh? I'm not very into that, but I'll always support you no matter what! I myself am still on the fence about my future, but maybe we can figure it out together?

Well, it's up to you if you would want that...

With love, your friend Chloe."

Chloe: There (hugs the letter)

I miss Regina dearly, it's true. It's not often I get to be the 'senpai' in a relationship, you know? Aside from Goh, but it's not like he typically listens to what I say.

18 notes · View notes

hellsitegenetics · 4 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

rougecreator1 · 2 months

Text

Masterlist... //

Personal Introduction

Fandoms

Rules for Requests (must read before making requests)

Wip Masterlist

Hi!! This is my master-list blog, including any and all info you'll need before making a request. Tells you who I am, who I write for, submission rules, and works I've already done! I'll try to keep this as updated as possible; if I somehow miss something don't hesitate to tell me! || Requests open!

Meangirls (2024)

Regina George

Beauty is Pain -Regina's high heels bother her, reader notices and makes Regina switch shoes. (established relationship.)

Desire for you Affinity -reader is a mystery student on y/sports team, Regina sends Gretchen to gather information. Eventually you're asked to join the plastics. (mutual crushes.)

Under the Protection of Regina George -reader is bullied for being nonbinary, Regina comes to their rescue and comforts reader at the end. (established relationship.)

Pretty Girl Part 1 -reader is a new student at NorthShore who keeps running into Regina, Regina defends reader and has her join the plastics. (starts as friends.)

Part 2 -Regina takes Reader to her house with the rest of the plastics. She gives Reader a makeover to be party-ready. (friends.)

Second Chances -College AU. Regina asks reader out to a cafe date. Regina apologies to reader. They run into Gretchen and Karen after leaving the cafe. (first date.)

Shattered Glass -Reader watched Regina get ready for school, comforting her when she had to end up wearing jogging pants because nothing else fit. (established relationship.)

Bruising Kisses -Gretchen tells Regina about a rumour where reader is close to another girl, Regina publicly claims reader in the hallway. When they get home, Regina's insecurities show and reader assures Regina they only have eyes for her. Lots of kisses. (established relationship.)

You're Beautiful -Reader struggles with body dysphoria, Regina assures the reader they're beautiful which leads to reader showing Regina they're thankful for her... the next day, Regina shows the school who owns her. (established relationship.)

Truth or Dare -Regina gets reader ready for a house party, they get a little distracted by each other. At the house party, reader ends up having more fun than she thought she would. (established relationship.)

Don't Forget

-reader's been wanting for Regina's attention, so she takes matters into her own hands to get it. Regina isn't too happy and reminds her who she belongs to.

(established relationship.)

Poly!Plastics

NorthShore Nowheres Part 1 -reader is the leader of NorthShore's infamous biker gang; NorthShore Nowheres. Plastics decide they're interested in reader, but so has Cady... (aware of, not yet dating.)

Part 2

-Reader goes to the movies on her date with the plastics, Regina's being extra flirty with reader. Outside, reader gets into a fight with the rival biker gang. Employee breaks up the fight and the girls take reader to Regina's for a patch up.

(first date.)

Slow Boil -reader doesn't get enough sleep, the next day people get on her nerves and it pushes her to a boiling point where she snaps at Cady for insulting her girls (established relationship.)

Insecurities -Reader feels left out when Cady joins the group: the girls don't notice right away. When date night rolls around and all they seem to talk about is Cady, Reader can't take it. (established relationship.)

Whats One More? -Reader keeps helping out everyone to the point where it begins to effect her sleep schedule. Ms. Norbury notices and brings it to the attention of the plastics, who comfort Reader and get Reader to sleep. (established relationship.)

Heatwave -It's HOT. Regina is unaffected and makes them go outside for lunch, Reader faints from the heat and her girls (along with Ms. Norbury) take care of her. (established relationship.)

I See the Light -Regina's auditioned for the school play; Tangled as the role of Rapunzel. She gets it, of course. Only problem is the boys auditioning for Flynn Rider don't have a spark with her. It's so bad to the point where the play director considers dropping the play, reader steps in and saves the day. (established relationship.)

Totally Fine -reader's part of the cheer team, her girls go and support her only to watch reader fall from the pyramid much to their concern. Reader insists she's fine, turns out she's very much not and her girlfriends know it. They take reader to the hospital, with some scolding from Regina. (established relationship.)

Burning but its Ice Cold

-reader and the girls go ice skating at Regina's cottage, reader gets distracted by the northern lights and falls through a thin spot of ice. The girls work together to comfort and warm up reader.

(established relationship.)

Janis Imi'ike

Pretty Little Secret

Part 1 -Reader calls Janis in tears as she talks about her experiences at her school. Janis suggests she switches to NorthShore. The following Monday, Reader starts at NotthShore and things go from there. (established relationship.)

Part 2 -reader runs into Regina George, Regina makes fun of Janis & reader. Janis tries picking a fight with Regina but reader & Damien pull her away before things can escalate. (established relationship.)

Gretchen Wieners

Miss Smooth Talker -first date, where Gretchen's worried that reader will be like Jason. But reader surprises her and they have a great time at a fair. Mostly fluff. (friends to lovers.)

Let Me Spoil You, Baby

-reader hasn't been giving Gretchen much attention, Gretchen gets upset when she sees reader talking with another girl. She doesn't let it slide. Reader does her best to make it up to Gretchen.

(relationship repair.)

Legend of Korra

Avatar Korra

Gifted with Impurity Part 1 -reader is the daughter of Amon. Your father only ever allowed you to use blood bending, after your father's defeat you seek the help of Avatar Korra to get back what you have lost. (enemies to lovers.) Part 2 -You and Korra are attacked by Equalist chi blockers after your date. She defends you, you save her with blood bending. (established relationship.)

Dining with the Rich -Korra finds reader hanging out by the park river and offers to take her on a nice date, it's been a while since they had the chance to. (established relationship.)

Arcane

Caitlyn Kiramman

Your Idiot -reader gets back from a heist, Caitlyn isn't pleased. The heist would later come back to interrupt their date. (established relationship.)

Jinx

Accidental Truth -reader and Jinx head to their usual hangout, falling for each other along the way. Jinx accidentally confesses her feelings and reader returns them. (friends to lovers.)

One thing I should've told You -reader and Jinx escape enforcers with the help of the magic reader has tried so hard to keep hidden. Jinx is mad at reader for keeping it hidden. (friends to lovers.)

Hazbin Hotel

Carmilla x Velvette x Reader

To the Hip -reader invites herself to an Overlord meeting, cuddling with Velvette and accidentally disturbing the meeting. (established relationship.)

Devil in a Calm Sea -reader is in an Overlord meeting, keeping Velvette and Carmilla in check. Valentino keeps flirting with reader and reader loses it. (established relationship.)

Heathers

Heather Chandler

Tipsy Hook Ups -Reader gets spotted by Heather M and the two become fast friends, resulting in reader joining the Heathers & Veronica. Heather M invites Reader to a house party where drunk!Heather Chandler hooks up with drunk!Reader. (undefined?)

Totally Killer

Pam Miller

Drunk Girls Kiss -Reader is best friends with the Mollys, specifically Pam Miller. What happens when they drink a little too much at a house party? (friends to more?)

Wednesday

Wednesday Addams

Soft Thorns -Reader's on the more clumsy side, Wednesday's there to support Reader when they need it. Wednesday's "soft" side surprises everyone. (siblings.)

Magic Stones -reader is Norse Pagan. Wednesday and reader are out in town, as Enid had dragged them out for coffee when some town teens bully reader because reader had brought along a rune set and was doing a reading for Wednesday. Wednesday shows the teens not to mess with an Addams and they head back to Nevermore where Wednesday comforts reader. (siblings.)

Renée Rapp

Swirling Thoughts -Renée's meeting reader's parents for the first time, safe to say she's nervous as shit. Reader helps her through it. (established relationship.)

197 notes · View notes

ramp-it-up · 1 year

Text

Doctor and Mr. Cavill

Pairing: Henry Cavill x Veterinarian!Reader

Word Count: 5.9K 😓.

Warnings: 18+ Only, Minors DNI. RPF. SMUT, Explicit description of graphic sex. Read at your own risk. Dog in distress. Angst, pining, flirting, nerd activities, Marvel vs. DC, brat behavior, dirty talk, size kink, oral sex, raw p in v (wrap before you tap) pulling out, cum play. Not Beta’d. All errors my own.

A/N: This is in response to an ask from @notmyfault404 about Kal’s favorite Veterinarian, nerd activities and Henry. This story sucked me in. Let me know if you liked it!

I no longer have a taglist. Please follow @rampitupandread and turn on notifications to learn when I post! 😘

I Do NOT Consent to my work being reposted, translated or presented on any other blog or site other than by myself.

The film production came to town at the end of summer, buying the now defunct airport for a production studio and moving scores of staff into town. The uptick in your business was the first indication that your life was going to change.

The production meant two years of publicity and economic prosperity for your town. It was exciting. And the fact that Henry Cavill was the lead in the production was no small news item.

Sightings at the grocery store, on the running trails, at GNC were all everyone could talk about, but you didn’t have time for all that. You had a business to run.

You got busier, with production increasing the population of the town by over 200 people. Including the talent, Everyone was buzzing with the fact that Henry rented a house out on State Route 60, not too far from your own.

You weren’t that pressed. Sure, he was fine as hell, but he was probably a jackass and you would probably never run into him.

You were so wrong.

One blustery late fall day, an American Akita was brought into your office by a bystander who found him caught in a bush along a greenway, dirty and covered with brambles.

He was muddy, overexposed and shaky. He was agitated and growling at everyone, until you came near. You gave him a firm command.

“Sit!”

He obeyed immediately and whined, still stressed, but calmer now. You approached him and kneeled, holding out your hand and taking his paw when he offered. You smiled, and he panted in return.

“It’s okay, buddy. Let me help you.”

20 minutes later, you had him on the table in one of your examination rooms

“Now keep still. I know it’s uncomfortable right now, but I’ve got to get you unmatted and then I’ll get you some nice soothing salve for those scratches.”

The dog whined, but stopped fidgeting and stood still, as if he understood what you’d said.

“Good boy!”

The huge animal panted at you and looked as if he smiled, but then whined again as you started detangling and brushing again.

Regina, your nurse, came in and microchipped him, and then turned to you with her mouth wide open when she saw what came back.

“You’ll never believe who this dog’s owner is…”

After you found out about Kal’s parentage, you fed and watered him, cleaned and groomed him, attended to his coat and his scratches and were playing with him when Henry arrived at your office.

“Did you run away Kal? Is he a good dad?”

You leaned over to him conspiratorially.

“I bet he’s not.”

You tutted as you worked on the last bit of matting, soothing hums falling from your lips as you applied the ointment to the lesions on his skin.

“I would take you to my house in a minute, he doesn't deserve you, does he?”

You were concentrating on medicating his leg when you heard a response.

“You’re quite right.”

You looked up at Kal when you heard a deep British voice rumble through you. You slowly turned around and were met with the most beautiful imperfect blue eyes you’d ever seen.

“I don’t deserve him.”

You drew yourself up to your full height, which didn’t stop Henry Cavill from towering over you. Damn.

He seemed huge, tall and burly, hair hidden under a baseball cap, but escaping out of the back into thick curls at his nape. His face was flushed, and his eyes held a look of worry and embarrassment, but held your gaze.

You felt like you were in one of those old romcoms, where the room was spinning around you. You had the urge to dive into his eyes.

“Mr. Cavill? I’m Dr. Y/LN.”

Henry’s smile widened and he extended his hand. You looked at it as if it were a fish. You were flustered. He was even more beautiful in person.

You reached for his hand and then stopped, awkwardly.

“Gloves,” came your reply as you held up your hands.

Henry dropped his own hand, as awkwardly as you. Your stomach tumbled.

“I’m Henry. Cavill.”

“Yes,” was all you could say. You knew who he was.

“Mr. Cavill. Kal is fine, but he was exposed to the elements for quite a while.”

Henry had a stricken look on his face.

“Believe me, Dr. Y/LN. I have been distressed with worry for about 14 hours now. Kal and I went running yesterday evening and he saw and chased a squirrel. He wouldn’t respond and I couldn’t find him. I feared the worst all night…”

Henry paused, trying to compose himself. You saw his emotion and you heard his voice crack and you softened, all over. You should really stop staring.

“That is unfortunate, but luckily someone found him and brought him in…”

You found yourself suddenly at a loss for words.

“Yes.”

Henry smiled, a genuine, shy smile.

“And it seems you are taking expert care of him.”

Kal whined and you tore your eyes away from his owner.

“Hey buddy. Yeah. I’m almost done, just gotta get this paw...”

You smiled at Kal and turned to Kal to continue your work, smiling at Henry over your shoulder.

Henry watched you with his dog and his heart melted. You were gentle, kind, and caring. And that voice. Your sultry tones were soothing, not just to Kal. You were calming Henry’s nerves.

Henry didn’t know what he was expecting, but it wasn’t you.

Somehow he was expecting a veterinarian to be someone not quite so lovely. His heart was already racing, but when he saw you he swore that it skipped a beat.

Henry was transfixed with you, his eyes searching for a glimpse of your body beneath your white coat. He ascertained generous curves and found himself quite pleased.

As you turned around and caught him staring, he remembered Kal.

“Mr. Cavill!”

Henry startled and turned red as a bashful smile graced his handsome face.

“Y-yes?”

He seemed flustered and awkward, but he was also a highly trained actor. You resisted any benevolent thoughts as you handed him a couple of tubes of salve and reminded him of the routines to make sure that Kal healed properly.

“Thank you Dr. Y/LN. Thank you for taking care of Kal …”

“No need for thanks. It’s what we do here.”

“Well…Excellent!”

Henry graced you with that beautiful smile and you wanted to melt, but you stayed strong.

You two stared at one another until Kal whined. You released him from the grooming lead and Henry prompted him to jump down from the table.

You watched, your heart warming to the sight of Henry practically rolling on the floor with his pup. You could watch the scene forever, but you had work to do.

“Mr. Cavill.”

“Yes.”

Those bewitching blues looked up at you. You held in a gasp as Henry sat on one knee at your feet with Kal. It was quite unnerving for some reason. You cleared your throat.

“I have another patient I need to see in this room.”

Henry was deep in thought after you kicked him out of your office. He couldn’t get you out of his head. He walked slowly to his car with Kal, almost turning around and back into your office when his phone buzzed. It was his agent.

Thoughts of you were pushed aside as he answered the phone.

Two weeks later, you entered your exam room looking down at the patient chart with no other warning than a smirking Regina who handed the clipboard to you.

You were greeted by a big handsome brute.

And his dog.

“Kal!”

You were assaulted by licks and jumps when you got near him.

“Down, boy, sorry, Doc. Kal! That’s no way to behave.”

Henry took Kal’s collar in hand to get him off of you, but he was ignored while you laughed and hugged the dog. Soon, he obeyed Henry and sat down on the table, smiling at you and thumping his huge tail.

Speaking of huge, you noticed Henry’s hands. They were large, with thick fingers and pronounced veins which extended down his thick forearms. His muscles were flexing from the effort to restrain Kal, but Henry’s face was serene.

And staring directly at you.

You cleared your throat.

“What are we here for this time?”

Your saucy raised eyebrow did things to Henry, he decided. He’d been thinking about you ever since that first time and he was intrigued by you.

“Our visit today is two-fold. Kal needs his yearly shots. We’re in the states for the next few months filming and you took such good care of him last time… well, I’d like you to be his veterinarian while we’re here.”

You grinned at Henry, and he paused, blinking at you as if in shock. He wanted to make you smile forever. You cocked your head at him.

“And two?”

“What?”

Henry was outright flustered. You chuckled.

“What’s the second reason that you’re here?”

“Yes! Right! I want to thank you for taking care of Kal. How about I take you to lunch as a way to express my gratitude?”

You frowned and Henry’s stomach dropped as you appeared to have eaten something sour. He knew he shouldn’t have tried it.

“I’m trying to think of a reason not to…”

You looked up at him with those big doe eyes and Henry turned to mush. Then he recovered and smiled, giving his best rake performance.

“Well, if you’re thinking anything about Dr/Patient ethics, I’m not your patient. Kal is.”

Henry hadn’t had to pursue like this in quite a while. It was refreshing.

You finally smiled as you prepared to counter his argument.

“But in a veterinary practice, an animal’s owner is a client.”

“Dr. Y/LN, it’s just lunch. Nothing more.”

“Really?”

“Really. It’s just a thank you. No funny business.”

Henry held his hands up so as to indicate he wouldn’t touch you. Why were you disappointed?

You avoided Henry’s eyes as you opened the door and called for Regina to set up the shots. Henry took the chance to subtly check you out again, making sure to have his eyes elsewhere when you turned back around.

“When did you want to go out to lunch, Mr. Cavill?”

Henry shook his head and chuckled.

“Henry. Call me Henry. Dr. Y/LN.”

He waited for you to offer your first name to him, although he could read it on the diploma on the wall. When you just smiled, he just shook his head again.

“I was thinking today.”

“I– I – ummmmm…”

“Your nurse, Regina is it? Regina told me you hadn’t eaten yet.”

Henry raised his eyebrow and looked at his watch. You couldn't help but notice the veins in his arm.

“It is 1:28 pm and you haven’t had anything to eat today except coffee.” He looked at you as if you were in trouble, but that would have been too familiar. Henry was quite displeased that you weren’t caring for yourself, but he didn’t dare say it. He hardly knew you. This wild urge to take care of you was unexpected.

“Regina cleared your afternoon.”

“Did she now?”

You went to the door and called for her. Regina appeared as if she were close by, with the shots prepared on a tray.

“Here are Kal’s shots, Doc. And I’ve rescheduled your appointments for your lunch date.”

You scowled at her and she smiled brightly as she pushed you back into the room by the tray. You would take care of her later.

You turned around and went to wash your hands and put on your gloves. You sighed and decided to go with the flow.

“How about Dave and Buster’s?”

Henry looked nonplussed.

“Do Buster and David serve good healthful food?”

“No,” you grinned.

An hour and a half later, after dropping Kal at Henry’s place and a lunch of ribs, wings, and nachos, you and Henry were having the time of your life playing giant electronic Connect Four. When you beat him the third time, he pulled you away and started browsing the games.

The darkness of the arcade, and the fact that it was 3 pm on a Tuesday, made it easy for Henry to not be recognized. His ball cap was quite the disguise.

“Rampage!” Henry yelled like a kid. “No wayyyy! I used to love this. One of Midway’s best games.”

You gaped at him.

“Oh Come on. I’m a massive nerd. I love stuff like this. We have to play!”

You just laughed.

“A man after my own heart! I’ll play you, but we have to scope out the other games. You have to have a plan for your game play.”

Henry stopped when you said he was after your heart. He knew it was a figure of speech, but he decided it was not an untruth. He cleared his throat.

“Right. Seems you’re a bit of a nerd yourself, Dr. Y/LN.”

You grinned.

“You should see my comic book collection.”

Henry’s heart surged, that was so fucking sexy. You out of your doctor’s coat was also damned attractive, and he was about to say so when he saw his face on an arcade game.

You two stood in front of Injustice, a game that had many of the DC Superheroes and Villains illustrated on it. You and Henry stared at each other.

“I dare you.”

Henry never backed down from a dare.

“Challenge accepted, Doctor.”

It was on.

—

It was basically dinner time when Henry dropped you back at the office, but you weren’t mad. You shivered at the cold and pulled your jacket around yourself. Henry wanted to pull you into his arms for warmth, but this wasn’t that kind of date.

You smiled that smile at him.

“That was a great lunch, but you lied.”

Henry looked so cute with the frown on his face.

“That was funny business. I haven't laughed like that in a long time. I had a ball.”

Henry was relieved and followed you as you turned and went to your car.

“I’m very glad. You ate something and had some fun. Splendid.”

You were trapped between Henry and your car as he beamed down at you. This feeling could not be denied, you realized with dismay. But you were going to try with all your might. Henry was only temporary. He was probably just searching for comfort near set. You needed to guard your heart.

“Well, have a good evening, Henry.”

You reached for your door handle. Henry backed up to let you open it.

You got into the driver’s seat.

“Perhaps we can do this again sometime, Doctor.”

You just smiled at him and said, “Good night, Mr. Cavill.”

Then you closed your door, started the car, and pulling away, Henry realized that he didn’t get your number as he’d planned.

“Call me Henry!”

He shouted at your taillights.

This was getting inconvenient.

A week after your lunch, you’d taken to having nightly dreams of Henry, and it just wouldn’t do. You woke up in the middle of the night with your clit pounding and you’d worn out the batteries of your wand, knowing it would be a poor substitute for the man from Jersey.

You had to get Henry Cavill out of your head. Work. That was the answer.

You walked past Regina’s desk around 11:30 and didn’t realize she wore that smirk until you turned the doorknob to the examination room.

“Shit!”

You cursed under your breath as you opened the door to Kal’s bark.

Henry stopped mid-pace when you did so. His eyes looked a little wild, just like the first time you’d met, but there was a difference now.

The difference was that Henry was distracted by need, not worry. He’d thought about you every waking moment, and woke up with a stiff reminder of his dreams every morning. He needed more of you, or to be in detox.

“Mr. Cavill.”

Henry's jaw clenched at your continued insistence at the formality. Your core clenched in turn. You were in danger. You moved to pet Kal, seeking him to be your protector.

“Dr. Y/LN.”

Henry’s deep voice was gravelly and you tried not to gravitate nearer to him.

“We’re here today because it is a bit of an emergency. I’m headed to Britain for a couple of weeks this weekend, and I need boarding for Kal. Beginning Friday? Regina said that you had facilities?”

You really needed to talk to your meddling nurse. But you looked down at Kal who started to lick your face. You could not say no. You went over to your computer.

“I’ll check the boarding schedule. I’m sure we have room…”

You opened your laptop and pulled up the schedule. Then you frowned, your eyes flicked over to Henry, then back at the screen.

You looked so adorable as you bit your lip. Then you huffed, seemingly miffed at what you saw.

What Henry saw was a little bit of the brat. And that made his cock a little stiff so that he had to shift his stance. That’s it, he decided. He needed to tame you.

“I’m sorry, Mr. Cavill. It seems we are booked up this weekend, but we will have an opening on the following Monday…”

“Please, call me Henry.”

He was begging now.

You took him in as your nipples got hard. His beauty was no question, his eyes, his hair. It was left out today, the curls unruly as he swiped his hand through them, thinking.

“Well, I… I’ll have to find another arrangement. My flight is commercial and leaves early Saturday morning, else I would take him with.”

Henry looked at you with sad eyes and so did Kal.

“Could you recommend?”

Yours was the best facility within 50 miles. You sighed and couldn’t believe what you were about to say.

“I can keep him at my home Mr… Henry. Just for the weekend. I have lots of land off of Route 60.”

Henry’s eyebrow raised when you mentioned where you lived. He lived on Route 60. You continued.

“Kal will have lots of room. And I’ll bring him with me to work on Monday…”

Henry moved into your space impetuously. You stood your ground, however.

“Splendid!”

You stared up at him, unconsciously biting your lip. The energy between you intensified. It seemed natural to go on tiptoe and reach up to brush the hair that fell into his eyes.

But you didn’t.

“Well, Kal is such a handsome boy, how could I say no to him?”

You looked into Kal’s eyes and petted him. The loving way you looked at his dog made Henry a little bit jealous. He surprised himself.

“Can I have…”

Henry’s voice was now impossibly a bit deeper, and needy. You sighed, and Henry wanted to claim those lips. He thought that outrageous, but this attraction between you was undeniable.

“...Your number and address. I can bring him to your place Friday evening. My flight leaves at 5 am to New York Saturday for my long business layover. Then the red eye that evening to London. I wouldn’t want to wake you up in the middle of the night…”

Henry was thinking just the opposite as he smiled down at you. He’d love to wake you up. And you were thinking the same thing.

Your first instinct was to tell him that he could bring Kal by the office and you would take him home with you, boundaries. But you were exhausted of running from this feeling. Henry gazed at you hopefully and it was your turn to be flustered.

You held out your hand, palm up.

Henry, non-plussed, took your hand awkwardly and grinned, thrilled at the chance to touch you. You laughed, a melody to his ears, as you shook your head and said,

“Give me your phone, Henry”

Henry blushed at your gentle command, released your hand, and pulled out his phone while shaking his head at himself. His grin was the greatest thing ever, and the curls falling forward into his face were a distraction.

He handed his phone to you and you took it, concentrating as you entered your information, feeling his eyes on you. When you gave it back, he looked at your number and address like it was a newfound treasure.

“Thank you. I can’t tell you what this means to me… to us. Isn’t that right, Kal.”

You both looked over to Kal, who barked.

“What time should I bring him by?”

You looked up and thought. You were so damn cute to Henry.

“Well, we close early on Fridays. 2 pm. You could bring him by 3?”

Henry thought for a moment.

“Perfect.”

He was looking at your lips.

“We’ll see you then. Doctor.”

The title was beginning to feel like an endearment. You didn’t wipe the smile off your face for the rest of the day, despite Regina’s side eyes.

——

You don’t know why you were nervous. It was a simple thing really. Just Superman dropping off his dog at your house. No biggie.

You heard Henry’s car on your gravel driveway and went out on your porch

Henry marveled at your place. He got out of the car looking around appreciatively as he got Kal and his gear out of the SUV. You led him to the fence line behind the house.

“You can take him off the leash. Back here he has room to run free.”

Henry did so and Kal immediately took off and galavanted around your animals there. He was cozying up to one of your rescued alpacas as you and Henry watched.

“This place is… there are no words.”

You flushed.

“It’s my childhood home. My dad was the town vet before me, and I think he loved animals more than I do. I grew up thinking he was Dr. Doolittle.”

You became wistful with memories. Then you looked at Henry, bowling him over. His heart was taken in that moment.

“I wanted to be just like him, even when he told me to get out of this town. But I would never leave. He was my hero, a single dad, saving animals. He was my why.”

“Wow. Thank you for sharing.”

You’d never heard Henry’s voice that low. You gave him a small smile.

“He passed away two years ago while I was still in vet school. It was hard.”

“I’m so sorry for your loss.”

Henry wanted to take you into his arms.

“Thank you.”

You straightened your spine.

“I’m sure you’re very busy, with the trip and all..”

Henry smiled at you.

“Would you believe that I’m practically ready to go? Fully packed and all.I’m going to grab an early dinner and head to bed.”

You looked at your watch. It was 3:45.

“Can I make you some tea?”

Henry gave you that beautiful grin.

“I’d like nothing more.”

In your kitchen, Henry soon got up from his seat at your kitchen island to help you make proper British tea.

You were laughing and talking as he teased you for being American. It all felt so natural.

“Where are your teaspoons? See, this is what I mean….”

Henry was standing behind you, not looking for spoons at all, but looking at that ass in your casual at-home leggings. Good god you were hot. You shook your head and turned around quickly to find him facing you.

“They’re right- oh!”

You were deliciously in Henry’s space and as you looked up at him something happened and he leaned down to kiss you. It was a quick press of the lips but it previewed so much more.

“I- I’m sorry. That was way too forward-“

Henry was cut off by you jumping up into his arms and wrapping your legs around him as you kissed him back. His surprise turned to passion as he grunted in his throat as he claimed your mouth.

He turned you around and sat your bottom on the island, slotting his hips between your legs, his hands on your sides. The kiss was a feral expression of pent up need that was only interrupted by the whistle of the kettle.

You stopped and laughed, and Henry pulled away to take care of the pot. When he turned back around, you were down from the island and all business again. The mood was lost.

You served the tea as if nothing had happened.

The silence between you two as you drank was big, but thoughtful, not awkward at all. Henry was smirking down into his cup, replaying the kiss in his mind. It was more than he could ever ask for. You, however, were thinking quite the opposite.

You turned to him after you finished your tea and asked, “Want to see my comic book collection?”

10 minutes later, you were upstairs in the comic book room, amid boxes and boxes of classic comic books, the collection started by your father. There were books in every conceivable surface, so you were setting in a bean bag chair while Henry kneeled and flipped through a box of Wolverine comics.

“Holy hell! You have the Wolverine Top Secret #50! Do you know how much this is worth?!?”

Henry was impressed, and so were you.

“Not really. But I’m intrigued that you are so into a Marvel book, i would think you would be strictly a DC alcolyte, Man of Steel—“

You gasped.

“Holy shit! I have Superman in my comic book room.”

Henry raised his eyebrow.

“Do you want Superman in your…. nevermind...”

You gaped at him, mouth hinged open at his saucy comment, and Henry was scared that you would kick him out. But you started rolling on the floor laughing instead.

“You’re such a dork, oh my god. ‘Do you want Superman in your…’ hahahaha… that’s what she said… hahahaha…”

Henry laughed too, coming over to tickle you to extend your laughter. It was musical. You two horse played until you weren’t playing any more. You lay beneath Henry, flushed and out of breath and never more beautiful, your shirt halfway up your torso and comic books strewn around you.

He had to kiss you again.

Soon, his mouth strayed from yours to your neck, sloppily marking you up and getting you wet as he rutted against your center. His jeans and your leggings were the only barrier to you full out fucking.

His hand reached under your shirt and you pushed him away, panting as you tried to get your bearings.

Henry was wild, hair in his eyes as he nodded.

“You’re right. Too far. Too much.”

He leaned back on his knees and your eyes raked from his thick thighs to the bulge in his pants to his dilated eyes.

You stood up, still silent and so did Henry, following you out as you straightened your clothes and your hair. You were wrapped in the last string of decorum in you.

Henry ran his hand in his own hair, looking to the side and catching sight of your bedroom. Then he watched your bottom sway in front of him.

“Just want to bite that ass.”

You heard his lewd comment and wheeled around on him on the landing of the stairs.

“What are you doing? What do you want? A fuck buddy while you’re here? Because…”

“Do shut up, Doctor..”

Henry took your head in his hands and leaned in for a kiss, pausing momentarily to look into your eyes. Then Henry destroyed that string of decorum with his kiss.

Somehow, you wound up on your bed, heavy petting like two teenagers, Henry’s hand up your shirt, teasing your nipples.

When he reached for your pants and slipped his thick fingers into your panties and felt your slick, he cursed.

“Fuck, I don’t have any condoms.”

When you arched and moaned when he breached you, and he felt your tight cunt, he licked his lips.

“No matter, won’t be necessary, just let me eat you out. Take all that off.”

You obeyed, buoyed on a cloud of lust.

“Beautiful.”

Henry gazed at you for a minute, and then you reached for his zipper. He let you pull him toward you and start to work it open.

“Ah ah ah. I'm far too hard for that. Let me.”

Henry carefully removed his pants around his massive, hard cock, which made his dark blue boxer briefs even darker at his wet tip. You licked your lips and palmed him over his underwear while looking up at him with those eyes. He knew what you were asking.

“Hmmmmm. I’m going to have to say …no.”

You pouted as Henry chuckled and flipped you over, pulling your hips up so you were on your knees before him. You watched over your shoulder as Henry leaned down to kiss, and then in fact bite, each of your cheeks, rubbing to soothe the sting.

“Oh. If I had more time…”

Henry shook his head and then descended to the valley between, licking a large, rude stripe up the length of you.

“Yes. My dreams, Doctor. This is better than my dreams. Taste like heaven.”

Then he went to town, feasting on you and moaning, rubbing his nose and chin into your folds, sucking your clit, and causing you to grab his head as you came all over his beautiful face.

When you opened your eyes you were on your back, Henry above you, one hand parting your lips again, and another wrapped around the biggest uncut cock you’d ever seen. You gasped when he inserted a finger into you, not realizing how big his hand really was. It made sense now.

“So gorgeous. But, it seems I’m far too big for you. I fear I’d tear you apart.”

You arched, which elicited a moan.

“It’s amazing what a body can do. Why don’t we try, and you could always pull out…”

Henry grunted, climbing up between your legs, led by his dick.

“I’ve decided that’s not a good idea. I’ll just use my hand to finish.”

His smirk said he was teasing, but you were mad. Your pussy clenched, seeking fulfillment, as Henry jacked his cock above it, angry red tip projected now and leaking precum on his fingers.

You whined and writhed beneath him.

“Henry... you can’t do that to me…”

Henry nodded his head, eyes ablaze.

“Yes. It would hurt you too much.”

He was stroking faster now, jaw clenching with restraint.

“No. You can’t show me that magnificent cock and not give it to me.”

Henry groaned and leaned down to kiss you, continuing stroking with his hand. His tip was at your entrance, driving you mad.

“Give it to me…Henry…”

“Such a brat.”

Henry bit your ear and you arched your back as he shoved the tip in. Just the tip.

“Henry!”

“I’m giving you what you want, Doctor…”

His voice was controlled in your ear, but you felt his cock jumping inside you.

“God you feel so….. I need to go travel this silken canal. But you’re so, so tight…”

You rotated and locked your ankles on his back, making him stop and rest his forehead on yours. You both looked down to where you were connected.

“Stretch me out.”

Your plaintive whisper caused his reserve to snap.

“Unnnngh. I’m not strong enough to tame you tonight. I want this.”

Henry started moving, gliding slowly inside you, fucking you open like you’d never been before.

“Hunh, Hunh, Hunh, Hunh…”

You moaned with every inch, the pain a delicious nirvana. You bit Henry’s shoulder until he was fully seated inside.

Henry looked you in your eyes and then closed his and shook his head, as if trying to snap out of a trance.

“You are exquisite, you know that?”

He’s never seen a more beautiful sight than your face when you were full of him. When you shook your head no to his question, Henry started moving.

“We’ll, I'm going to teach you…”

Your fingernails dug into his forearms as he delivered the long strokes which served to short circuit your brain. Sparks were shooting off inside you with every pull and drag of his thick cock along your walls.

When you started moaning with pleasure was when Henry reared up on his knees, pulling your bottom up to rest on his thighs. He held your waist as he pumped inside you, not able to tear his eyes away from his cock destroying you.

The image of a naked Henry just outright fucking you, along with the heavenly way he was delivering the dick made you start cuming. Him just looking at your clit made it start pulsing. Did he really have x-ray vision?

Henry’s mouth hung open at the way your pussy started creaming around him and when he glanced up at your face, well, it was all over for him.

“Cum with me!” he commanded.

When you screamed is when Henry pulled out, pumping his creamy cum all over your torso. The velocity of his spend, the way it sprayed all over your body and reached your open mouth, extended your orgasm and you howled, literally howled.

You licked your lips, tasting him and hummed as your body vibrated down from the clouds. You felt Henry lay down beside you and start drawing his cum around your areola. Your clit jerked your entire body and Henry raised his eyebrow.

“I’m sorry that was so…”

“Amazing, perfect?”

“…Rushed, but next time, I promise you an entire night of delights.”

You shivered at the promise and bit your lip.

“It’s time to get cleaned up.”

Henry was admiring his handiwork all over your body. You felt his cock thicken against your thigh. You couldn’t believe it.

“You need the shower?”

“Later. Now. I’m going to tidy you up a bit.”

And Henry’s lips claimed your breast, along with the rest of your body marked by him.

—-

At midnight, after some more fun in bed and the shower and takeout and more fun and another shower, you grabbed Henry’s sweatshirt and pulled it over your head. The sight of you engulfed in it, and knowing you were naked beneath made Henry want to cancel his flight.

“Can I borrow this?”

Henry chuckled, “Borrow. Right.” Henry grabbed your neck and brought you in for a forehead kiss.

“Let’s trade. A sweatshirt for…”

He held up your still wet panties pulled out of his pocket. You gasped.

“No deal!”

Henry held it above your head as you tried in vain to jump and retrieve your underwear. You knocked him off balance into the couch and somehow wound up straddling his crotch.

Henry grabbed your ass as he felt the heat radiating off you.

“I can’t get enough, and now I have to leave…”

His petulant pout was everything. So you kissed it.

“I’ve reconsidered, your sweatshirt smells like you. When I wake up wet from dreams of you, I want to be enveloped in your scent.”

You were trying very hard to be still, but you felt the bulge in Henry’s jeans get bigger. He brought your panties to his nose.

“My thoughts exactly.”

You started moving on Henry’s lap, your warm wetness seeping through the stiff material to his stiff dick.

“Give me one more thing before you leave.”

Henry’s eyes were dilated, lust blown and beautiful.

“Anything.”

“Your cum down my throat.”

“Christ, Doctor…”

#ask dj #dj will answer #henry cavill x reader #henry cavill x you #henry cavill smut #henry cavill imagine #henry cavill #henry cavill x black reader #henry cavill x veterinarian!reader #doctor and mr cavill #henry cavill rpf #kal cavill

2K notes · View notes

urlocalnonbinarybastardwrites · 2 months

Text

Greasers x mean girl/boy/person (think Regina George, Heather Chandler, Bryce Tankthrust) s/o who uses their status to protect their greaser and is kind of nice under all the cutthroat boss bitch-ness. Like the top rank of social that most other socs are afraid of.

(tried to make it gender neutral of my best ability, but it’s hard to fit phrases like “ queen bee” into gender neutral terms)

Inspo:

*socs approach and start making jeering comments* Hey Grease…

*you get in front of them* if you ever talk to them like that again, I will make it my personal life goal to ruin yours, and no one will hire your sorry ass again. Oh, and you can consider *insert secret* spilled.

Ponyboy Curtis

-intimidated by you fs

-he knows your life ruining rep

-sukrised when one day you tap on his shoulder

“Ponyboy… right?”

“U-uh yeah that’s me!”

“Great you’re tutoring me. Every Friday.”

“U-uh ok?”

-you guys actually get along and he helps with with your grades a lot

-You actually become friends and stand up for him against other Socs and even your own friends

-One night he’s walking home alone from the movies and four Socs approach him and start threatening him

-you on one of their shoulders and the Soc blanks and realization as he remembers your long-standing friendship with Pony

-“if you ever mess with him again I will ruin your life. You know I will.”

-the Socs all back up, and you stand there, smirking

-I feel like that’s when pony boy realizes his feelings for you and kisses you right there on the spot

-you guys are actually a really great mix, the popular person and the kind of more quiet guy

Johnny Cade

-he was so scared of you

-thought of all the possible ways you could ruin his life even more

-one day he comes to school and his locker is spraypainted with “Bastard Greaser”

-he’s even more suprised when you approach him at lunch break

-“Johnny Cade, right? Yk, you’re kind of cute… *you smirk* Anyway I have a dear friend… well, ex friend with me that wants to apologize for so crudely vandalizing your locker. RIGHT, Jessica?”

-his head is spinning, the queen/king bee of the whole school just flirted with him and made a bully apologize?

-you start coming to the lot more and more after that, and realize he often doesn’t have a place to sleep

-you invite (drag) him to your home where you set up a room for him, and being rich, it’s pretty damn nice

-I feel like that’s when he realizes his feelings for you and one night, when he’s about to go to sleep in his bed, he leans over and kisses your cheek

-you guys become a new couple and it shocks everyone

-yall are cute tho ❤️❤️

-you make sure no one gives him shit. If they do then LORD help them

Sodapop Curtis

-ok so you guys are a more expected couple

-prom royalty fr

-soda probably made you nice 💀💀

-you guys met in school and started dating, and he helped you kind of be the nice kind of popular

-you also spoil him with your money fr

-his brothers are skeptical of you at first (especially after sandy) but once they see your do really like him they totally ship you

-POWER COUPLE

-fr you guys are what everyone wants to be

Darry Curtis

-you were both popular and kind of ran in the same circles but didn’t like eachother

-he didn’t think he would like you because he doesn’t like mean girls/guys/people and thought you’d be all fake n stuff

-but one day yall got assigned to work on a history project and you both got along pretty well and you put in a pretty good effort

-that’s when he realized that you weren’t so bad and you two became friends

-eventually he caught on feelings for you and asked you out

-sweet couple, and everyone ships it

Dallas Winston

-you two met in detention FS

-you spread a nasty rumor about a boy who cheated on one of your close friends and he vandalized something

-enemies to lovers energy

-yall didn’t like eachother that much

-he sat behind you and kept making crude remarks and messing with you so you bit back

-“There’s no way in hell if ever dream of being with a lowlife like you”

-after a bit of banter and insults you somehow end up on his lap making out with him

-the teacher walks in and is like wtf- my eyes-

-you guys are the best power couple people cower in fear with you two together

-calls you prince/princess or doll fr

-it’s a typical bad boy x mean girl/guy/person thing

Two Bit Matthews

-you fits me at the mall when you were making fun of another stuck up girl

-he joined in with the teasing

-you were like ohhh this one’s kinda funny and you two actually hit it off really well

-you liked his wisecracks, they made the world all the more entertaining and he admired your cutthroat bitch attitude

-yall started dating after a while

-class clown x mean girl/guy/person and it’s SO iconic

-you two are surprisingly healthy for eachother, you both kind of get to see the under layer

-like you get to see what’s beyond his wisecracks and he gets to see beyond your plastic mean girl facade

Steve Randle

-he was suprised

-when you went up to him instead of Sodapop

-but when you pulled up in your red Ferrari with a scratched tire that was totally not just an excuse just to talk to him and started heavily flirting

-he wasn’t impressed, he still thought you were fake

-which bothered you, you didn’t know anyone who didn’t like you or at least pretend to

-so you kept showing up and one day a group of Socs stopped by the gas station, spitting on him

-you got furious and nearly ruined your car trying to ram them

-Steve was kinda in love after that

-he realized you really weren’t plastic

-you guys got together and are sooo cute

-when you go on long rants he listens to you while he fixes his cars

-and you have a free new handyman

135 notes · View notes

berrinlee · 14 days

Note

hiii!! I just recently found out abt ur blog and I really really love your works sm like omg ugshhdhdh

anywhoo is it okay to request sbg x reader who acts like regina george? its been bothering my mind lately aaaaa u dont have to write it! hihih tyty i love you take careeee

IT GIRL

author’s note : i love when ppl enjoy my things ilysm /p

concept : regina!reader with the sbg group

genre : headcanons, mean girls!au, drabble

content : might be ooc, reader is an actual bitch, not a single hint of genuine softness

meeting the group

⠀ › ⠀has bullied logan once or twice but then ignored his presence completely after and forgot about him

⠀ › ⠀out of the whole group, logan is unsure of you the most. he can’t tell if being in a group with someone who bullied him before is good since you have seemed to forget who he was.

⠀ › ⠀tyler knows your reputation and is bothered by your presence honestly

⠀ › ⠀ashlyn has never heard of you; never had connections so she doesn’t know you that well but was bothered with your first impression

⠀ › ⠀taylor would try to warm up to you but you make her feel so out of place with how flashy you are

⠀ › ⠀ben and aiden don’t know your reputation since they’re new students but when tyler suddenly revealed everything when he started complaining about you; aiden was entertained with your rivalry

sorrel house

⠀ › ⠀you found the random lady who asked you to go inside very.. weird.

⠀ › ⠀only went in because the others said sure, you just had to be nice.

⠀ › ⠀you felt chills down your spine when you saw the phantom but just like tyler, you chose to brush it off.

phantom world

⠀ › ⠀by this time, you still hated them. (you probably shit talked them too)

⠀ › ⠀when you all got locked in the room, you felt panic until you just thought of using them as ‘meat shields’

⠀ › ⠀you and tyler had a whole fight about what matters most in the moment until ashlyn had to break it up

⠀ › ⠀the first time you were put in severe danger, you used the others as an advantage to survive.

⠀ › ⠀however, this caused problems. the next night; you would be in the same place again.

⠀ › ⠀at some point you’d have to apologize. the next time you were put in danger; it was logan near you. the first thing you had to do was.. apologize? are you fucking serious.

⠀ › ⠀due to the panic of the near-death experience, you stammered out an apology and begged him to help (took a few corrections since you were screaming curse words)

general headcanons

⠀ › ⠀when you flex your expensive things, aiden would suddenly bring up something more expensive (it becomes a debate on whos is more expensive. between the two, aiden’s having fun and you’re just getting upset.)

⠀ › ⠀tyler took the longest warming up to you

⠀ › ⠀there would be a lot of times when you would get into fights because of how opinionated you can be.

⠀ › ⠀you’re pretty much forced to be friends with them. it’s ride or die. no matter how much you hate them.

“i can’t do this anymore, i swear to god, i’m so stressed! and stress causes pimples! and restless nights cause eyebags! i’m gonna get eyebags and pimples!” you panicked “now’s not the time to worry about that!” tyler screamed, grabbing your arm and pulling you away from the phantom chasing you.

#school bus graveyard #sbg #school bus graveyard x reader #aiden x reader #ashlyn x reader #taylor x reader #tyler x reader #ben x reader #logan x reader #logan fields #aiden clark #ashlyn banner #taylor hernandez #tyler hernandez #ben clark #sbg x reader

58 notes · View notes

townbully-hatzroy · 8 days

Note

“ ..Roy? Are you busy..? “

She’s still huddled up in her blanket, though she has a stuffed animal tucked under it.

“ I think I fell asleep and w-when I woke up, you weren’t there..so.. “

— Lottie Dottie

" Hey Lottie. I'm not uh, at home right now.. "

" B-But I didn't just leaved you for free or anything! I thought you were okay since you fell asleep! I promise! "

#OOC: I'm assuming this is like #after Roy went to Regina's housw #house #💔💔#spooky month #spooky month roy #spooky month hatzgang #spooky month roleplay #spooky month rp #ask blog

5 notes · View notes

starrclown · 3 months

Text

I have 3 differing opinions on Hazbin Hotel scenes than what I used to and I didn't wanna make a individual post explaining it so let's go over these all together.

What were talking about:

Loser Baby

Angel's Sa + Sir Pentious

The Vees being evil.

Triggerwarning for Sa and Rape.

First let's get loser baby put of the way. I was kinda critical on that song cause it felt like Husk was telling Angel to get over being under Valentino and to indulge in his bad behaviors.

My opinion has changed. Honestly I don't think that's what the song was trying to say but I understand why me and other felt like it did. Angel's dialoge before that song makes much more sense before the song.

I like the song. It's catchy and sounds good. I like it alot more than what I used too. While I know what it's trying to say, I think it had akward execution.

Next is Angel's Sa.

I never really talked about Angel's SA because I'm not a SA survivor and my opinion shouldn't be used in this argument. The only time I remember critiquing Angel's SA ans hypersexuality is when he says "This body was made to be exploited!"

Yeah I still think this line was gross.

I remember people argued that Angel was using that line as humor to cope. Honestly that's really intresting and can work. Thing is that's it's not played as joke. Charlie says she wouldn't want to exploit Angel and then Angel says this line and then everyone looks uncomfortable.

Like this line can work as Angel joking to cope but the scene doesn't play it like that. Maybe we're supposed to laugh at it but 1. Objectively I don't think it was funny and 2. Shouldn't the characters have a reaction that's not uncomfort?

Like if someone brought it up in the show like Husk or Vaggie that it was a dark joke and ask Angel if he was okay then I believe it could work but the scene isn't like that.

If your a SA survivor feel free to way in cause this is my only opinion on Angel's SA and your opinion is more important than mine here.

Part 2 to this. Sir Pentious.

The scene where Sir Pentious gets dragged into a room to have sex against his will is gross. If you have an entire episode dedicated to supporting SA survivors why the fuck would you add a scene where Sir Pentious gets SA'd? You did this with Moxxie and it wasn't cute. That scene with gross and no one can change my mind. Ew.

Last one is gonna be longer. The Vees being evil.

I made a post a while ago saying that liking Velvette and Vox is completely fine because their better than Valentino. People in the comments argued that their all equally evil and I'm not superior for liking Velvette and Vox more.

This is something I don't exactly agree with. People in the comments were correct on some things. Velvette and Vox enable Valentino. They stick around with Valentino. Velvette made the date rape drug with Valentino. Velvette abuses her modles. Vox litteraly hypnoitises people. Are Velvette and Vox disgusting and vile? Yes. Are they as bad as Valentino? I say no. Ya know why? Their not rapists.

I think Vox and Velvette are disgusting people who are horrible for putting up with a rapist. They are evil. No arguing that. But Vox (not Velvette because she made the date rape drug) isn't on the level of Valentino because he's not a rapist. Valentino is.

If you think the Vees are equally evil then that's fine. My opinion is that Velvette and Vox are only a little better because again, they didn't rape anyone. Velvette is gross for making that date rape drug though.

Okay now that we got that out of the way let's talk about this tweet I saw on here (saw it on someone's blog) because it appuled me.

I'm aorry what? Valentino, the rapist, Velvette, the woman who abuses her models and helped Val make the date rape drug and, Vox, the man who is romantically involved with the rapist, are Karen, Gretchen, and Regina?

I'm sorry huh?

Those two groups are NO WHERE near each other. Regina, Gretchen, and Karen are mean high-school bullies. VALENTINO IS A RAPIST. Comparing Valentino to Karen, a airhead teenager who bullies people with her friends, is so weird to me.

Like why the Mean Girls? I know Viv is trying to make a comparison but I think it's weird as fuck.

"The Vees are just mean girls." No. No their not. Their disgusting demons rotting in hell.

This is on the same level as Valentinos voice actor saying Valentino is bubbles codded.

I just wanted to make this post cause while I am critical of Hazbin Hotel, I think I was wrong for some of my opinions and I'm willing to admit my mistakes.

If you have a differing opinion, be respectful in the comments to me and people who don't agree with you.

- ⭐️StarClown⭐️

#hazbin hotel critical #hazbin hotel criticism #hazbin hotel critique #vivziepop critical #vivziepop criticism #vivziepop critique #owning up to my opinions cause i have alot of them #viv stans dont attack my comments please.

86 notes · View notes

writing-imagines · 5 months

Text

I’ve always tried to make my blog a safe and open place for all people (except for the bad ones, yes, all the bad ones you’re thinking of). Now, I’m going to be open and vulnerable and ask two very sensitive yet important questions.

Where are all the Regina George x reader fics??? Where are the Karen Smith x reader fics???

#like did the movie reach the wrong audience??#do people hate Regina??#do people hate Karen??#I need answers #I need fics #mean girls #Regina George #Karen smith #Regina George x reader #Karen smith x reader

93 notes · View notes

yuri-is-online · 15 days

Note

Hello hello! Anon here. First of all, congratulations on getting accepted for your courses! Don't worry about trying to balance work and the blog, we will always be here waiting for you. Second of all, your whole Yutu AU has been really fascinating to look through. (Though that may be because of my bias toward Fire Emblem Awakening, as it was what got me into the series) Sorry for the incoming wall of text, but it's been giving me THOUGHTS.

So imagine this: whoever Yutu's dad is (I'll pick Azul for this example because I headcannon his English voice somewhere between Matt Mercer's Chrom and Olivert from The Legend of Heroes games) finds out who Yutu really is. You remember that cutscene after Chapter 13 in Awakening, with the Lucina reveal and Chrom has this: "You deserved better than a sword and a world full of troubles. I'm sorry."? Imagine Yutu hearing something like that: the acknowledgement of everything he's gone through, the pain of knowing his dad couldn't do anything and can't do anything more than offer words, and the reality that it might now be really possible to change the future? I imagine Azul breaking down after hearing all that because the last thing he wants to do is hurt Yuu or his son after everything he's been through. Oh goodness, the two of them both need hugs.

Second: did Crowley tip off the Magic Marshalls (because I think he would) and force Yuu to take the blame for his negligence (because he absolutely would)? Now imagine Yutu finding this out and telling his dad. Now his dad knows Crowley is a cheapskate who fobs his work onto everyone else without a second thought. And now he's responsible for having Yuu taken away and starting all this? Knowing the boys and how far they would go for Yuu I'd imagine they don't take that well. In other words, to slightly alter a quote from Regina in Once Upon A Time: "I guess killing a crow suddenly made the top of my to-do list."

Sorry for the wall of text but that's been rattling around in my head for a few days (so make of it all what you will). Hope you're doing well and looking forward to what's next!

-The anon who loves Riddle & Azul

AHHHHH (i feel like I always take forever to answer your asks I am sosososososososososo sorry, this one just drove me crazy in a good good way)

Listen fire emblem awakening was my entire personality for like all of middle school. The only thing i wanted to talk about was chrobin. I celebrated Morgan and Lucina's birthdays by drawing them. I think I still have a Cherche x Libra fan art thing I drew on some sheet of paper somewhere in my things because I was SO MAD that no one shipped them and I couldn't find fan art of them anywhere and I just oooooooooooh. THE WAY CHROM GETS A NEW CRIT LINE ABOUT HOW ANYTHING CAN CHANGE AFTER THE REVEAL???? BECAUSE OF HOW DETERMINED HE IS TO KEEP THAT PROMISE AND GIVE LUCINA A BETTER WORLD???? i just cant be normal about them i am so sorry. R+A annon I love you, I love you so much for this you made my entire month and possibly my year. Awakening is also what got me into the series and made me so many friends I just love her so much. She's an icon and I hope she gets remastered with Sumia either deleted or with a fucking personality.

I should probably sit down and actually write a timeline for myself of events, but since I am free to lean in to the fire emblem pacing, I want to say that monsters from Yutu's timeline start showing up (similar to how the Risen do in Awakening) in the past and stirring up trouble, which leads to an event where Yutu panics and forgets himself in his desperation to protect his dad. The main way the future kids always proved themselves was by showing their mother's wedding ring, but Yutu doesn't have that so really it's just up to his dad to see someone who looks like him and Yuu blended together, supposedly from Yuu's world using magic and above all else crying out and driving up his own blot levels to protect him calling him dad. For Azul! Yutu it's especially painful, he feels like he already knows what his dad is going to say. That he's disappointed in him. That he has no idea how they could possibly be related. That he hopes in this future he turns out to be different. But that's not what happens.

Before Azul overblotted he was quiet. There's a similar quiet over him now, a similar look of tense surprise, but Yutu- no- his child doesn't know that. His child is looking at him in fear, in worry for his reaction or his safety he doesn't know but he knows the way those tears start to form. Azul knows the quiver of the lip and the shriek, of all the things he could have passed on to such a treasure.

"You deserved better from me." Because it's true. He might think of himself as a work in progress but he still thinks he has quality; he would have done research, read every book he could get his hands on, taken classes, anything he would need to do to be a good father, a worthy partner. Anything. "You deserved to have the world within your grasp, not whatever shadow of a future and a father I left you with. I am so sorry." He does not expect Yutu to grab him and hold him like he's still somehow worthy of his love, but Azul can't fight the urge to grab back, to stroke his son's hair and let the tears fall on his suit without any care at all. I'm here. It's ok, daddy's here, daddy's got you, he won't let anything happen to you.

As for your second question, I did not really write Crowley like that no. It was more like he was the first person mysteriously arrested after the Magical Marshall's decided to finally do their job. I was writing it like they wanted to ship Yuu away to cover up for their own incompetence in preventing seven overblots instead of properly investigating what might have caused that. He's not completely innocent though, so yes. The boys do not take it well at all. And please do not apologize for sending in your thoughts, I am so so slow but I love hearing from you.

#<3 asks #twisted wonderland x reader #twst x reader #future kid au #azul ashengrotto x yuu #azul ashengrotto x reader #riddle and azul anon

38 notes · View notes

sheluvslani · 4 months

Text

Hoes-love-Lani’s Masterlist:

✅: Smut, fluff, angst, fem reader. Literally will write anything like the normal fucking fanfics you see on here. G!p is a maybe, I’m not good but I’ll try if you really want, if anything it’ll be a strap on 😜

❌: incest, pedophilia, rape, cnc, zoophilia, alpha/omega, WEREWOLF SHIT, FURRIES, stuff like that. No non-binary or male reader. I will not write for any of these at all. I have the right to refuse any requests, don’t send me weird shit in my asks.

I just want to make this clear, idc if minors read my blog. It’s a piece of writing, not a porn video. Okay? And I obviously have warnings in all of my fics in case yall don’t fw them.

most of these guys are underage, so obviously they’ll be aged up‼️

don’t be afraid to request for someone else! I can totally switch things up and try someone new! 🤷‍♀️

fanfics⬇️ hearts and reposts are appreciated, but not forced!! 💋 But I don’t consent to having my work copied, you can take inspo but not word-for-word 🌝

smut - 🍒

fluff - 🥭

Angst - 🥥

Headcannons - 🥝

Drabbles - 🍓

Personal Favorites/Most Popular - 🍑

Anon List: 🍘🍭🌹🍓🎸

Jenna Ortega: Requests Open

Jenna Ortega:

Jenna Ortega Characters’ Favorite Music Artists And Songs 🥝

The Death Of Us (zombie apocalypse series)- coming soon

Tara Carpenter:

Tara Carpenter Math 🥝

Tara Carpenter Headcannons Pt1 🥝

Behind Chad’s Back - Coming Soon 🍒

Brat - Coming soon 🍒

I Trusted You (Ghostface reader series) - coming soon

Wednesday Addams:

Are You Gonna Let Me In? 🍓

Cairo Sweet:

Inexperienced 🍒

Knuckle Deep 🍒🍑

Goodbye My Baby - Coming soon 🥥

Vada Cavell:

So High - Coming soon 🍓

Lorraine Day:

Church Mouse - Coming soon🍒

Mikey Madison Characters: Requests Open

Mikey Madison:

Tired - Coming soon🥭

River (All Souls):

At All Costs - Coming soon 🥥

Max Fox:

Makeup Session - coming soon🥭

Amber Freeman:

Not What It Looks Like Pt. 1

Not What It Looks Like Pt. 2 🍒

Scream 1-6: Requests Open

Ghostface: (no specific one)

cooking up in drafts

Ethan Landry:

cooking up in drafts

Quinn Bailey:

Quiet - Coming soon 🍒

Mindy Meeks-Martin:

I Will Always Be There For You - coming soon🥭

Jill Roberts:

Drunk In Love - coming soon 🍒

Mean Girls 2024: Requests Open

Regina George 2024:

Is That a Threat or a Promise? 🍒🍑

Karen Shetty 2024:

When I Have You 🥭

The Last of Us:

Ellie Williams:

Linger - coming soon 🍒

#jenna ortega x fem!reader #cairo sweet x reader #tara carpenter x female reader #reneé rapp x fem!reader #regina george x fem!reader #Wednesday Addams x fem!reader #lorraine day x reader #Karen shetty x Reader #Deena Johnson x reader #cindy berman #ghostface x female reader #quinn bailey x reader #mindy meeks martin #jill roberts x reader #ethan landry x reader #max fox x reader #river x reader #ellie williams x female reader

100 notes · View notes

xxlovelynovaxx · 4 months

Text

Hey, tagging everybody on this list because a member of a hate group known to be pro-harassment is creating a "blocklist" that just puts targets on y'all's backs. If used as intended, it might actually be helpful, but... well, if I ask how many of you have been personally victimized by Regina George anti-endos, we're gonna get the whole bleachers raising their hands. Because this is a safety issue, anyone can send this to anyone on this list I may have blocked. If you see this and want me to take you off my version, note that you'll still be on the antis one but I am happy to do so, and you may also block evade to do so as again, it is a matter of safety.

Sideblogs named not included, but I'll put an astrix by those that have multiple sideblogs listed. The blog doing this is "endo blocklist" if you want to be able to block them yourselves.

@abyssal-system

@agentgreenbean

@anendoandfriendo

@batm0th

@chocobarsys

@closeted-punk

@curiousitycollective

@daydreamers-sys *

@dialtownsys *

@dogboysora

@draco-system

@dreambound-ring

@sophieinwonderland *

@eliias-bouchard

@emojis-are-cool

@endogenichaven

@endonp-no-d

@fightinggod03

@fowlsys

@funnierasafictive

@funnier-as-a-system

@gateway-2000

@gracien-system

@gentlewonderssys

@homestuck-tech-psy-fan

@hourglasssys look

@introject-confessions

@introject-culture-is

@isappho

@jadeitis

@lorisystem

@metafarers

@monopool-system (is this supposed to be @moonpool-system ?)

@morcialists

@nightfallsystem *

@nonlibidoist-culture-is

@none-gender-left-man

@paracosmic-gt

@paxislandsystem

@plural-culture-ic (maybe @plural-culture-is ?)

@ponderouswhims

@positively-plural

@pluralpolls

@pluralprompts

@problemaddtic

@queermetalgremlin

@rookie-captain-friska

@rosegroup

@rjalker

@shadowstarlightwitch

@sirenium

@starfallsystemsblog *

@stars-in-our-skies

@starznvoidz

@syscourse101

@syscoursebot

@syscourser

@sysmedhater

@symmetrysys

@syssettings

@system-comforts

@systematic-hyyydromatic

@t4tdog

@tscs-plural-advocacy-blog

@the-astral-arbour

@the-amethyst-system

@the-dreamworld-system

@theluminolussystem

@thelunastusco

@theweebsystem

@urfavisplural

@pierz

@dr-gearz

Hang on, ran out of mentions, I'll reblog to add more

#metafarers

63 notes · View notes

Last Seen Blogs

godsofhumanity

i changed my mind.

aairom

AAM

lilllybones

Lilly in the void

aurum-writer

AurumWriter

patyinwonderland

paty.in.wonderland