set out to create a serious, canonesque drawing with which to say "feel free to go in my lackadaisy tag and help me mystery speculate" but only got going when i made it bowling and the rarepair agenda
315 notes
·
View notes
Are Witcher’s still made in the onlyfans Au? I just have a hard time picturing this modern good dad Vesimir putting his kids through the trails, especially if they might not survive, especially if Gerald doesn’t want to be.
You are absolutely right! He would never.
I have not thought that out in detail, but I imagine it’s a mix of spontaneous genetic mutations (that are quite rare) and a ‘running in the family’ thing, because they’re not 100% sterile anymore.
For Lambert it was a mutation his parents didn’t see coming (hence they gave him away / maybe his father accused his mum of cheating, idk), Eskel just doesn’t know, he remembers his mum but not too much of her; and for Geralt…
I thought that maybe there is some higher chance once magic is involved? Maybe he’s still a law of surprise child? I haven’t really thought about why Visenna gave him away, she just put him in Vesemirs care “for a few days” and never picked him up again.
156 notes
·
View notes
regis and his ex-girlfriend is. i’ve never known a fictional pairing to cause me such deep emotions and such intense pain, despite the fact that i don’t like them together and i actually think they should stay separated. truly the doomed romance, tragic pairing, divorcees of a lifetime or two. every time i think about them i am clenching my teeth, digging into my skin with my fingernails, pulling my hair, sobbing,
11 notes
·
View notes
having thoughts about like. how the flashbacks we see of setrákus, pittacus, and celwe are ambiguous enough--the tiny slices we get of their dynamic, and all of the missing context in between--that pittacus' nastiness toward setrákus might be in response to setrákus being abusive toward him while they were growing up. and setrákus' nastiness toward him might be in response to pittacus being abusive toward him while they were growing up. or maybe they were just shitty to each other and in general, with celwe and Everyone Else getting caught in the crossfire.
the authors probably intended for it to be the first option, to the extent they were thinking about it in those terms at all: pittacus grew up with a friend who's been shitty to downright abusive toward him, and by their big confrontation he's had enough time away from him to unpack how fucked up his behavior was, and understand his tactics in order to call them out. you could interpret it that way, and were probably meant to, and it would make sense.
but... that assumption is kind of the problem, to me. because the other very much valid way to interpret what we see is a certain kind of abuse that's bad enough by itself, but is primarily aimed at neurodivergent and otherwise marginalized people in particular. (and setrákus is autistic as fuck.) and it's abuse that widely goes unseen and ignored, and is most often perpetuated by people who know they can afford to do it, or think they can.
might have to come back to it in more detail in a reblog, honestly, because it's a lot to talk about; but essentially it comes down to silencing someone by either openly dismissing what they say as nonsense that no one can understand but them, and isn't important enough to try, or disguising it behind a bad faith ''attempt'' to understand so they can say they tried and there's no point. it's a lifelong trauma which has shaped enormous parts of my personality and how i communicate, i can spot it a mile away, and i see all the hallmarks of it in their relationship and how setrákus is affected by it.
and that bothers me. it bothers me a lot that we're supposed to see one and not the other. it bothers me that it's not even 'pittacus' behavior is genuinely shit, but it's somewhat more understandable in the version of events where the context is that he was abused'; he's framed as the hero of the situation either way, who's acting out of pure kindness and reason and good intent. it bothers me that the person who is easy to interpret as having been abused this way would, even then, still be depicted as the Abusive Hate Sink Incarnation of Evil. (because he is abusive, and he is very much an evil son of a bitch. regardless of who was worse in his relationship with pittacus, that's true.) and it bothers me that that framing makes it harder to explore how the cycle of abuse manifests in this scenario, because it absolutely is a thing that happens and is worth telling stories about.
just, i don't know. thoughts. hm.
4 notes
·
View notes
Something I adore about T-Bag is how subtle but consistent his character development is because as the seasons go on and he spends more time out of the jail (or, in other, worse jails) the more of his worst traits and beliefs he kinda let's go. Which is what makes me passionate about him he really has it in him to improve, to change. By the intro of season 5 he was literally just living alone in a swamp or something and didn't even want anything to do with Michael.
Like it's not that it happens from morning to noon it's just that there's less and less opportunities for him to repeat his problems to the point he just stops doing it altogether willingly it's just really neat. I just enjoy it.
1 note
·
View note
I think my problem is I don't currently have patience for baby feminists who's big bug bear is how "evil" and "awful" pink is
Like yeah I get it I also had a phase where I hated pink and it is annoying how culture as a whole likes to assume pink is automatically a girl thing, when we first started dating my partner made jokes about me getting the pink screwdriver at the store "because it's for girls" and I had to set him straight. But oh my fucking god
It is just a color
It is actually a pretty nice color once you get away from it being everywhere and seeing it with other colors.
And idk focusing on the superficial color of sexism doesn't seem like it'll really address the root problem, just opens you up for the problem to get mapped onto a different color
0 notes
i released a book c:
1 note
·
View note
CURB THIS SICKNESS. . . ! — ( SOFT YANDERE!PLAGUE DOCTOR OC X READER. )
#. synopsis! — there's a virus outside that's snuffed out the lights of many. . . and lucian refuses to let you meet such a miserable fate .
#. contains! — f!reader , explicitly nsfw content , multiple orgasms , vaginal fingering , implications of paranoia , cum swallowing , oral sex , cunnilingus , blowjob , vaginal sex , obsessive behavior , frequent usage of endearment terms (love, darling, angel) , missionary position , bathing , established relationship , slight choking , slight hair pulling , creampie , biting .
#. word count! — 5.1k .
#. oc carrd! — click here to find more information on lucian + other original characters of mine that i might write for in the future! xx .
When the virus began to spread in all directions from its alleged location of origin, —you were certain you’d be dead before winter. If not from sickness, then certainly from another disease, or at the hands of some twisted maniac just searching for someone to slaughter that nobody would care enough to miss. You thought it was only a matter of time before you succumbed to hunger or thirst or the changing chill of autumn, or maybe something completely different: but something was bound to happen, and you were sure of it.
And it did. . . But it was nothing like what you had in mind.
Lucian may have seemed like something out of a horror story passed down through generations, still clad in his working attire the night he scooped you up in his arms from a shabby alleyway like a stray kitten, but he was surprisingly gentle (and perhaps unusually quiet.) He wasn’t very talkative, but he cared for you in a way you were completely unaccustomed to, —prepared you a warm meal, brewed you chamomile tea, ran you a hot bath, and gave you a place to sleep for the night. He said you were slightly fevered and a bit malnourished, but all things considered, it could have been worlds worse.
“You’re lucky,” he hummed, a gloved hand smoothing over your jaw, “the pestilence hasn’t taken hold of you.”
Even back then, that wasn’t why you felt lucky. . . No, much to the contrary, you felt lucky because this man had taken you in without expecting anything of you in return, and he sought to keep you safe from the rot of the outside world. Thus, little by little, you stopped caring much about going out there.
His place is a bit quaint for two, but it’s homey, and it smells perpetually of lavender. Over time, he’s shifted the sleeping arrangements, and now you rest in his arms each night; about as close as one can get to being a lover without having the label.
A part of you is sure you could get it if you asked, but to you, it doesn’t matter much. At the end of each day, he comes home to you, and that’s what counts. You take care of the housework while he’s away (not that there’s ever much to do.) For as odd as he is, his living space is free of most things, —no trinkets unrelated to his work (which you are not keen on touching), and he’s meticulous about picking up after himself and keeping all his items in order, so your unofficial duties are few and far between. Otherwise, the rest boils down to cooking meals, washing clothes, and keeping yourself entertained while he’s away. . . Like some kind of glorified trophy wife.
And sure, this will probably get old eventually, but for now, this is what you’re working with. He likes to have you close and to know where you are, —to know that you’re safe and not out getting infected by anyone or anything. If you’re at his home, you’re safe from all the filth of the outside world, and heaven knows it’s so nice to come home and lie next to a body so utterly unmarred by the grime of society.
You’re sure once the virus has stilled, he’ll ease up.
But tonight is not that night. Lucian all but stumbles through the door, and you can hear his rapid breathing through the long, beak-like shape of his mask. He seems startled and frantic, and you rush over, a concerned expression crossing your features.
“Lucian? Are you alright?” You ask, reaching out to put a comforting hand on his shoulder.
In an instant, he snatches your wrist and grabs for the other, holding one in either hand. His grip is fervent, but far from painful, and you become more confused the longer he goes without explaining the state he’s found himself in.
“Lucian—”
“Darling,” he cuts you off, “you mustn’t get near the door.”
“Okay,” you nod in compliance, “but why?”
“The pestilence has taken hold of this city,” he replies. “The air out there, you wouldn’t believe the thickness of that putrid aroma. It’s suffocating.”
Before you can ask if there’s something you can do to quench his worries, he tugs you away from the entrance and into the bathroom. He removes his gloves and sets them aside, reaching down to begin running a warm bath. Then he looks to you, almost expectantly.
“Strip, please,” he encourages, —saying it like he’s desperate for the act, albeit not necessarily under the context you’d prefer of him.
“Lucian—”
“Darling,” he hisses, “please, do as I ask of you.”
His bare hands cup your cheeks.
“Please,” he repeats.
It’s hard to deny him when he asks like that and has been so good to you, and it’s not as if he’s asking for a lot. He’s just having a bad night, and if scrubbing yourself down will help ease his mind a bit, you’re willing to put in that sliver of extra effort for his sake.
Lucian sighs in relief as you begin to disrobe.
“Thank you,” he comments. “I really don’t have a clue what I’d do if you fell ill. . . I don’t think my heart could handle such a thing.”
You slip the last of your clothing off and step gingerly into the filling tub. It’s not long enough to stretch out in, so you bunch yourself up neatly to fit the space and look up at him once more.
“I feel fine,” you assure.
“I’m glad,” he replies. “Even so, it’s much better to air on the side of caution. The human body is a dangerously fickle thing, and it can be incredibly fragile. I’ve seen as much firsthand more times than I can count. In its infancy, this virus is little more than a common cold, but progresses into something fatal at a rapid pace.”
You simply nod as he kneels next to the tub, rolling his sleeves up.
“Your breathing is ragged, Lucian,” you state, “you should take that mask off and get some fresh air.”
“After,” he answers quickly.
He reaches for the half-used lavender soap bar and lathers it on his palms, then reaches out to smooth the suds over your arms and neck. His motions are a little rough and all too urgent. This is far from the first time he’s accompanied you for a bath, but it is the first time he’s ever done so and been this aggressive in his approach (if only as a result of his own anxiety.)
For the time being, he seems to avoid your breasts, instead reaching for one of your legs to hike it up out of the water. He repeats this process with the other, cleaning you until he seems satisfied. When he makes no move to revisit your chest, you take the soap from his hand and lather it yourself, placing it in its previous spot before leaning back slightly and allowing your hands to travel where you’d have liked for his to go.
Lucian watches but doesn’t touch. Your fingertips nudge at your nipples, feeling them harden under the minstrations, your bottom lip slipping between your teeth. If nothing else, he should be getting the hint by now.
Surprisingly, you’ve never had sex with him in all the months you’ve spent curled up in his arms, sleeping in his bed. He’s watched you take care of yourself on a number of occasions, has helped with his fingers another few times, —and allowed you to wrap your hand around him once a few weeks prior; but anything beyond that has seemed to be off limits. You’ve chalked it up to his shyness, or perhaps his distaste for human contact as a result of the pestilence; but tonight feels distinctly different.
Even in his previous state of frazzlement, Lucian seems all too content to sit back and watch you fondle your own breasts, soapy fingers clutching and releasing in tandem. You’ve always liked for him to watch you do things like this. Though his mask obscures the view of his face, you just know his eyes are trained on you, soaking up every movement, and you like to think he’s drooling at the way you grope yourself for his enjoyment (and for your own.)
“Lucian?” You prompt, half-lidded eyes glancing over to him.
His shoulders straighten as you say his name.
“You’re very beautiful,” he says, words almost too muffled by the mask to be made out.
“You think so?” You smirk a bit.
“I do.”
Ah, but that’s nothing new, and it’s nothing he hasn’t shared with you before. On the very night he took you in and washed your hair, he smoothed his gloved hands against your scalp and mumbled about how pretty you looked, even with dirt still caked on your skin. Even covered in filth from the alleyways you’d been sleeping in, he thought you were nothing less than stunning, —a real vision to behold, and he’s never skimped on such compliments.
You pause for a moment, reaching out to grasp for his hands. He allows the gesture, though he seems a bit confused, leaning in closer to the rim of the tub as you position him to your liking.
“Do you think I feel feverish?” You inquire, placing one of his hands on your neck and another on one of your breasts.
He makes no move to pull away, firming his grip up almost instantaneously, as if he’s been itching to feel you this way.
“Perhaps a bit warm,” he mumbles, taking a moment to roll your nipple between two nimble fingers, “but body temperature is known to rise during times of. . .” he trails off, clears his throat, then utters: “arousal.”
You trail your nails down his arm, letting your head tip back again. His hands are a bit calloused, but they feel so good against your skin, and you let a few moans slip past your lips. It’s not often he touches you like this without his gloves on, but the flesh-on-flesh contact is electrifying.
“Not to worry you, but I do feel a bit strange,” you huff slightly.
Through the slightly tinted bath water, Lucian can still watch your hand as it travels between your thighs.
“I’m just a throbbing mess,” you hum, giving him a pointed stare; “but you’ll take care of me. . . Right, Doctor?”
It may just be your imagination, but you could swear you heard his breathing shudder at that request. You’ve never been this forward with him, but something apart from the facial expression that’s still hidden away tells you that he likes where this is going. His fingers clamp down on the column of your throat, squeezing just enough to make taking in air a bit more of a struggle, but not anywhere near hard enough to be fatal.
The bit about being a throbbing mess was by no means an exaggeration on your part, so you take matters into your own fingers for the time being, drawing circles on your clit beneath the water.
“Of course,” he finally finds the voice to agree, “—I’d do anything to keep you from feeling unwell.”
That is what you like to hear.
“Anything?”
“Anything.”
His grip tightens on your throat again, for emphasis, and with that, he seems to come slightly undone.
“Darling, that’s why I’ve demanded you stay here in my home, —our home. It’s safe here, free of contaminants and filth and anything that could cause you harm,” he says, the words spilling out like he’s been holding them back since he first set his sights on you.
“The world outside is ill, not just this rotten city. I’m working tirelessly to combat this pestilence, but as things stand now, the safest place you can be is here. With me. You understand that, my love. . . Don’t you?”
You’re only half listening, but you nod in agreement anyway. Whatever he’s saying, you trust his opinion on the matter.
“Of course,” you gasp, almost slipping a finger inside yourself to the tune of his melodic voice.
“I knew you would,” he continues, loosening the grip on your neck again. “You know I only want what’s best for you, that everything I do is to ensure your safety, —to eliminate the possibility of you ever falling sick.”
“Of course,” you repeat, head growing cloudier by the minute. “You’ve always taken such good care of me, right from the very beginning.”
God, he’s so elated that you’re seeing things his way. The way this makes him feel is almost too much to handle.
“I try so hard, darling, I truly do,” he says, both hands coming up to cup your cheeks.
“Please, Lucian,” you mumble desperately, “I need you tonight.”
He complies, shedding his long coat and draping it over your shoulders once you’ve stepped out of the tub. The chill of the air against your wet skin leaves your nipples hard and sensitive, and as he leads you to the bedroom, you hope he realizes just what it is you’re asking for. His fingers are a plentiful start, and you just know they’ll feel so good stuffed inside you, curling to hit all the right places, —but they’re nothing compared to the cock he’s stingily hidden away for all this time.
Tonight, you want him in all his glory in the glow of the lanterns on the walls. You want to strip him bare and gag on the length between his thighs, feel him twitch against the roof of your mouth, tease every vein that runs up his shaft. It’s not enough to grind against him while you’re half asleep or hump his clothed thigh until you’ve left his pants damp and your pussy sopping, just begging to be fucked by this man who might just love you more than he could ever fear any virus that lurks outside these walls.
“Don’t fret,” he tells you, though it sounds more like a command than a gesture to soothe any worries, “just lie back. I’ll be sure to give you. . . A proper examination.”
You could cum just hearing that.
With half your body pressed against the headboard and his coat nearly slipping off your body completely, he sets to work in his underclothes and mask. It’s by no means an uncommon sight, but there’s something distinct about him this late evening; the way his black attire contrasts so beautifully with the stark paleness of his skin and the mystery it shrouds him in that you’re just dying to sink your teeth into. Everything hidden beneath that cautious wardrobe and that long mask. . . You’ve gotta have it. It’s a necessity.
His fingers, ungloved, begin softly with your calves, tracing senseless lines.
“I’m not so fragile,” you remind him.
For as oblivious as he can be, Lucian takes the hint, and by the time he’s reached your thighs, he’s content to give them the same treatment as your throat.
The way he splits you apart is almost painfully clinical, a thumb on either side of your lips, peering through the eye holes of his mask to admire the way your folds glisten in the orange lantern light. A few prodding strokes leave you biting your lip again, body waning in anticipation for the moment he finally turns his hand over and sinks the longest of his fingers inside you, —slowly, but deliberately. It’s impossible to see his expression, but you hope his mouth hangs open a little at the way your cunt suckles on his finger, encouraging him to prod more and maybe stuff another few inside for you to grind against.
There’s something about the warmth of his fingers that gets you off almost in equal amounts to the way he moves. Another finger inside, and you whine, halfway to an orgasm from this alone.
He’s not particulary rough in his execution, but there’s a clean meticulousness in every movement that leaves every cell in your body craving more, begging for anything he can offer. Months upon months of wanting, of dropping hints, of hoping he’d catch on and finally see things your way, —and at last, you’ve made it. And now that you’re here, you’re content to simply lie still and let him have his way with you.
“Please don’t stop,” you beg, nearly choking on the words when the tips of his fingers brush just the right spot.
“Before you’re satisfied?” He sits forward a bit, resting his free hand on your stomach to press you down onto the bed. “Darling, I couldn’t fathom it.”
You will your upper body forward, grabbing for the hand on your stomach to move it up to your throat. He squeezes, scissoring the fingers inside you, watching closely as your body shakes and your eyes roll back a bit in ecstasy.
“I’ve tried,” he says to you suddenly. “I’ve tried so desperately to be gentle with you.”
You smile.
“I appreciate that,” you answer. “But I don’t want you to be gentle at the moment.”
“That’s a dangerous request, my love,” he warns.
God, you hope so.
You reach forward and grab at the beak of his mask, pulling it upward gently until it begins to slip off and reveal the handsome face underneath. Dark hair, dark eyes, but skin almost pale enough to be sickly, you meet his gaze just long enough to ask for permission, then lean in to kiss him on the mouth. It’s the first time, and it’s electric. He’s avoided this for months, —avoided your mouth, your unspoken pleas, all the passes you made for the sake of keeping himself at bay. But here you are now with two of his fingers stuffed inside you, his hand on your throat, and your lips slotted against his own.
“Please,” you murmur, fingers clutching at the fabric of his shirt.
And you can feel the restraints of his mind come unwound.
He’s no longer gentle in the way he fucks you silly with his fingers, hammering them over and over and over again into that delicious spot buried deep inside you, squeezing your throat hard enough to cut your breathing off. The way your pussy spasms as you cum is blissful, and he loves the way your arousal soaks his digits, loves the way your back arches, soundless moans spilling forth as he makes you orgasm.
“I fucking tried,” he says again.
It’s almost manic, so desperate and sort of pathetic in the kind of way that turns you on. This is the first time you’ve ever heard him curse, and it dawns on you that even the filthiest of words sound so unendingly elegant when they’re spoken by Lucian.
“I tried to be gentle. I tried to keep you safe here, —to shelter you from whatever forsaken wasteland remains out there,” he insists, his fingers still buried in your twitching cunt. “I just wanted to protect you.”
He lightens the grip on your throat as you lean in to kiss him again, cupping his face in your hands.
“You have,” you assure him.
“You take such good care of me, Lucian,” you mumble into his ear. “Let me show you how grateful I am.”
The fingers stuffed inside you slowly slip out, and reach for his hand, guiding them to your lips, taking his digits into your mouth to taste yourself on them. He watches with hunger and interest as you clean him with your tongue. He leans in to kiss you to get a taste of it himself, grasping your hair near the scalp and taking a fistful hard enough to make you gasp.
“I can’t let you leave,” he murmurs. “It’s not safe out there. When this pestilence has been subdued, I’ll do this all correctly. We can start from the beginning, and I’ll be a gentleman.”
“I look forward to it,” you answer softly.
“You’ll stay until then?” He inquires.
He’s clearly overreacting, but it’s hard to care when you just want him inside you. Lucian has seen death day in and day out, —so it’s no wonder it feels like it permeates everything around him. He just doesn’t want you to suffer such a fate, and you’re confident that you won’t, as long as he’s yours.
“Of course I will,” you answer.
It’s like something primal takes over. Suddenly his lips are on yours in a bruising kiss, and his hands are grasping roughly at your breasts, pushing you down onto the bed as he crawls between your legs. He pauses, hovering just above your dripping cunt, turning his head to sink his teeth into the meat of your thigh. It makes you squeal a bit, and he kisses the teethmarks he left behind as if in apology.
You can’t help but wonder how long he’s been yearning for this. It’s like every part of him is thrumming from the thrill of it all, and this man who has previously refused to even kiss you on the mouth is now stationed exactly where you want him, tongue lolling out to lick a solid stripe up your folds. He laps like a man starved, then spreads you apart with his thumbs to suck your clit mercilessly.
It’s good enough to make your vision go blurry, and you can’t seem to form proper words through the haze. Desperately, your fingers claw at the sheets of this mattress, and he moans against your hot cunt, sending a vibration rippling through your core that makes your back arch on instinct. You mumble something that comes out like gibberish, pussy convulsing against the flat of his tongue.
His arm comes round to press your hips down, forcing you to be still. It’s the kind of toruture you’re sure you’ll learn to live for. There’s only so much you can wriggle under his arm, which has a surprising amount of force despite his rather lanky stature.
From what little friction you manage as you attempt to grind against his tongue, you tip yourself over the edge and as the knot in your stomach unties for the second time tonight, he continues licking, lapping at the juices that spill forth.
He stands and reaches for the top button of his shirt, not bothering to wipe his face, chin and lips glistening with your aftermath. You watch him undress with lustful eyes, propping yourself up on your elbow, then slinking back against the headboard once again, resting your weary body against it. The quiver of your thighs doesn’t stop you from nudging at your swollen clit.
“I wanted to be a gentleman,” he comments, untucking the shirt from his pants and pulling the front open.
It’s not skin you haven’t seen before. In fact, you’ve seen every inch of him at one point or another; just never all at once, and now, you’re waiting with bated breath to see him completely exposed for your eyes only.
“I truly did. I wanted to give you comfort and security, —to love you as you deserve. And I knew from the moment I saw you that only I could give you exactly what you’ve always needed.”
You hum in acknowledgement as he continues to strip himself bare.
“But it’s so clear to me now that I’ve neglected you,” he continues. “This beautifully desperate display is all a result of my negligence. . . I failed to realize just how much you needed me like this. How much you needed the touch of a man. . .”
He sounds apologetic, but your eyes are fixated on his half-hard cock. The last time you saw it, he asked that you keep your mouth away; insisting it wasn’t sanitary to use it for such purposes, terrified that you might contract some sort of illness if you sucked his dick for the sheer enjoyment of doing so. This time, however, you have a feeling you’re well past that.
To test the waters, you let your hand fall away from your cunt, slipping off the side of the bed to kneel before him. He gazes down at you as you open your lips and let your tongue fall out, encouraging him to make what he will of it.
“My love,” he says, placing four fingers under your chin to rest his thumb against your tongue for a moment, “—I’ll make everything up to you. . .”
His free hand pumps his cock once, twice, thrice, —then he places it gently on the flat of your tongue, letting you feel the weight and the warmth of it. He sighs.
“Darling,” he groans, “ah. . .”
It takes very little for him to come close to cumming in your mouth, just a few minutes of sucking him off, listening to him moan, feeling him quiver at your touch. You hum with his member stuffed down your throat, and he cants his hips reflexively, an orgasm bubbling up beneath his skin.
Your non-dominant hand holds his cock steady while the other is stuck between your thighs, rubbing furiously at your clit, making you whimper along his shaft. When he notices, Lucian finds that wholly unacceptable and snatches you up to position you on the edge of the bed, relieving the pressure on your aching knees. You weren’t down there for long, but kneeling was hardly comfortable on the hard floor.
He spreads your thighs apart and smacks the pads of his fingers against your slit.
Whatever he’s doing, you’re sure you’ll enjoy it to the fullest, so you occupy yourself with his cock again from this new angle, bending awkwardly to mouth at the reddened tip. His fingers find their way inside you once more, working their delicate magic, brushing against all the right places. At this point, you’re more desperate for his dick to slip inside you like this, but you take what he offers in stride (and more of him into your mouth in the process.)
He’s vocal, and that’s utterly divine. His gravely moans and the pump of his fingers leave you cumming for a third time before his first orgasm arises, depositing a sizable amount of his seed into your mouth.
“I love you,” he huffs, —and if he were anyone else, you’d be certain it was just the oral sex talking, but no. . . Lucian wouldn’t have said it if he didn’t mean it.
Of course, he’s made similar confessions over the months, and has certainly treated you like it long before he ever expressed it so directly, but still. . . It feels nice to hear it, if nothing else.
“I love you too,” you answer honestly, urging him closer with your arms wrapped around his neck. “I’m yours tonight, completely. . . If you’ll have me. . .”
“Oh, darling, don’t be foolish,” he remarks, kissing you deeply. “You’ve been mine since the moment we met.”
Your back to the cool sheets, he lingers over you now, his shadow looming over you so monstrously. There’s a stark flush of red on his face that has begun to spread down the length of his neck, and one of his hands finds its way to your breasts as the other smoothes across your thigh. The head of his cock kisses your sopping entrance, sending a series of chills from the top of your spine to the bottom.
His breath on your neck makes your chest tighten, and he finds your lips with his own again as he sinks inside you, filling you up.
“Lucian,” you whimper, helpless to his touch as he pauses, buried down to the hilt inside your cunt.
He presses a few gentle kisses to your throat, murmuring something about how nice it feels to be stuffed inside you. He feels your nails dig into his shoulders as you adjust to his intrusion.
“You must understand by now,” he says, mumbling the words right next to your bitten earlobe. “Everything I do is for you.”
“I do,” you gasp slightly.
As he begins to move, your walls clench around him, and he exhales deeply against the junction of your neck and shoulder. You roll your hips to match his pace, but as he goes faster, that becomes fruitless. Eventually, you resign yourself to the fate of lying there against the pillows, speared on his cock, him making a mess of you as you moan uncontrollably.
This was everything you’d been hoping for and then some, like some erotic dream come to life. Lucian’s lips travel where they please, —stopping to peck at your jaw, then to suck on your throat. Your breathing is haggard, and he smooths a hand down your side, resting it against your hip for a moment.
“Just a little more,” he whispers, as if to be reassuring.
“Just look how stunning you are, angel,” he murmurs, “how pretty you look like this.”
He kisses you once more.
“You take this so well, like your body was made for me.”
You’re delirious enough to believe that might be the case.
His cock pounds a little harder, and he hits the perfect spot, tearing a desperate yelp from your throat. You’re overstimulated and weak, but your high is itching just under your skin, and you couldn’t bear to see it disappear.
“Please,” you whimper to him, completely at his mercy, “—please, I’m so close.”
He loves the desperation that clings to your voice. The hand on your hip travels to your clit, pressing roughly against the abused little button, making you jerk slightly. He rubs a few heavy circles against it, and you come undone, cunt spasming around his cock as he chases his own release inside you.
Lucian is sloppy near the end, which may just be the only time you’ve ever known him to not be perfectly calculated and precise. His breath hits your neck again, over and over as he huffs through the hunt, finally sinking his teeth in when he comes to a finish. His cum sits hot inside your cunt, and he catches his breath for a moment, head resting against your throat.
“I apologize,” he utters. “I hope that wasn’t too much for you.”
You exhale slowly, his cock still buried in your heat.
“Don’t apologize,” you murmur, “I enjoyed myself.”
You feel him smile against your neck.
“I’m glad, darling.”
For the first time, he sleeps next to you without clothing, letting you touch every part of him, tangling your limbs together. Your face buried in the crook of his neck, breath fanning softly against him, as close to sleep as you can manage without tumbling over the precipice, Lucian reaches for his long coat and drapes it over your body, holding you closer.
5K notes
·
View notes
also a special shoutout for real like wendy epic ableism moments when she stops talking directly to winston and expresses this is b/c he communicates too incorrectly (here too literally or whatever, once again whether he misinterpreted her or she misinterpreted him, it's put on him) and thus he doesn't deserve that
10 notes
·
View notes
make it cute | jeon jungkook
title: make it cute
pairing: jeon jungkook x (f)reader
genre/rating: smut, pwp, 18+
summary: if jungkook loans someone money, he expects to be paid with just that. but tonight, he just might make an exception.
wc: 1.5k
warnings: infidelity, swearing, mentions ransoms and everything that comes with that (threats, m*rder, etc), pictures??, consensual g*n play (more like oral but yeah), sloppy bl*wjob/deep throating, consent bc it’s sexy, pet names, degradation, m*sturbation, facial c*m shot, dirty talk, slight power play, obedience kink, hair pulling, face f*cking, unedited, that should be all
release date: march 15th, 2024; 10:55pm est
note: idk why or how i came up with this trash lol. i was bored and wanted to take a break from writing my other stuff. i hope you enjoy. divider by cafekitsune.
inbox | m.list | join my taglist | read on ao3
“Keep going until I tell you to stop.”
Jungkook can feel his pants getting tighter with each second he stands there watching you slurp on the barrel of his gun. He’s done some sick shit in his life, but this—this was your idea.
“You’re deadass enjoying this, aren’t you?”
He can tell by how you’re rubbing your clit and pinching your stiff nipples.
“M-Mhm,” you choke out a moan as you devour the cold steel buried in your throat.
He can’t lie and say he isn’t impressed, or turned on. But this is strictly business. Your darling husband owes him a lot of money, and he’s going to pay it if he wants his little trophy home by dinner.
Otherwise, he’d be glad to keep you here in his bedroom.
With an ass like yours, Jungkook wouldn’t let you out of his sight if you were his. You’d be on his lap no matter the time or the place. You don’t let this kind of pussy off the leash in this world. This guy’s an idiot.
He can only imagine what those soft lips would look like wrapped around his dick. He’s twitching at the thought of it.
As if you are reading his mind, your hand leaves your soaking wet panties, and you place it directly on his Armani-covered crotch. A hiss pushes through his clenched teeth, biting back the urge to curse at you for your carelessness.
Your mouth filled to capacity, but he knows what you’re asking for.
“Hey!”
Jungkook isn’t a gentle man, but he’s careful to not snap your neck when he grips your hair and pulls your head back—removing your bruised lips from his gun. Your lungs suddenly become filled with air, leaving you desperate to catch your breath. Your coughs nearly drown out the sound of his own voice.
“Look at me,” he orders, and those blown out watery eyes find his face instantly.
Sexy and obedient. Yeah, he definitely has a problem on his hands.
“Are you sure this is what you want? I just want my money—”
“Fuck my throat.”
“Pardon?”
He heard you. Even though your voice is rough and hoarse, he didn’t miss a beat. He’s just stunned.
“My throat…Shove it down my throat, please.”
Please.
You didn’t have to add that part. He was already getting ready to take his dick out.
“Well, shit.”
Jungkook quickly places his gun on the dresser and starts unbuckling his pants. He steals glances at you waiting patiently on your knees like a good little slut. The sight has him fidgeting like a virgin.
Once he frees himself from the confinement of his trousers, his dick springs out and reveals itself to your expecting eyes. A smirk grows on his face as he watches you gawk over his size. Whatever you were expecting, he’s exceeded that.
“Bit off more than you can chew, huh?”
You seem offended by his assumption. The look you give him says exactly that.
“Not at all,” you reply, adjusting yourself to align with his midsection. “May I?”
He grants you permission to touch, and you waste no time wrapping your smooth hand around him. You stroke it as you marvel over the raised veins that climb up to the reddened tip, licking your lips like you’re sitting before a feast.
“Don’t fuck around, kay? I still got a bullet with your name on it, princess.”
You heed his warning and move closer, sizing him up to see how much you can actually fit in your mouth.
“Sorry,” you whisper, and he shudders.
That manners might get you on the winning team; if you play your cards right.
“No sweat, beautiful. Keep going.”
It’s probably the first time he’s said something that sincere, but honestly, he’s just trying to get gobbled up before he cums all over his freshly waxed floors. His men are probably wondering what the hell is taking so long. For all they know, you had to go to the bathroom.
Jungkook almost yells out when warm wetness surrounds his throbbing dick like a compress. His mind struggles to comprehend what to do. He isn’t sure if he should just let you take over, but he’s not able to thrust even if he wanted to. He can’t move. The way you’re slurping him up, he might even be able to walk after this.
“Easy,” he warns.
You look at him and raise your eyebrow, finally displaying a hint of cockiness.
Jungkook pulls himself together and finds his bearings because there isn’t a chance in hell he’s going to boost your ego anymore than he already has.
“Fine,” he grunts. “You wanna play rough, I’ll teach you.”
His hands venture to the back of your head, giving him full control of your intake. Your eyes stay glued to him as he harshly uses his grip to push your mouth into his swift thrusts. You begin to gag and choke, dripping spit all over his dick and the floor—but he doesn’t mind.
It’s not like he has to clean it up.
“Goddamn. Who’s training this throat, hm?” He buries himself in your throat, making your face collide with his crotch. “Your hubby?”
When he hears your gurgled reply he pulls away and allows you to speak. Through your panting, you give him a solid response. One he’s sure you’ve never shared with your husband.
“I’ll suck him dry every night before I let him cum in me.”
Jungkook nods. “Smart woman.”
But he doesn’t give a shit what you do with that pretty pussy. Right now, your services are needed elsewhere.
“Come here.”
Hopefully, you were able to take a breath because Jungkook’s dick can’t hold back anymore.
You two had a deal, and he’s going to uphold his part as you did yours. You complied, now it’s time to send your sweet husband some face shots so he knows Jungkook isn’t fucking around. It’s been a month since the funds were due.
It’s time to pay up. One way, or another.
“Fuck!”
He curses each time his cock hits the back of your throat, suddenly feeling his muscles tense up from the pressure building inside. The sweat building up on his forehead slowly starts to roll down his face, but he’s too occupied to wipe it off.
Your warmth has him hunched over and leaning on his toes, his mouth in an O-shape as he comes closer to release. While he’s pulling in and out of you, he catches a glimpse of your juicy cunt being filled with your fingers, your body squirming and seeking the same relief he’s chasing.
Both of your moans fill the room as you reach the peak of your highs. Your eyes roll back as your body stiffens. Jungkook knows exactly what’s going on with you, and as you’re riding out the waves of your orgasm, he waits for the perfect moment to pull out and paint you with his seed.
The time comes when you’re no longer able to control your breathing, and you’re desperately looking for air after you’ve finally come down. It’s not a second too soon because Jungkook cannot bear another dive into your wet mouth.
He removes his dick and gives it a couple of quick strokes before his cum begins to squirt all over your pretty face. You sigh delightfully as he covers you with a warm blanket of his cum.
It’s everywhere, but he kept his promise and didn’t get any in your hair.
“Ready?” Jungkook asks, still out of breath.
“I am.”
Jungkook slips his phone out of his back pocket and finds his camera. He positions it in front of your face, and he’s amused by your exhausted smile.
“Is my hair okay?” you ask him, and this time he actually has to chuckle.
Since you’ve made his night a little better, he does a quick job smoothing down flyaways and kinks. Honestly, he didn’t have to because you look hot already. Hair messy, tits out, with his kids all over your face and the expensive diamond necklace your husband bought you.
He can’t think of a more perfect image.
You pose provocatively as he takes a few pictures, and when he’s done, he finally guides you to the bathroom. He instructed you to take your time and take as long as you need to freshen up while he sits on the bed to make this official.
He opens his messages and finds the contact he’s searching for within a minute. A mischievous grin slowly begins to form on his face as he taps the latest images in his camera roll, sending his debtor a little message to stir the pot.
03:14 am Sent: img.788, img.789….
03:14 am Sent: at the spot fucking your bitch. bring my money and i might let you borrow her again.
He’s lying. You’re staying right here, or you can join your husband in the little bed his men made for him.
2K notes
·
View notes
I realized Steve is absolutely that kid whose parents put him through piano lessons solely so they could have another way to show off at parties and shit. And then that thought morphed into a little Steddie plot bunny and here we are lol:
Steve doesn't know it's the last time he'll sit at the grand piano, the last time he'll press down its keys and let music fill the empty room before bleeding out into the empty house.
He doesn't know that when his parents next come home, his mother will notice how horribly out of tune the instrument is. He doesn't know that it will be sent off somewhere for repair (his parents won't tell him where, no matter how he asks, and he'll never quite understand why) and lost to him. He doesn't know his parents won't bother buying another one; it was only ever there to impress party guests when Steve sat down and played some Bach. Without those parties, company or otherwise, there's no point in getting another one: both the piano and Steve will have outlived their usefulness.
He doesn't know that he'll be storing away his sheet music, carefully placed into folders and in a waterproof box for safekeeping. He doesn't know that he'll soon become too consumed by high school and dating and monsters to idly write down notes on a staff. He doesn't know that when he's swinging a nail-ridden bat in the future (to destroy monsters, sure, but destruction is destruction, right?) he'll ache with the pain of missing the act of creation as a means of stress relief.
He doesn't know any of that, so Steve sits down at the grand piano with a soft smile, gently trailing his fingers over the keys before lining them up in the Middle C-position. He runs through a few warm-ups, letting muscle memory take him away, so he doesn't have to think. Without another thought, he seamlessly transitions into idly playing, bits and pieces of everything he remembers and songs he's heard blending together.
Mozart's Air morphs into Beethoven's Fur Elise into Queen's Bohemian Rhapsody. It doesn't all sound good together, but that's not the point when Steve plays by himself. All that matters is letting his brain shut off for a bit, letting the notes and echoes mingle together to create something new and joyful.
After two hours on the piano, his wrists are aching; he always forgets to hold them in the proper position when he plays alone. But it's a good ache, one that reminds him of the music still dancing around in his brain.
Steve takes a deep breath and slowly releases it, feeling the last of his tension dissipate. He lets his hands linger on the piano for a little longer before standing and leaving the room, tragically unaware of his imminent and unavoidable loss.
--------
Steve is sprawled across an old couch in Gareth's garage, reading Eddie's well-loved copy of Lord of the Rings. He'd promised to at least give it a go, and he had to admit he was looking forward to finally understanding some of the references Hellfire Club and the kids make. His progress is slow, but he's almost halfway through after two weeks of work. Reading while Corroded Coffin practices helps; the background noise of their music is perfect, letting him ignore all other sounds and focus.
Of course, that's provided they actually play continuously instead of starting the same song over and over only for Eddie to stop them halfway through. When it happens for the sixth time, Eddie growls in frustration, tugging harshly at a lock of hair. "It still sounds wrong!" he cries, dropping into a crouch while cradling his guitar close.
"Stopping us halfway through isn't helping," Gareth points out, idly twirling a drumstick as he watches Eddie's lament.
"Do you know what's wrong yet?" Asher asks.
Steve can longer focus on Lord of the Rings. Instead, he places the book on his chest and looks at the band to watch how this plays out. Eddie scowls and looks up at Asher. "Unfortunately, Ashy Baby, no."
Jeff, meanwhile, has locked eyes with Steve. And because Jeff knows the perfect way to get Eddie off their asses is to get him on Steve's instead, he says, "Why don't you ask Harrington what he thinks?"
Eddie whips around to look at Steve, eyes wide and hopeful. He doesn't even bother standing from his crouch, instead waddling his way over to Steve and testing his ability to hold back laughter at the sheer ridiculousness of the sight. "Stevie, baby, sweetheart, lover boy, please tell me that wonderful brain of yours has an idea so your favorite boyfriend can finish this rocking song."
"You're my only boyfriend."
"Which automatically makes me your favorite," Eddie points out, grinning as he leans closer. With Steve still laying down, Eddie's the perfect height in his crouch to kiss him. He lingers for a few seconds before pulling away, and Steve knows his own smile matches the dopiness of Eddie's.
"Have you considered adding a piano?" Steve asks.
"None of us know how to play," Asher says, and Steve would look at him if Eddie's face and hair and shoulders and everything weren't filling his entire line of sight.
Without thinking, Steve hums and says, "I do."
"Do what?" Eddie asks.
"Know how to play piano."
There's a silence that follows his sentence, one that makes Steve's stomach lurch as he wonders if he's maybe fucked up the shaky peace and friendship he's finally managed to build with the other members of Corroded Coffin. He doesn't know how his words might have done it, but he's scrambling to somehow take them back when Eddie slaps a hand over his mouth, the bands of his rings pressing against Steve's lips.
"Gareth, you still got that keyboard?" he asks, keeping his eyes locked on Steve. There's a light dancing in them like he's just discovered magic is real, like Steve has amazed him beyond imagination.
With a grunt, Gareth gets up from his drums and steps into his house. The rest of them stay in silence while waiting, Eddie refusing to remove his hand no matter how much Steve licks his palm. When he finally gives up and just glares at Eddie, his boyfriend grins brightly back.
"It's a little dusty, but it'll work fine," Gareth says when he comes back, and Eddie finally moves his hand and body, allowing Steve to see Gareth setting up a keyboard a few feet away from his drums.
"Okay, sweetheart," Eddie says, taking the book from Steve and carefully setting it aside before pulling him off the couch, "you've heard the song enough. Play what's missing."
Steve hesitates before walking over to the keyboard. Eddie sticks to him like a shadow, sliding his arms around Steve from behind once he's standing in front of the white and black keys. An odd nervousness churns in Steve, tugging at his spine and making his palms clammy, but he knows it would be much worse without Eddie there. If he had to play in front of the band without feeling like anyone was on his side, he'd probably just throw up instead.
"It, uh, it's been a while," he says quietly, easily falling into the muscle memory of tracing the keys and finding Middle C and dancing his fingers through warm-ups despite his words.
Eddie squeezes him tighter as Jeff asks, "Since you've played? Why?"
Memories of his grand piano rise in Steve unbidden, overwhelming him in a rush of longing for the instrument itself and the relaxation of playing. "My parents paid for lessons and had me play at company parties. They, uh, sent it off to be tuned, but it got damaged, and they didn't get another one."
"That sucks, Stevie," Eddie murmurs, soft and reassuring and Steve suddenly feels far more confident.
He looks up at Jeff. "Can you start playing again?" he asks, flashing a grateful smile when Jeff nods and starts strumming the song's opening notes.
Steve listens closely, breathing in the tune he's heard so many times and letting it take hold. He doesn't allow himself to actually think, letting Jeff's guitar and Eddie's arms and hair and scent drown out everything else. Before he knows it, he's playing a hesitant tune that grows with confidence as he follows the song laid out before him. He's always a measure behind, chasing the guitar's echoing notes as they fade.
He and Jeff make it through the whole song without Eddie telling them to stop. When the final notes of guitar and piano echo together, the latter still chasing the former even at the end, Steve is shaking with excitement and anxiety and grief and joy.
He lets out a slow breath, feeling tension he didn't even realize had lingered for so long finally draining from his shoulders and dissipating. Steve can also feel Eddie's face pressed against his neck, a smile searing into his skin as Eddie squeezes him even tighter.
"I love you so fucking much, Stevie, that's exactly what was missing," Eddie says, his words the only warning he gives before pulling Steve away from the keyboard and off his feet and spinning him around. His surprised yelp quickly morphs into laughter that still lingers even after Eddie has set him down again.
Gareth and Jeff and Asher have already started discussing how the other parts of the song might change with the addition of a keyboard, but Steve is too busy turning in Eddie's arms and kissing his smile away to pay them any mind. He can worry about inevitably being roped into the band's practices later, after he and Eddie are breathless and flushed and smiling bright.
4K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
omggg im craving a halloween themed , rockstar!eddie x shy!reader at a halloween party , matching costumes and everything & he sees a ton of guys hitting on her & is like ???? my baby?
here you go lovie! hope you like it! — eddie takes his girl to a bar on halloween and gets jealous when guys hit on you like you're not already his (shy!reader, rockstar!eddie, established relationship, 1k)
fictober (㇏(•̀ᵥᵥ•́)ノ)
The world didn’t know you before today.
You’ve been just Eddie Spaghetti’s girlfriend for so long — but now you’re Eddie Munson, up-and-coming rockstar and lead of Corroded Coffin’s girlfriend. The title carries a certain weight with it. You wear it with pride, but it weighs you down just the same.
What’s weird about tonight, though, is you’re not sharing Eddie with the rest of the world like you thought you would. He’s having to share you, because everyone and their goddamn brother’s been all over you all night.
Apparently, your coquettish rendition of The Bride of Frankenstein is making everyone else as crazy as it’s making him.
“God, go save your girlfriend, Munson,” Gareth jokes across the booth, laughing into his drink as he watches yet another guy stop you at the bar. “At least one of these assholes is gonna steal her from you.”
“She’s not property, dude. She can’t get stolen,” Jeff scolds from beside him, then flashes Eddie a sheepish glance. “But, yeah, the odds aren’t in your favor, Eds.”
Eddie pays no mind to his friends’ teasing — or the anger swirling like fire in the pit of his stomach.
“Nah. She’s alright…” he mumbles into the rim of his glass. The whiskey burns his throat going down. It doesn’t match the flame rising in his chest at the sight of his precious girl talking to some douchebag dressed like Elvis Presley.
He wouldn’t say it if he didn’t think you weren’t a hundred percent fine. These bozos aren’t trying anything with you — hell, they can barely make conversation with you. You’re just entertaining it because you’re the sweetest thing on the earth.
It’s laughable more than anything.
He’s humored by it all. Not jealous. Definitely not jealous.
“Yeah, who’s the famous one here, again?” Jeff’s girlfriend jokes. She’d left to go to the bathroom with you but came back alone when you got stuck with dollar-store Elvis. She points to the rest of them with a long, manicured finger. “It’s you guys, right? Because I can’t really tell.”
“Fuck off…” Eddie grouses, forcing a grin while the rest of them laugh.
You return then, with a drink in hand and a frown on your face at the sight of your suddenly grumpy boyfriend. “You okay?” you wonder quietly, smoothing down your skirt when you slide into the booth.
The boy moves over to make room for you. “‘M fine,” he answers with a mumble that makes you assume otherwise.
You reach a hand to his face, smoothing fluffy curls behind his ear. His cheek is warm against your palm. His faded seafoam Frankenstein paint job smears on your wrist.
“‘M sorry for taking so long. Some guy stopped me on the way over. I didn’t wanna be rude.”
Eddie shakes his head. Not a single part of him blamed you.
“It’s okay, babe. Not your fault.”
He’s full-on beaming now. Just because you called that asshole “some guy.” It feels good to hear you say that, to know that that’s all he is to you — just some fuckin’ guy. You won’t remember him later, if you still do even now.
Honestly, you’ll be lucky to remember your own name at the end of tonight.
“He get that drink for you?” Eddie asks, nodding to the frosted glass in your fist.
You shrug. “Yeah. He bought it, but I watched the bartender make it, so it’s fine.”
He nods, proud and sparkling with it. “Good.”
“What is it?” Gareth wonders, squinting across the table.
“An Old-Fashioned.”
“You hate whiskey,” Eddie laughs, licking the alcohol from the plush of his bottom lip.
“Well, yeah, but he asked what I liked, and I didn’t know what to say, so I just told him your favorite drink,” you ramble, all mousy, as you drag the falling sleeve of your corset back up your shoulder.
Your cheeks heat with embarrassment, still a bit overwhelmed by the attention.
Eddie’s grinning something fierce beside you. His chest swells with so much pride he thinks he might burst.
“Aren’t you just the sweetest fuckin’ thing?” he singsongs with a rosy grin, wrapping the ripped sleeve of his arm around your shoulders to pull you closer.
Then he kisses you. Like, really kisses you.
It’s deep and intimate and sloppy. He opens your mouth with his and slithers his tongue inside. He tastes like bitter-sweet alcohol. You get drunk on him accordingly.
The rest of the table gags.
Your lips click audibly when Eddie pulls away. His smile glistens with a mixture of your saliva, lips a deeper shade of pink and slightly swollen. You wipe your chin with the back of your mouth — some of Eddie’s face paint comes with it.
“Where’s he now?” the boy asks with a mischievous squint in his deep chocolate eyes.
You shrug, totally uncaring and just wanting to be kissed. “I dunno.”
“Still at the bar,” Gareth answers for you, snickering to himself. “Giving your girl the sex eyes.”
Your face screws up in disgust. “Sex eyes?” you repeat, nose scrunched.
The group laughs.
“Think you can get him to buy you a round? You know, for the table?” Eddie asks you. His fingers trace shapes on your bare shoulder. You have to fight back a shiver.
“You want me to go talk to him?” you gape, like you must’ve heard him wrong.
“I want you to go get us drinks, sweet thing. Work your magic, you know?”
He’s not in the most right headspace right now. You know this. He’s still high on the post-show adrenaline and mellow on the alcohol. He’s jealous and in love with you and aflame with hatred for bootleg Elvis Presley. He gets rash when he’s raging, risky and unpredictable — a deadly concoction.
“Eds…” you hum quietly, brows scrunched like the idea pains you. “I don’t wanna make you mad…”
“You won’t make me mad, sweet thing,” Eddie assures, squeezing your shoulder. He presses a sanguine peck to your waiting mouth, then his voice gets all low. “Who knows? Maybe I’ll reward you after.”
He smacks one last kiss to your buzzing lips.
You blink at him until your senses return to you. You slide out from the booth and saunter back to Some Guy, who’s seemingly been waiting on your return this whole time.
There’s a sudden sway to your hips now, but it’s not for him.
It’s for Eddie.
The boy with the wild hair back at the booth, missing splotches of his face paint and wearing your lipstick knows this too.
3K notes
·
View notes
"I think they like you." Prompts
“I’m sorry. I know you liked them (too).”
“You should talk to them.” “No. I couldn’t. What would I even say?”
“Clearly they have good taste.”
“Shut up.”
“Please, please, tell me you’re not trying to play matchmaker again. (As much as I love you, you suck at it.)”
“Good. Otherwise, that relationship of ours would be a mistake.”
“Can we not? (I just want to spend the evening with you. No distractions.)”
“No, they don’t.”
“How— How do you figure that?”
“What gave it away? The compliments? The touching? The kiss?”
A freezes. They had hoped nobody would figure out – not yet anyway – that they are in a secret relationship with B. Look natural. Act natural, they tell themselves.
Sighs. “Yeah, I’ve noticed.”
“And you? Do you like me?”
"Not you too." "What?"
“What, you gathered that from a simple ‘Hi’?”
“Maybe.” “You’re not interested?” “They just seem like they are looking for a relationship, and I’m not… I’m not ready for that. Not yet.”
“You think? How can you tell?”
“Stop pulling my leg.”
“You don’t think so?” “… Why would they/someone like them be interested in me of all people? I’m just—”
“This your way of telling me to leave you so you can ‘go on the hunt’ yourself?”
“Too bad I’m interested in someone else.” “Oh?”
“Message received.” “What? What message?”
A asks B if they are interested in person C to see if maybe they themselves (still) have a chance with B/C.
“Are you dumb or are you just pretending to be?” “What?” “You really don’t know?”
“So? I already have everything I need right here.”
Snorts. “What? We’re friends. Just friends.” (“Do they know that?”/”Hm. Sure.”)
1K notes
·
View notes
YOU'RE LOSING ME.
summary: how the love began to die out between you and them. featuring kamisato ayato, alhaitham, diluc, and zhongli. gn! reader (see a/n below) pt. 2 here
w/c: 2.1k words in total
a/n: inspired by the new vault track from midnights by taylor swift. meant to be a gender neutral reader but one of the lyrics i reference uses "her". otherwise, no pronouns used.
And I wouldn’t marry me either, a pathological people pleaser, who only wanted you to see her.
“I’ll be entering an arranged marriage to the daughter of another clan.” Ayato said matter of factly, as if it was as casual as discussing the weather. Today was the off day Ayato had free. He’s been so busy the past month that he barely has time for you. You can’t even remember the last time the two of you woke up together. He always slept late and woke up earlier than you. The affection was rarely there too; The usual loving kisses and cuddles were reduced to pecks on the cheek and pats on the arm. This was one of the rare times you were actually able to sit down with him.
The air was tense, almost impossible to breathe in. What was supposed to be a romantic dinner quickly turned sour the moment Ayato announced a piece of news you never wanted to hear. “I’ll be meeting her in two weeks. I’m expecting the marriage ceremony to take place within the next three months or so.” He wasn’t looking at you, instead more focused on the food in front of him. Your chopsticks fall from your hands, the clatter piercing the silence between you two. Ayato looks at you, completely deadpanned. You take the moment to really, truly look at him. His expression was standoffish, and his eyes were dispassionate. Just where did that loving gaze go? “What?” He asks.
“Ayato, you can’t just expect me to be happy about this.” You huff in frustration, picking up your chopsticks and setting them down in a proper manner. “When you accepted the proposal, did you just forget about our relationship? About me?”
Ayato rolled his eyes and sighed. “You’re acting like I declared undying love for her. I’m simply doing what’s best for the clan, and for Inazuma as a whole.” He puts down his chopsticks as well, clearly not focused on eating anymore. “It’s not like I’m ending things with you. Marrying her opens many opportunities I can’t pass on.”
“You’re not ending things with me, but you’re just gonna go off and marry some girl?” Your heart broke a little more with every word. If someone were to listen closely, they could probably hear each individual crack. “Ayato, our relationship has already been wavering a little…you’re so busy. It’s like you just can’t fit me into your schedule.” Your eyes start to become glossy, and you need to swallow back your tears to fight against them falling. “How can I expect us to stay together when you need to make room for two spouses now? I thought love meant more to you than business did.” Your voice cracked with every syllable that fell from your lips.
Ayato stood up from his seat on the floor, adjusting his sleeves and beginning to make his way to the door. He slides it open before stopping in place. “Marrying her has a lot to offer.” He speaks, but he isn’t even looking at you.
“And I don’t?” You ask. You didn’t even know if you wanted the answer to that. Luckily for you, he didn’t answer at all. He looked back at you from over his shoulder. He takes a breath, and you feel as if he’s stealing the air straight out of your lungs. He turns his head back and sighs. He steps forward, leaving the room.
The door shuts, and you are left in silence.
And I’m fading, thinking: Do something babe, say something.
With Alhaitham being appointed as Acting Grand Sage, it’s only natural that his workload for the Akademiya would increase. However, if there’s one thing that Alhaitham truly hates, it’s when unnecessary work piles up and begins to leak into his personal life, like a bucket overflowing with water. A work-life balance can only go so far before work begins to completely tilt the scale in its favor. Naturally, this takes away from time the two of you could spend together.
Normally, that would be completely fine with you. You knew Alhaitham was a busy man with a busy lifestyle. It’s completely reasonable for him to not throw aside his work just for you. Alhaitham always tries to make time for you, to show you his affection in small ways that don’t take up too much time. Either with tea he makes for you before he leaves for work, small trinkets that begin to appear on your bedside table, or a hushed declaration of love when he accidentally wakes you up when he rises early. But recently, his efforts have been slowly dwindling. You no longer wake up to the smell of tea. You no longer reach over to your nightstand in a sleepy haze, only to feel an object that was not there before. You no longer hear an “I love you” amongst the sound of your bedsheets ruffling in the early hours of the morning.
Of course, you noticed. So you took it amongst yourself to try and do something to express your love. You usually go to sleep before him, but here you are in the living room, waiting for him to return. It’s already quite late, and you fight back a yawn every twenty minutes or so, but you’re determined to stay awake to greet him. The smell of his favorite food wafts in from the kitchen, and you smile while thinking of his reaction. You might not be a Michelin star chef, but you pour love into everything you make him.
Finally, the door opens, and there he is. His eyes are tired, and an annoyed expression is etched onto his face. “Hey, honey.” You shoot up from your seat to greet him at the door. His head snaps in your direction slightly, not expecting you to still be awake. He lets out a little grunt as a response. You can tell he’s in a bad mood, but you keep pushing. “You’re home late.” You state before realizing how you pointed out the painfully obvious.
“I always am.” His voice is monotone, cold. He walks straight past you, barely even sparing you a glance.
Your hope begins to falter, but you try again. “Are you hungry? I made you dinner.” You reach your hand out to lightly touch his. He pulls his hand away with no hesitation. You feel the familiar sting deep in your stomach, and you try your best to ignore it. You clear your throat as if to rid the moment of his past action before speaking again. “Then, maybe we could eat together-”
He groans aloud. “Can you just be quiet?” He snaps. His voice wasn’t angry. It wasn’t filled with love or hate. It was indifference, and in all honesty, that hurt so much more. “I’m exhausted. The last thing I need today is you nagging me.”
You falter, as if you were shrinking away in a desperate attempt to try and disappear. “Right.” Your voice is quiet, meek. “Of course.” You turn away to walk into the kitchen, and you hear your shared bedroom door slam shut. You sit at the dinner table, gazing at the untouched meals on the opposite ends. Your hand moves to touch the spoon and stir it around in the food, but any outsider could tell that you have no intention of eating a single bite.
For the rest of the night, you sit there alone as the food goes cold.
Lose something babe, risk something. (You’re losing me.)
If there’s one thing Diluc strives to do, it’s protect you. He lost his father already, he can’t risk losing you too. It brings him peace to know that you’re safe at Dawn Winery, away from things that can bring you harm. But even though he is protective, it’s not as though he keeps you locked inside the house. He knows of your adventurous spirit and he would never want to hurt you. However, he has a habit of being a little paranoid. The people of Mondstadt are aware of your relationship, but he rarely lets the two of you be seen together. He prefers things quite private, but you’re starting to get a little sick of it.
You just returned from a small commission; it’s been ages since you’ve done one. It felt so refreshing to wield your weapon and go on a mini adventure! Even if it was just a few slimes near Windrise, the experience was one you haven’t had in far too long. You end up with a small cut on your hand, but you look at it in pride as you walk back to the winery. You open the heavy door, and you’re met with the face of your lover.
“Y/N, where were you?” Diluc’s question is loud, his voice laced in concern. A second barely passes, and he’s already by your side. He catches sight of your hand and cages it in his larger ones. “Why is your hand hurt?”
You shake him off lightly, heading to the couch to set your things down. “I took a small commission.” You explain. “Just a little group of slimes. My hand got cut, but I’m okay. Don’t worry about it!” You attempt to reassure him, but the crease in his eyebrows doesn't go away.
“Y/N, how many times have I told you?” Diluc scolded. He folds his arms over his chest. “You don’t need to take commissions. I provide for us enough already.”
Your eyes roll before you can stop them. You can feel your frustration rise inside you. “I didn’t take the commission for the money, Diluc.” You huff at him. “I wanted an adventure, even if it was a small one. It’s the experience I wanted.”
Diluc scoffs. “Oh, so getting hurt is an enjoyable experience for you?” Diluc never had the most friendly tone, but you’d have to be truly clueless to miss the sarcasm weaved into his words.
“By the Seven, Diluc, it was a cut!” You exclaim. “All of this over a cut?”
He looks you in the eyes. “You know I just want you to be safe.”
Your eyes softened slightly, biting your lip. “But Diluc, you play it too safe sometimes.” You grab your weapons and bag again, adjusting your jacket before heading towards the door. Despite just getting home, you felt the need to get away, to cool off. Maybe to kill some other monsters, you weren’t sure.
“Where are you going?” He asks.
“Out.” You respond curtly. You weren’t sure of your destination, but you didn’t care. You just needed to be away from him.
“Y/N-“ He called out. You cut him off by slamming the heavy winery doors.
Choose something babe, I’ve got nothing to believe, unless you’re choosing me.
“I love you.” Zhongli murmured, knuckles turning white with how hard he was gripping his pole arm. He towered over you, who was on the ground in a pool of blood. The metallic smell was hard to ignore. “I love you, I truly do. And I always will.”
You laugh bitterly. “You love me, and you caused my injury.” You use your hand to weakly gesture towards your torso. “Some love you have…”
Zhongli grips his weapon even harder. He digs the heels of his feet into the group as an effort to ground himself. He knew that if he were to take a single step, he’d run to you, and he’s not sure if he can stop himself. He takes a breath to calm himself, and every breath of air he breathes makes him wish he could breathe that same life into you instead. “It’s for my nation.” He says as calmly as he can. Oh, how he wished he could run to you, kiss you, and heal you. He continues with bated breath. “You know I cherish my nation.”
You cough, blood splattering out. “More than you cherish me?” You ask weakly. “More than you cherish us?”
Zhongli’s eyes soften with sadness. “Yes…more than I cherish you, my love.”
You sigh, suddenly feeling the fatigue hit you like a truck. You’re so tired. So, so tired. You voice out your thoughts. “I’m exhausted, Zhongli.” Your voice is weak, along with your body.
“I’m sorry.” He says before facing away from you. He can’t bear to look at you in this state. He can’t bear to see what he’s done to you. He takes slow steps away, using all his willpower to not turn around and run to your side.
“I love you, Zhongli.” You call out.
He takes one final look. “I love you too, dearest.”
A sad, soft smile etches itself onto your face. Your eyelids droop, and eventually, they flutter closed. Zhongli stares at you sadly. His weapon drops to the ground, making a loud clatter. The silence is deafening. He peers at your lifeless body before closing his eyes. “You’ll always be my favorite story.” He whispers.
A single tear falls from his eyes.
5K notes
·
View notes
bring back yan!bully 🙏🙏 i miss him, don't kept him in basement too long, pookie (╥﹏╥) anyway i love you and i hope you have great day/night 💗
-🦈
Yandere! Bully
A/N : Revamped version of my little gremlin Darius💞🐰
T/W : harassment, death threats,possessive behaviour.
«────── « ⋅ʚ💌ɞ⋅ » ──────»
[Name] gripped the strap of their bag tighter in their hand to calm their nerves as they stared at the huge building before them. They had recently moved to another city after their parents had been offered a job opportunity.
They were in an unknown territory, having no knowledge whatsoever of this new place.
"Calm down [Name]. There's nothing for you to be scared of!" [Name] tried to convince themself, rubbing their sweaty palms on their shirt.
Walking inside the building, they were surprised by the spaciousness of the hall. They were expecting a packed hall filled with students around their lockers but were pleasantly surprised to see the opposite.
They could already hear the whispers of the people around them, almost all of them having mentioned about this Darius person. [Name] were intrigued, what kind of a person is this Darius?
[Name] didn't have to wonder for too long as their question was immediately answered by a harsh shove into the lockers.
"Ugh... what the hell?" They groaned as their back stung from the impact.
Looking at the person who were guilty of shoving them, their [E/C] eyes clashed with the vibrant golden irises that narrowed with amusement as if he was a predator watching his helpless prey trying to escape.
"You're a fresh meat. I can tell from how you look like you've lost your mommy in a store" He spat out in a condescending tone.
This must be the Darius the students have spoken about. A total dickhead apparently.
[Name] weren't having it, they're not going to let this man to ruin their first day. They ducked under his arms that was caging them to the lockers and ran away. It's better to walk away than be subjected to whatever the guy was planning to do to them.
Darius blinked, stunned at [Name]'s action. That's it? They don't even spare him a glance──not an ounce of reaction. Annoyance, fear, anger──none!
He was offended by their lack of reaction to him. Darius swore to himself that he'll coax a reaction out of them, be it them screaming into his face or crying.
He'll make sure of it.
«────── « ⋅ʚ💌ɞ⋅ » ──────»
"What's your favourite movie?" Here comes his random trivial question about [Name] of the day.
Eversince their encounter, Darius had become a persistent presence around [Name]. He would throw snarky remarks at them and try to pick on them whenever they would pass him at the halls or god forbid they share a class with him.
After a while though, [Name] noticed that Darius had become genuinely interested in them as a person. He would frequently try to make small talks or asked them trivial questions about them.
" [Favourite Movie]. Why'd you ask? You wanted to take me out?" [Name] teased.
"Yeah I'll take you out──in a fight" Those hint of crimson on his cheeks says otherwise though.
"I don't think s──"
[Name]'s words where abruptly interrupted by an empty can of soda hitting them. They hissed at the impact of the can hitting the back of their head and turned to see the one responsible of throwing it.
Fucking. James.
It seems like someone has decided to take up the role of picking on them since they had 'tame' Darius. The aforementioned man seems to not take kindly to James throwing the can at them.
He stood up from his place beside [Name] and walked towards the table in which the bully-wannabe was sitting, the soda can in hand. [Name] watches James practically paled as Darius stood before him with a menacing smile.
"Here. I think you lost something"
Before James could take it from Darius's hand, his face was smashed by the can of soda, the can denting from the force of the impact.
"You bother [Name] again and I'll have you dead the next day" Darius sneered, each words laced with venom.
[Name] along with the rest of the students who were in the cafeteria were left in shock. The Darius just stood up against a bully?
"Wh──what was that for?" [Name] asked Darius as he took his place beside them again.
He shrugged, stealing a fry from their lunch.
"Making sure everyone knows that you're mine. Only I can pick on you, got that?"
«────── « ⋅ʚ💌ɞ⋅ » ──────»
2K notes
·
View notes