#i hate how kira looks here

[gendergeezer]

teen wolfin

#scott mccall #stiles stilinski #allison argent #lydia martin #isaac lahey #kira yukimura #derek hale #roscoe the jeep #teen wolf #malia tate #my art #i hate how kira looks here #but i redrew her several times #and each time was worse and worse fml

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

[buckybarnesss]

the fact that nobody called Derek out on his sudden "no, no, we shouldn't immediately murder" attitude in season 3B is so funny

Derek killed Peter, Jackson, and wanted to kill Lydia, but when it's Stiles? Nope, suddenly non-violence is the only answer.

it's one of the things i love about 3B so, so, so much.

i think the only people who could reasonably call derek on it would be scott and peter. scott may have noticed but he wouldn't have on this. not when he was desperate. peter sort of did when derek became focused on the chessboard but instead he was kind of helpful about it. perhaps taking a little pity on his nephew.

riddled is such a great episode for various reasons. scott is terrified of what's happening to stiles. the look on his face when isaac suggests after seeing stiles room that it's insanity all but screams scott is thinking about claudia just like the sheriff is. scott may not have known the name of the disease claudia had but he knew enough. it's the first time scott sees the bite as a gift when he all but offers it to stiles. a last resort because they both know stiles really doesn't want it but it's an option and one claudia never had.

but what gets me is scott immediately calls derek. he's scared about stiles's wellbeing. scott hates involving derek in things and usually only contacts him as a last resort but not here.

scott may willfully put his fingers in his ears and close his eyes to the stiles and derek dynamic but we spent time on him realizing that stiles and derek made friends without him in 3A.

so he calls derek knowing derek will help.

derek is the most transparent we ever see him in 3B. derek enjoys having a certain amount of mystery about him with scott and company. he likes his local cryptid status with them. keeps them on their toes.

like yeah derek mellowed somewhat in season 3 but when stiles is in danger all his known methods and strategies go out the window.

he's teaching chemosignals to scott. he's revealing he knows stiles by scent well enough to be able to tell that stiles was having a fight with himself. he's purposefully seeking out argent to gauge how much of a threat he is to stiles.

he investigates what happened on the night with barrow and even takes kira along for the investigation. same guy who saw lydia was immune to a werewolf bite and went "yep absolutely the kanima gotta kill her" instead of looking for other reasons.

this man doesn't even investigate himself when he's losing his powers the next season. derek baby what you doing?

the nogitsune so called him out this by using his loft as essentially a safe place to hide from the oni. it purposefully used derek as protection right beside the sheriff because neither of them could kill stiles and it knew that.

stiles spent 2.5 seasons gaining derek's trust. stiles is the one who learns about derek's past and checks on his wellbeing. stiles is the one who makes an effort to understand him. the only two people we ever see offer derek comfort are stiles and cora.

stiles earned derek's trust so much by this point not only would derek do just about anything to protect stiles but stiles became his anchor.

the derek hale committee for the protection and safety of stiles stilinski founded 2011.

#my blog #thoughts on teen wolf #teen wolf #sterek

[petit-etoile]

Astarion goes to the cat shelter to get a sibling for His Majesty, Tav is the worker who helps him out and it’s history from there

cat  &  mouse  ( back  &  forth )

pairing: astarion/tav wordcount: 2,505 content warnings: set in baldur's gate but i mention designer brands, other than that,  nothing other tags: alternate universe - modern setting, pre-relationship, developing relationship, getting together, fluff, astarion is rich, gender neutral tav archiveofourown: here.

tag list: @azrielshadows1nger, @pandimoostuff, @faevi, @microskies, @foreverthemaraudersera, @queenofthespacesquids, @claryvoyantfray, @6doodlaang14, @anne-isnotokay, @itshimbotime, @yeeteth-the-raven, @sessils,@8-opossums, @worryknotdear, @abirdaboxandachippedcup, @ghosts-and-ink, @b4um3pfl4um3, @gunslingerorchid, @hypopxia,  @m0ssytrees, @erysione, @odette-attackattack, @catching-fire-in-the-wind, @ashrio20, @wills-mental-illness, @queenofcarrotflowers-s be added to the taglist here

summary:  ‘But you see, I travel for business and His Majesty holds grudges,’ Astarion explains. ‘If I leave him with a sitter, he’s a true terror. If I leave him alone, he eats my Brunello Cucinelli cashmere!’

‘Hello! Is there anything I can help you with?’

The man is currently kneeling down, humming to himself, while he looks between a bundle of elderly cats and his phone. You’re surprised. Normally people who come to the shelter are looking for kittens as presents, but the sight of him giving attention to anything but kittens makes you feel better about his intentions. He looks at you, startled by the sound of your voice. His phone clammers to the ground.

‘Oh my gods, I’m so sorry!’ you say frantically. ‘I didn’t mean to startle you!’

‘  — my gods, no, I mean it’s quite alright, heavens above,’ he breathes out. He drapes a hand over his heart dramatically. ‘Perhaps you should wear a bell around your ankle. You’re…horrifically quiet.’

He huffs out a sigh of relief before picking his phone back up. He stands up, knees creaking as he does so, and shows you his screen. Thankfully, it’s free of cracks.

‘I’m looking for a companion for His Majesty,’ the man explains.

The picture he shows you is an offensively hairless cat who seems to be somewhat older as well, though it’s hard to tell due to all his natural wrinkles. You’re not sure how it’s possible, but the cat seems to be judging you through the phone. You once heard Mr. Withers say that all pets take after their pet owners' looks, and when you glance at the man before you, you can kind of see it. He’s not hairless by any means but he certainly looks at you with an air of accidental arrogance, and that makes you nervous.

‘What a cute cat!’ you say instead.

‘His Majesty is rather adorable,’ the man agrees. ‘Oh gods, I just realized he isn’t even wearing a sweater in this photo… Please look away, he is indecently exposed!’

You laugh, covering your mouth and closing your eyes as instructed. You can hear him frantically scroll through his camera roll for a picture of His Majesty that would have all his hairlessness expertly covered.

The next photograph you’re allowed to see of His Majesty shows the sphynx cat in an adorable sweater which matches the sweater his owner is wearing. Seeing the two side by side confirms your earlier suspicions. They seem to belong together. Smug, but not as if it isn’t warranted, and proud, like their happiness is something they’ve earned. You hum, nodding.

‘But you see, I travel for business and His Majesty holds grudges,’ the man explains. ‘If I leave him with a sitter, he’s a true terror. If I leave him alone, he eats my Brunello Cucinelli cashmere!’

‘He definitely sounds like he needs a friend!’ you agree.

‘But he hates kids,’ the man stresses, sniffing delicately. ‘So I doubt kittens would fare any better. He bit my sister’s niece once.’

‘I see, I see,’ you say, trying not to laugh. ‘We have a few cats here that I think could be a good companion. Right here is Kira and she’s quite the refined lady. I think she likes to gossip.’

‘Oh my,’ the man says. ‘She would fit right in.’

‘But there’s also Myshka. He’s a bit more playful, but he has gorgeous eyes,’ you say.

You kneel down where the man was sitting before, gesturing between the two cats you pointed out. Kira frowns at you disapprovingly, and Myshka continues to chirp happily. The man gasps at the adorableness and wiggles his fingers in front of the kennels. Myshka shouts like you’ve never heard him shout and bounces, shoving his nose against the doors and sniffing aggressively. He’s perhaps the least ‘civilized’ cat you have at the entire shelter, but from the way the man’s eyes light up, you wouldn’t even know it. Part of you is thankful. Myshka deserved a good home.

‘Ugh, he’s perfect,’ the man says.

‘He isn’t as old as some of the other cats, but most people overlook him because he isn’t a kitten,’ you explain. You wiggle your fingers too and Myshka forgets about the man and starts yelling at you instead. ‘He’s a little odd but I’d take him home in a heartbeat if I could.’

‘Oh? You want him too?’

‘Yeah, but my home is a bit busy,’ you say with a shrug. ‘I have a cute dog named Scratch, who is a rescue, and I’m currently helping rehabilitate a baby owlbear.’

‘A baby owlbear!’

‘Yeah! Do you want to see some photos too?’

The man grins crookedly. He’s so handsome it makes your heart stutter. You look away from him and focus on fishing your phone out of your back pocket. You find your photo album titled ♡ family ♡. You show him Scratch first. He coos over the dog, pointing out how pretty his coat is. You purple shampoo it every once in a while so that it stays sparkling and shiny and white. Compared to what Scratch looked like before, he’s so happy now.

It only goes up from there when you show the man the picture of the baby owlbear. He’s so chubby it’s cute with big, hopeful eyes. You tell the man about how Jaheira had found him one night in the woods and how you were the first person she thought of to help rehabilitate him. That seems to earn you some recognition. He looks at you like he’s really taking in the look of you.

‘You may as well be an angel in disguise,’ he says approvingly. ‘Although… Jaheira… I think I know her.’

‘You might! She owns the rescue.’

‘I think I took on a case for her once,’ the man muses, rubbing at his chin. ‘Yes, that sounds more like it. If you know Jaheira, then you must be a phenomenal person.’

You laugh nervously. Now he’s just flattering you, you’re sure of it. Either way, you try to change the subject as quickly as possible before your nerves get the better of you.

‘Mm, yes, I think I’ll take this one,’ he says, referring to Myshka. ‘But no need to put him in one of those awful boxes. I have a Prada carrier in my car. If you’ll only give me a moment.’

Prada… Brunello Cucinelli… You almost wish you were Myshka instead!

Still, now that you watch him go in and out, everything starts to add up. He’s an expensive magistrate with expensive cat carriers and expensive cats… You stare agape as Astarion Ancunin walks back in with his bright red Prada bag and offers it to you. He smiles once you realize who he is. The awe must show on your face. Not that it matters, he’s here to get a cat and you happen to have been one of the only ones working today, but you still feel ridiculously honored. Without saying anything, you coax Myshka into the bag and show Astarion the way to the counter so that he can pay.

“We take cash…or credit…’ you say faintly. ‘Or checks…’

‘Cash will have to do,’ Astarion says with a shrug. ‘Anything for little Myshka. What a little baby!’

You don’t even know what to say half the time, busy trying to get the paperwork together and not stare. It seems like Astarion has hit all your weaknesses in one go. Attractive, loves animals, adopts and doesn’t shop, and goes out of his way to wear ugly matching sweaters with his cat. You ring him up as slowly as you can out of your own desire to stare at him more, and then once everything is signed and paid for, you reluctantly slide Myshka’s carrier forward. You don’t mean to pout. You can’t really help it.

‘You’ll tell Jaheira I stopped by, won’t you?’ Astarion asks casually. He’s running his fingers over the zipper of his carrier instead of picking his new cat up. ‘We used to get into trouble together back in the day.’

‘You know,’ you say conspiratorially, ‘we’re actually having a bonfire out at my place this weekend. It’s a little bit out of the city, but Jaheira will be there. She’s bringing kidney pie.’ You leave out the part where it’s supposed to be an employee’s only bonfire.

‘It does sound phenomenal,’ Astarion hums. ‘Give me the address. I’d love to drop by. You can leave your phone number too if you’d like.’

It goes without saying that for the next three days, you do nothing besides prepare for the bonfire, go to work, and text Astarion. He sends you updates about his new family  —  Myshka is freshly spoiled with a Louis Vuitton collar, His Majesty wears a new Gucci sweater that matches Astarion’s, and Astarion himself takes ridiculous selfies at bad angles while looking ridiculously attractive. It’s almost unfair. 

Sometimes you send him pictures of Scratch chewing on his favorite toy, but mostly, Astarion seems to enjoy videos of the baby owlbear sitting in the silliest ways possible. You managed to get him to wear a hat one day and Astarion was so delighted by it he allegedly set it as his homescreen.

You’re the only one not surprised when Astarion shows up to your humble farm in his Mercedes-Benz. You might have forgotten to tell Jaheira about it. Everyone crowds around you instead of the bonfire trying to get a peek at the hot-shot magistrate, but if the attention was overwhelming, Astarion says nothing. He strolls in carrying a pot of something that Gale immediately begins fussing over. Now with empty hands, Astarion throws his arms around Jaheira and kisses her cheeks over and over. It’s lovely.

Astarion begins fussing over Scratch as though he were an old friend after that. Scratch has brought over his ball to play, and even though it’s covered in spit and roughly three years old, Astarion delights in playing fetch. You sneakily grab a plate of kidney pie to feed Scratch and sit on the ground so you can watch them play games. At one point, Scratch refuses to bring Astarion the ball and makes the elf chase him around the yard. When he’s done, Astarion sits next to you laughing and gasping for air.

He helps you feed Scratch the meaty bits from the pie, cooing all the while. ‘What a delightful beast!’ he says.

‘He really gave you a run for your money for a moment, didn’t he?’ you tease.

‘Well, he has two more legs than I do,’ Astarion snorts, sniffing delicately. ‘It’s only fair he wins.’

It makes you laugh more than it should, and you wipe the leftover pie crust and juices on your jeans before standing up. You’re surprised when Astarion does the same on his jeans, but he laughs at your expression and follows suit.

‘Do you  —  Do you want to see him?’ you ask.

‘See who  —  ’ Astarion’s eyes widen immediately. ‘The owlbear! The baby! Oh please, you must let me see him, darling. What a delight!’

‘I must warn you,’ you tell him, leaning forward like it’s a secret. ‘He may be asleep. And he’s extremely cuddly. Beware the claws.’

‘Beware the claws, yes, yes,’ Astarion repeats, waving his hand impatiently. ‘Let me see the little man!’

You lead Astarion away from the bonfire and everyone else to a quieter, fenced off part of your property. You had it passed down to you from your grandfather who wasn’t deceased as much as he was that much of a recluse who decided Baldur’s Gate was becoming too large. Inside, tucked into a cute little bed, was the baby owlbear who had picked up the habit of snoring from Scratch.

Everyone else liked the baby owlbear as well, but you weren’t expecting Astarion to gush at the sight of him. You lead him into the enclosure and very carefully sat next to the owlbear. As if trained to do so, he wakes up and blinks his large orange orbs at Astarion inquisitively.

‘Do you want to hold him?’ you ask.

Astarion almost quivers at the idea.

‘You have to be really careful!’ you tell him, probably for the hundredth time. ‘He’s just a baby so he can’t control his strength yet. He has big boy paws. They hurt if he smacks you in the face by accident.’

Astarion is the picture of serenity. He sits, cross legged, and waits for you to slowly coax the baby owlbear into his lap. He’s clearly delighted by the whole thing, visibly trembling, and watching the owlbear with the kind of reverence you only see at a temple. Astarion sits very patiently and gently pets the top of the owlbear’s head, and it only takes a minute or two for the baby to fall back asleep. Every snore is a hoot, and his feathers fluff out occasionally as he continues to make himself comfortable in Astarion’s lap.

‘This might be the best thing ever,’ Astarion tells you earnestly.

You aren’t quite sure what possesses you in the moment, but you straighten up a little bit and glance at him as coyly as you can manage. You put your hands in your lap and twirl your thumbs around one another nervously.

You say, ‘It really does seem like he likes you. Maybe  —  Maybe you could come by more often. If you want to.’

Astarion glances at you knowingly. ‘Oh, perhaps every once in a while,’ he says ‘Maybe I could teach him how to play fetch.’

‘Like Scratch taught you how to?’

‘I knew how to play!’ Astarion complains. ‘He wouldn’t give the ball back! And he’s so fast, it’s ridiculous. His Majesty would never treat me this way.’

‘I’d like to meet His Majesty too,’ you say casually.

Astarion’s eyes light up. Had they always been that shade of red? The light of the evening seems to make them glow… You try not to think about it too much, but you haven’t been very good at focusing lately. Astarion seems equally as interested in your eyes. He chases after them, intent on looking you in the face as you chat.

‘You’ll have to come over,’ he says encouragingly. ‘I cook a mean Lheshayl steak. It pairs nicely with a Silverymoon white wine.’

‘I don’t ever think I’ve had a Lheshayl anything,’ you say, and Astarion laughs. It isn’t a mean laugh. ‘Do I bring a dish to something like that?’

‘Oh no, darling, you don’t bring anything but your gorgeous self,’ Astarion says, nudging you with his elbow. ‘I wasn’t inviting you to get together with friends, you know. If I wanted that, I’d have it catered. I was asking you on a date  —  ’

‘A date?’ you repeated stupidly.

Astarion laughs again. It’s a whimsical, unpracticed sound that doesn’t go with his usual countenance but it sounds nice. It makes you want to make him laugh more. You’re not quite sure what you’ve done to warrant his attention, but the affection is nice… You nudge him back, fighting the smile, fighting the butterflies dancing dangerously in the pit of your stomach.

‘Okay,’ you say softly. ‘It’s a date.’

#astarion #astarion ancunin #astarion bg3 #astarion x tav #astarion x reader #astarion x you #astarion x oc #from ，carcosa . #anonymous #my fic #ASTARION LOVES ANIMALS #source: me #anyway the socks i mentioned are like $600 USD #i just feel like Astarion Would

[anastasiabowe]

“…ᴀᴏᴍɪɴᴇ.”

Aomine was playing basketball with random people at the basketball courts down the block from his house. You were walking with friends, when you saw him dominating them all.

You gasp and run to the tall fence that surrounded the court.

“Aominichi!” Your pretty voice called out to him. Your friends giggling at the other men who were shirtless and sweaty.

He looked back at you and his energy was… off, but you obviously didn’t notice!

You ran around to where the fence gate was, and your friends followed in awkwardness. You ran to the bench where his stuff was, and he walked over to you, looking a bit annoyed.

“Can you not be here right now…” he looked off to his left and it seems like he was a bit embarrassed you were here.

“I wanna watch you play!” Your bright smile beamed at him, his gloomy cloud not faltering around his head.

“I kinda came here to play to get my mind of things, and you are kind of not helping.”

“Well, I promise I won’t say anything!” Your voice was getting whinier, babier, and he wanted to yell at you so you can take a hint.

“Please, just go do something else away from me.” His voice didn’t sound so cautious anymore, he sounded mean.

“But aomi-“

“Y/n, can you ever just get the fucking hint? Right now I don’t want to hang out with you, I don’t want to hear you, I don’t want to see you!” His voice raised, and your friends looked at him in annoyance.

Your friend tizzy understood him, but understood you more so she helped you up and walked you away, your other friend Kira glared at him.

“Still got a small dick I see,” She spat and looked him up and down. “Fucking bitch.” She walked away towards you both and you were now holding back tears.

Aomine pinched his bridge and turned back to the game. Everyone looked a bit upset at him, not a single person in the mood to play the fun game they were before.

“What?” He annoyingly asked them.

“Who talks to their girl like that? Especially a cute one?” One said.

“Yeah dude, you’re lucky you have a girl that wants to spend time with you.” Another said.

“Would hate to date someone like you.” One whispered.

“Right.” Another agreed.

Aomine rolled his eyes, but truly, he knows they’re right.

“Y/n, please stop crying! He’s probably just in some mood!” Tizzy rubbed your back at a bench far far far from the basketball court.

“He-he’s always in ‘some mood’!” I wiped my eyes, and Kira looked like she was about to kill someone.

“He’s such a dick! You are such a great person, and he is basically using you. I think you should have dated Kagami or some rival of his.” Kira angrily said.

“No, I-I love Aominichi!” My tears finally drying up.

Kira cringed. “He doesn’t deserve to be called ‘Aominichi’,” she mocked in a Whitney voice, not mocking you though.

“Thanks guys, I-i think I wanna go home for now.” I softly said, standing up.

“Do you want us to hang with you, or do you want some alone time?” Tizzy offered.

“I just wanna play with Loki and be alone.” I smiled. They hugged me and we parted ways.

I had walked down to the train and got on. My phone dinged and I looked at it.

Aominichi💗: Hey, can we talk?

I opened the message and closed it, I wanted him to know I read his message but don’t care. Yeah, it hurt to do that, I love talking with him, but again, like many times, he hurt me and I can’t give in to that!

Another ding.

Aominichi💗: come on Y/n don’t ignore me😒

I opened it again and closed it.

I finally reached my house, and outside was Aomine.

“Shit.” I groaned to myself. I walked through my gate and right part him, I didn’t even give him a glance. I opened my door and tried to shut it, but he pushed it open.

“Y/n, talk to me.” He sounded irritated. Good.

“I have nothing to say to you, Aomine.” The name you gave him struck his heart. Yeah it’s his name, but you’ve never, no matter how upset you were, you never called him by his actual name.

“Y/n, come on-“

“I have nothing to say to you.” I grabbed Loki and sat on my couch. The white cat glared at Aomine, knowing he did something wrong.

Aomine stood there like “🧍🏻”.

I looked at him, heart hurting. I’m not a cold person, this kills me more than it kills him.

“I’m sorry,” He finally said. I looked at him and wanted to hug him, but no. “You know how I get!”

“Mhm.” At this point my cold facade was faltering, tears burning at the back of my eyes. My throat was starting to close and tense.

He walked over to me and got on his knees.

“I love you so much, please forgive me.” His hands clasped together and his eyes wide.

“If you loved me you wouldn’t treat me so bad.” A pout formed on my face, slowly giving into his apology.

“I know, I’ll work on it.”

After looking at him, seeing him on his knees asking for forgiveness was not like him, so I guess I could forgive him.

“Alright, I forgive you.” I smiled and his face lit up, but then a smug look appeared on his face.

“Yep. Don’t think I’m getting on my knees for you ever again.” He hopped on his feet and leaned over to kiss me.

“But seriously, I’ll work on my attitude.”

“I know you will.” I smiled and he rolled his eyes.

“Also never call me Aomine again. Doesn’t sound right coming from you.” His face cringed at his own name.

“Yeah, yeah, you big baby.”

#aomine daiki #daiki aomine #Aominichi #knb x reader #knb #knb aomine #tōō academy #dai-Chan

[welovenightcord]

Hii I'm starting if you're ready YOU KNOW KAISER IS VERY GOOD BUT IT WOULD BE BETTER TO WRITE SOMETHING ROMANTIC ABOUT KAISER. I will be waiting 🤭

A/N: with that fucking scary Kira photo, it looks like a threat message. But anything for you my pook pook. 💕 I added some characters by the way 😍.

Characters: Kaiser Michael, Isagi Yoichi, Eita Otoya, Nagi seishiro

Warning: English isn't my first language. I'm sorry If there's any mistakes.

﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌﹌

You're simping for a character and it makes them jealous!

✧Kaiser fucking hates when you simp for a character. He deadpans at the sight and says “Huh? You love them? Babe, They are not real. And how can you love them when you have a king like me.”

✧Isagi knows that he shouldn't be feeling like this. But you pay more attention that character! He definetily hugs you from behind and nuzzles into your neck, “Why are you more interested them than me? You can't even cuddle with them and kiss them. But here I am, come here.” and kisses your cheek :(( WHY ISN'T HE REAL FUCK.

✧I think Eita is chill about it. But he sometimes reminds you that he is the one who is real and your lover, not the character. (Sorry I don't know too much about him!)

✧Nagi plays games too and he has favorite character aswell but he doesn't love them as much as you. And he feels a bit upset when he sees you simping for them :( He wraps his arms around your waist and kisses your all face! “Pretty thing, why are you paying attention them while you have me? Just look at me.” NAGI KISS ME PLS. I'M ON MY KNEES FOR YOU.

#blue lock #blue lock x reader #bllk x reader #bllk #blue lock fluff #michael kaiser #kaiser x reader #michael x reader #michael kaiser x reader #isagi yoichi #isagi x reader #yoichi x reader #isagi yoichi x reader #isagi yoichi fluff #eita otoya #eita otoya x reader #eita x reader #nagi seishiro #nagi x reader #nagi seishiro fluff #nagi seishiro x reader

[audhd-nightwing]

teen wolf as b99 quotes

*lydia’s party in s2*

lydia: why is no one having a good time? i specifically requested it.

***

isaac, to lydia: derek told me not to let him get hurt tonight, so i’ll keep him away from you.

later

stiles: have you seen lydia?

isaac: lydia died eight years ago.

***

derek: oh, are you and allison no longer…

scott: smushing booties?

derek: …yes that’s exactly how i was going to phrase my sentence, scott.

***

stiles: we gotta get to hospital and we gotta get there fast.

jackson: then i should drive.

scott: why you?

jackson: i have nothing to live for and i drive like it.

stiles: …okay, let’s do it.

***

stiles: all right, give me your hair-dryer.

allison: what?

stiles: don’t you carry one in your purse?

allison: have you ever met a human woman?

stiles: …*calls lydia*

lydia: hey, stiles.

stiles: hey. do you carry a hair-dryer in your purse?

lydia: of course. i’m not an animal.

***

stiles: you think you can just bully people, but you can’t. it’s not okay.

stiles: i’m the bully around here. ask anyone.

***

erica: i’m not a stone cold bitch.

erica: i’m a natural, beautiful presence.

***

stiles: do you know how many basic bitches would kill to have the same personality as me?

***

peter: we can go to my apartment. no one knows where i live.

derek: i thought you had stiles over once.

peter: yeah, it was fun. i moved the next day.

peter: he would way too easily use that information against me.

stiles: he’s right, i would.

***

scott: stiles, i screwed up, big time.

stiles: scott, given your daily life experiences, you’re gonna have to be more specific.

***

kira: ‘writing things down’ is nerdy!? what do you do?

malia: i just forget stuff like a cool person.

***

allison: you are disturbingly good at this.

lydia: i grew up forging report cards.

lydia: if people knew how smart i was, it would have been harder to control them.

***

stiles: are you a minor? how old are you?

liam: i’m 610. i’m a highlander.

stiles: okay, you know what? i’m gonna put that in there.

stiles: and then you’re gonna be tried as an adult highlander, and they’re gonna cut your head off.

***

erica: what do you look for in a guy?

stiles: i don’t know, real stuff. shape of his ass.

erica: yeah that tracks

***

scott: i straight up drove him off, big screw up on my part.

derek:

scott: i’m trying this new thing, where i just own my mistakes. i like it, do you?

derek: i did. until you bragged about it.

***

boyd: you searched for ‘cheapest date possible’.

stiles: and i wear that search like a badge of honor.

***

scott: wow, your handshake is quite firm.

kira: i took a seminar.

scott: where?

***

stiles: a parsec is actually a measure of distance. that’s one of the many inaccuracies in the ‘Star Wars’ universe.

malia: and what’s ‘Star Wars’?

stiles: oh boy.

***

scott: okay- no big deal, five days is nothing. i’m not afraid to be alone with my own thoughts.

scott: my thoughts are awesome. die hard 6 on a cruise ship… pizza bagel restaurant…

scott: my father never loved me, i’m gonna die alone.

scott: oh boy, that escalated quick.

***

stiles: well, remember when you told me not to burn down the precinct?

sheriff stilinski: you burned down the precinct??

stiles: no, i had the fire put out almost immediately. this is a success story!

***

stiles: peter, this isn’t High School Musical.

scott: yeah, peter, this isn’t High School Musical 2.

stiles: yeah, and it isn’t High School Musical 3: Senior Year.

***

boyd: i’m fine at parties.

boyd: i just stand in the middle of the room and don’t say anything.

***

derek: i only feel one emotion, and it’s anger.

isaac: last night you drunk-texted the whole pack a bunch of heart emojis.

derek: …out of anger.

***

stiles, to jackson: no hard feelings. but i hate you.

stiles: not joking. bye.

***

lydia: give me the ring.

stiles: ha, you sound like Gollum.

lydia: that means nothing to me.

lydia: i don’t see those movies, i’m too pretty.

***

stiles, walking out after a pack meeting ends: sexy train is leaving the station.

stiles: check out this caboose! later, sluts.

***

scott: look at me. do not blow this for us.

random dog that allison hit with her car:

***

peter: i really miss these people, the whole pack. stiles, scott…

peter: …i forget all their other names.

derek: *judgemental eyebrow raise*

#teen wolf #source: b99 #b99 quotes #incorrect quotes #brooklyn 99 #stiles stilinski #derek hale #scott mccall #lydia martin #isaac lahey #erica reyes #vernon boyd #allison argent #kira yukimura #peter hale #sheriff stilinski #malia tate #jackson whittemore #hale pack #teen wolf incorrect quotes #stiles and lydia are jake and gina #also derek is rosa #aka grumpy leather jacket bisexual

[deelavis]

I'm sure that some has talked about this before, but I have always been confused about Mello's reasoning for kidnapping Takada. I finished a read through of the Death Note manga recently and I FINALLY feel like I understand why. I'm going to break this down into 2 sections: Why he did it, and Did he intend to die?

Why he did it:

While I think it's meant to be kept somewhat vague for narrative purposes, the thing that I never understood fully was the wording in the scene:

Why specifically "his" name? Of course this line always made my little Meronia heart flutter, but before my manga read through I never quite understood it. If Near's plan to catch Kira went wrong, all of the SPK would die, not just Near. So why the emphasis on him? Especially if we are looking at a completely surface level reading of DN where Mello purely hates Near? But then I found this moment a few chapters earlier:

To summarize what is happening before and after these pages (Chapter 90), Near tells Light that there are 4 members of the SPK and that he is in Japan. He says they might meet soon. This is all coded language to challenge Light to an in person meeting. At this point Near admits that he doesn't have a concrete plan in place for confronting Light. But he knows they must meet Kira face to face and prove his identity by having a name written in the Death Note. This is prior to the SPK starting their investigation into Mikami. The part that stuck out to me was " When we meet Kira, the first person he'll write down is me, so..." To me this means that prior to finding Mikami and adding fake pages to the death note, Near planned to sacrifice himself to catch Kira if they didn't have any other options. This DIRECTLY correlates to Mello's line (read right to left):

Mello kidnapped Takada because he knew that if he didn't there was a good chance Near would die. This is literally the only reason that the text give us. Which leads me to our next part.

Did he intend to die?

While I've seen a lot of different takes on this, many of which I find very interesting, I now believe that yes, Mello kidnapped Takada with the intention to be killed by the death note. Here is my reasoning.

Mello knows better than anyone else investigating Kira how the death note works. Like L wanted to before his death, Mello used his time in the mafia to experiment with the rules of both the death note AND the shinigami eyes.

In the manga, Mello has one of the mafia members Kal Snydar (a.k.a. Jack Neylon) make a deal for the shinigami's eyes. Rod and Mello use Snydar's eyes to kill others for an extended period of time. This would give Mello at least a basic understanding of how they work; what face coverings inhibit the eyes, etc... And then after his encounter with Soichiro Yagami he becomes aware that there is always a chance that anyone associated with Kira could have the eyes. He also knows that Kira knows his name but not his face after the explosion. Meaning that he would know that the ONLY thing stopping Kira from killing him would be his face. Given that Mello never uses the death note himself but had other's use it for him, I believe that he also would theorize that Kira would do the same (such as X-Kira/Mikami, Misa, and Takada). Because of all of this he would be especially careful around anyone he knows has connections to Kira, such as Takada the spokesperson of Kira.

Moving on to the kidnapping. Mello wears a motorcycle helmet that appears to be tinted, but is clear enough to fully discern his face through. We know from previous instances that a dark tinted visor will block the shinigami's eyes from seeing your name, which most motorcycle helmets already have. Here is a comparison of a helmet used to block the face vs what Mello wore:

Mello specially chose one with a clear enough visor to see through. You could argue that he did this to show Halle who he was, allowing him to take Takada. However if this was his intention there were many other ways to make his identity clear to Halle without revealing his face. There is also the line on this page that intrigues me. "She's connected to Kira... Unless I do this..." The sentence structure implies that there is a direct consequence Mello envisions. Unless you do this...then what? Given everything else I have outlined above to me the implication is "Unless I do this then Near will die." You could argue that he’s thinking something like “Unless I do this then Near will win!” However, Mello has always been outspoken in his desire to be the one to catch Kira. If that’s what he was thinking wouldn’t it just say that? Whatever his reason is is something he can’t bring himself to say even in the privacy of his own brain.

If you were to argue that Mello didn't realize that his helmet was clear enough to see his face, this is then made moot when he takes it off in front of Takada. There was no reason for him to do this, in fact, there were a multitude of reasons not to. Even if Takada didn't have death note pages on her, Mello knows that if she escapes, Kira could easily ask her to write his name in the death note because she knows his face. You may then think "but why does Mello take precautions to not get followed and killed by Takada's men? He takes away and ships off anything that could be bugged and tracked including her clothing." This just further proves that he is trying to be killed specifically by the death note. The kidnapping is planned to a T, but he doesn't take the simplest precaution of concealing his face from one of Kira's biggest supporters.

So what was Mello’s plan? We know that Mello is someone who plans for a lot of different contingencies. We see this when he plants bombs through out his safe house in the event that he’s backed into a corner. Because of this I believe he had a few different plans. But no matter what his goal with kidnapping Takada is to force contact with Kira. In fact, Near thinks that Mello’s goal is to use Takada as bait.

What his exact plan was up in the air for me. He may have intended to be killed by her, thinking that she had access to a death note when kidnapped which would explain why he didn’t check her over before giving her the blanket to cover herself. He states that his intention of taking her clothes is to removing any tracers so her bodyguards didn’t find them. They make a deal that he will give her the blanket before taking off her underwear, where she’s hiding her pages of the death note.

Even if Mello didn’t know that you can used pages torn out of the death note, there are a few time in the series when a person hides a full death note under their clothes (Near being my favorite example). So it’s not out of the question that she could have had one tucked into the back of her underwear.

His plan also could have been to release her in some way so that she could get back to Kira and use the death note. Mello knows Kira has his name, now with Takada having seen his face Kira would have her write Mello’s name for him. Or it could have been that he intended to use her to draw Kira out and get killed by the death note in the process.

Going back to our first example from the manga, Near says "The fact that we replaced the pages in the notebook and the notebook happened to be a fake… I find it hard to believe that Mello thought that far ahead." I do agree with Near here. I don't think that Mello had figured out that the notebook was fake. But I do think that Mello could see that Near's plan had holes in it, and any mistake would result in Near getting killed. His solution was to be the name that was written in the book instead. You can argue in a lot of different ways why it was important to Mello that Near lives. Such as, Mello knew that with Near dead he didn't have any hope of catching Kira by himself with all of this resources and allies depleted. Or my favorite reason, despite his protests Mello deeply cares for Near and was willing to die if it meant Near would survive.

Please let me know any of your thoughts!

#Death Note #mello death note #near death note #meronia #mello x near #death note headcanons #death note brain rot

[juicyc0utur3]

random mello hcs w/ fem! reader

hi guys, sorry i haven’t rlly posted in a minute, i’ve js been busy lately

but i hope you enjoy ^^

warnings: smut, spicy hcs here and there, praise, degradation if you squint

nsfw content under the cut

• you guys met by you joining the mafia or just becoming involved in the kira case

• you two stay in the same apartment, just to make work easier

• it takes so long for this man to see you as a friend, let alone a partner

• for a while, he kinda just sees you as a coworker/roommate of sorts, but that doesn’t mean he hates you

• before you guys started dating, you’d bring him chocolate sometimes with little notes that would tell him not to overwork, have a nice day, etc etc

• he would mumble a quiet thank you for those things whenever he saw you again, but all in all he doesn’t rlly know how to show gratitude for anything

• asking him out was really blunt

• you guys were working and it kinda js slipped out

“could i be your girlfriend?���

“..what?”

• he’s definitely confused bc he doesn’t know what makes him attractive to her bc look at her she’s so gorgeous but he does accept

• he’s never been in a real relationship before, having been at the orphanage for most of his childhood and secluded as an adult, but he does his best and it shows :D

• small but sweet little things he does, like buying you something he sees you looking at in a store, or js getting you your fav candy or sweet along with his chocolate

• no little notes like you did, but it was still sweet

• relationship may be a bit toxic bc he is very insecure, and is smth of a workaholic

• but it works really well if you guys communicate and talk things out, and for the most part he’s a distant but kind boyfriend

• loves to kiss the bridge of your nose

• idk it just feels right

• he’s a top 99.9% of the time

• on the occasion where you wanna top, he’ll never be against it, but prefers towering over you and getting to see your face better

• go to position is missionary, but if you wanna try smth different, he will always be open to it

• bites you during sex, soft most of the time but rough on occasion

• wherever he is for the longest i can guarantee you’ll have a mark there later

• brat tamer

• brat tamer

• brat tamer

• will make you beg for what feels like forever just for him to touch you if you’re being bratty

• will call you things like slut, whore, etc

• but if you’re usually submissive in bed, he’d love that just as much, murmuring praises into your ears as he does literally anything

“good girl, taking me so well..”

“can you hold on a little longer for me, doll?”

• just ask nicely for him to let you come and he’ll kiss your neck and speed up a bit to get you where you wanna be :3

• i’ve seen people paint him as this constant tease and rough orgasm denier during sex

• but tbh i feel like unless you’re being bratty he’ll take his time and be exceptionally gentle

• still a tease ofc but not like incredibly rough

• his voice during sex >

• he could say the most out of pocket thing and it would still sound hot

• isn’t incredibly educated on aftercare, but he does his best

• like first time you guys ever did it, he probs helped cleaned you up and gave you some kisses and then js went back to work

• but if you ask him if he can stay longer, he’ll oblige with no hesitation, holding you close as you rest

• he will give you everything you want within reason as long as you just communicate it to him

• loves loves loves hickies

• giving them, receiving them, he doesn’t care

• first time you gave him one he was asking almost begging you to give him more

• wears them out in public w pride

• marks you up if you’re going somewhere w a lot of people, not in an insecure way, but js so ppl know not to bother you :3

• POSSESSIVE

• lets you brush and play w his hair a lot

• if you enjoy having your hair played with he is the man for the job

• pulls your hair as you take him in your mouth, breathing heavy as you suck him off like a pro WHAT WHO SAID THAT

• not super vocal during sex, surprisingly enough

• the first time you were slightly worried you were doing something wrong until you heard him let out a faint moan

• he makes light noises tho, like you can hear his breath hitch and soft sighs and groans out of his mouth

• doesn’t whimper, but he loves it if you do

• might be embarrassed if he makes a louder noise by accident but it just makes you go faster which he appreciates

• his lack of volume is another one of his reasons he likes praising you, just so you know you’re doing everything right

“good, good.. just like that, keep going..”

• he would like fruity drinks like the starbucks refreshers, i will die on this hill

• isn’t clingy but enjoys being physically close to you

• like sitting beside you, sleeping in the same bed even if you aren’t cuddling, that type of thing

• i can imagine he’d be up for cuddling but you’d have to ask fs

• motorcycle rides

• motorcycle sex

• likes those tozo coffee candies

• lets you paint his nails, if it goes w what he’s wearing

• small physical things

• ruffling your hair, playfully poking you in the head, cupping your face as he kisses you

• listens to the cure, deftones, smashing pumpkins, and the smiths. idk he just seems like he would

• music might help him focus better

#death note x reader #death note lawliet #death note #mello x reader #mello death note #mello #bros got the nicki minaj bob fr #mello x you #fem reader #my hcs #dating headcanons #death note light #death note smut

[existentialcrisistime]

D&D: Honor Among Thieves (Xenk/Edgin) fic rec list:

These are just based on those I've read and loved so far. There are so many incredible works coming out of this new fandom that I'm sure I'll have enough recs for a second post in another month or so.

Because this turned onto a bit of a long post, the recs are below the cut.

I've marked the rating by each fic, but please do mind the tags!

Curse of the Green Hag by @moorishflower (E, 16k)

Xenk contracts a fuck-or-die curse and turns up on Edgin's doorstep for the first time since Neverwinter. Also contains an excellent cameo from Holga, a bit of bondage, Xenk's first time, and A Lot of emotions. And of course the actual smut is top tier. Already wanting to read this one again.

High Praise Indeed by enchantedsleeper (T, 3k)

Xenk stops by Holga and Edgin's cottage to find Edgin in the throes of a breakup. In the process of trying to persuade Edgin of his many worthy qualities, he accidentally reveals a little too much. Short and very sweet, with cameos from Holga and Kira. Would recommend for fans of pining idiots.

in the absence of truth by @floralprintshark (E, 13k)

Five times Ed says that he hates Xenk and one time he doesn't. Yes, a 5+1 things, but oh it's so much more than that! There are heists and hijinks, accidental asshole Edgin, uncertain and inexperienced Xenk, and a hint of polyamory between Simon and Doric, but the whole party are featured and written perfectly here. Also contains Many emotions. I sent this one to the group chat, and we were ALL screaming about it (in the best way)

Universal Glue by Korwwa (E, 10k)

A rescue mission goes wrong, and Xenk and Edgin get caught in, yes, a glue trap. The premise may sound like a crack fic, but it's definitely taken seriously, whilst still being very fun. Plus a wee bit of angst for (delicious) seasoning.

Scraping the Moss Off the Standing Stones by @letmetellyouaboutmyfeels (E, 4k)

Established relationship, Xenk comes home after a long time away and Edgin takes care of him. Oh boy, this fic sure packs a lot into just 4k words, and I feel like the author just Gets how I imagine Xenk - always seen as holy or evil, but just wanting to be treated like a person. Also very hot - I'm weak for some well-written dirty talk and this is perfect.

When the well runs dry by demon_faith (G, 2k)

Part one of the Time Heals All Wounds series, which can either be read as a series or as stand-alone fics. Established relationship, Edgin is badly injured, and Xenk is unable to heal him. A classic hurt/comfort with a good bit of Edgin whump, and Xenk struggling with the reality of that.

On the edge of a blade by demon_faith (T, 3k)

Part two of the series, again established relationship. This time, Xenk gets badly hurt, and it's up to Edgin to take care of him. Heavy on both the hurt and the comfort.

lay on hands by @hauntedfalcon (E, 2k)

A getting-together/first-time fic, with a healthy dose of body worship. Xenk gets off on Edgin's metaphors. Beautifully written, and also my initial thoughts were - this is an author who sure is clued up on the names of medieval clothing/armor.

half your life (you've been hooked on death) by roundtriptojupiter (T, 2.5k)

Edgin struggles to process the events of the past six months, when Xenk turns up at his doorstep. Or, Edgin and Xenk process grief together, then kiss about it. A great exploration of Edgin's emotions, not only regarding Zia and Holga, but of the other people he may have harmed along the way.

We can burn much brighter (if we don't look back) by enchantedsleeper (T, 6k)

Xenk apprehends Forge and learns of the events that transpired at Neverwinter. Grappling with the fact that his past almost repeated itself while he was too far away to help, he encounters Edgin. Such a lovely post-movie fic, exploring just how Edgin and Xenk are processing their feelings in the wake of it.

Do you know you'll never fly alone? by MayGlenn (T, 1.2k)

Something a bit more light-hearted to end the recs list on: a fix-it of sorts, but for the poor undead guy in the post-credits scene. Xenk takes Edgin on a late night ride, to fix an issue he'd left behind, but maybe for something more also...

And that's that for now! Please do feel free to recommend your favourite D&D: Honor Among Thieves fics in return, or yell about which of these you loved the most. My comments and inbox are always open :))

And to the fic writers (and all fic writers out there), thank you so much for sharing these stories with us! You're all absolutely wonderful, talented people <3

#dnd honor among thieves #dungeons and dragons honor among thieves #xedgin #edgin x xenk #fic recs #nic's recs #dndhat fic #nic watches dndhat #rec list

[bleepbloopblaa]

Guys

I have a ton of headcanons

- L gets really goofy when he’s super sleep deprived. He can go two weeks max without hallucinating. If he goes past that, he l kicks his feet and giggles and is all sorts of goofy. (One time when Light and L were handcuffed, L had stayed up for a couple weeks by accident and Light had to have a date with Misa the next day. As interesting as the case L is sharing is, it’s 3 in the morning my guy-)

- Light likes mint chip ice cream

- L can’t stand the texture of the word “socks”

- Matsuda loves Christmas music, L and Light hate it. L bans Matsuda from playing it without headphones in. Matsuda plays it at full volume through his headphones and lays the headset next to L and Light randomly throughout November-December. L can’t technically get mad since Matsuda is technically following the rule and he hates it.

- L has to do a double take every time Matsuda says something smart.

- “This is the same man who played Mariah Carey on November 1st, what do you mean he- it’s definitely a clone. There’s no other explanation”

- L randomly yells out to every happy whatever holiday it is because he forgets what everyone celebrates because he knows too many holidays.

- It’s the only way he keeps track of what day it is

- L was a show choir kid

- That’s how he is so mobile and flexible and knows how to fight, he was a ✨dancer✨

- He is a bass, but can hit soprano notes

- L can play poker

- L loves pumpkin spice

- L also loves dad jokes. They’re so amazingly bad that Soichiro winces at them. It’s amazing. Misa absolutely loves them.

- On a related note: Soichiro (before the Kira case) absolutely told so many dad jokes that embarrassed Light so much. Light every once in a while will let a dad joke slip because he grew up with them and every time he is so disappointed in himself.

- Light wore a dress one time to prove a point/on a dare. He’s loved dresses since. Soichiro actively bought him the first dress when Light asked for it.

- L is a hot coffee drinker, Light is an iced coffee drinker

- Update: I learned L canonically lets his hot coffee run cold. Still, headcanon applies: he always makes it hot at first and will either drink it so it burns his mouth or it’s cold. No inbetween

- Light has pictures of L on his phone like how some people have pictures of their cats/dogs/kids

- L had an underground fanbase that was so small due to a lack of knowledge and publicity about him. When the Kira case and L went public happened, the fanbase was like “WE LOVED L BEFORE IT WAS COOL!!” And there would be comments and tumblr posts and stuff being like “like if you were here before Kira 😜” and stupid stuff like that like how you know fan bases are.

- Bonus: Light started the fanbase in middle school and he was a very well know L x Reader fic writer, but he kept his identity secret. He wrote fics of every au, had x male, x female, and x nonbinary stories. He was so well known that that he had his own little fanbase

- One day, Light got bored of writing the fics and wasn’t hyperfixated on L anymore so he just randomly stopped and his fans were concerned and worried that L thought he knew to much and got to him

- Light’s online name would be “Moon” because it would be hilarious

- (Somewhat) Related: Light wrote fanfiction in middle school and freshman year

- L proposing to Light, and instead of Light being like “damn it! I wanted to do that first!” Or have any irritation, he just gets the biggest smile plastered on his face as he looks at the ring on his finger, a complete loss for words

- L can pole dance (respectfully clothed thank you very much) because he wanted to spite a teacher in highschool

-fuck it, L has a ton of random hobbies that make no sense and half the time he has a story behind it

- he can play drums and guitar and a little piano, but can’t play a flute and it will always anger him because he knows he has the breath support for this, so why can’t he??

#deathnote #lawlight #light yagami #l lawliet #misa amane #touta matsuda #headcanon #death note headcanons #Light would be a fanfic writer in middle school you can’t change my mind!

[purplink8]

Naomi is one of my favorite characters so I decided to compile my thoughts on her in this post! :D

(Disclaimer: I do not particularly like the fanon version of Naomi & while I do dislike Raye, I still believe without a doubt that he cared for Naomi (enough to go along with Light when he threatened to kill his loved ones, and the first one to pop up in his head was Naomi) and had his (however misguided (by sexism ofc)) best interests at heart for her. That does not absolve him for being, frankly, really really rude + sexist to Naomi and I will forever be annoyed with him for that.

tl;dr I'm neither a fanon!Naomi stan nor a Raye apologist. Anywho-)

Before I talk about Naomi, I want you to take a look at this panel directly above the one in which she first appears.

Before Naomi's first appearance, Ryuk says "I guess women being tough in crisis goes for humans, too." This is said in reference to Yuri being unphased with the bus-hijacking and dragging our fave sexist murderer to Space Land haha.

But I think it's significant that the above quote was said by Ryuk for all women (maybe the real feminism was the Shinigami we found all along!) JUST BEFORE Naomi's first appearance.

Even before Naomi is introduced, the canon has (however jokingly (side-eyeing you Light-o)) established that women are tough in crisis. I do think that's saying something- especially when you'll see (which will be discussed in length in this post) that this statement holds true ESPECIALLY for Naomi.

But we'll come back to this later; let's move on to Naomi actual appearance in canon.

We're introduced to her as Raye's loving fiancé who is also attentive (receptive) towards him as she asks him why he's tired to which he mentions the bus-hijack.

She's quiet in noting down her observations in her head as she asks Raye for more info regarding the bus hijack:

Look at the '...' she has before asking Raye for details. We can read it as hesitation to voice her suspicions before they sound strong enough or as the pause to think it all through OR more likely as we'll see in the panels below, she perhaps hesitates due to the conditions she agreed to with Raye. The pause may also be due to her analytical mind starting to work, she has to mull over the details she's just been given before reaching to a conclusion.

She does speak out on her misgivings as she clearly cares about Raye and thinks (& correctly at that!) that he met Kira.

Only to get shut down by him. Raye is, obviously, sexist and rude here but we have to remember that Raye thinks he's doing the right thing (according to his sexist 'i have to protect her from danger' attitude anyway). He does admit that she was an excellent fbi agent but still, he's not respecting her opinions.

Now this is where my hate for Raye shines through like

"once you pop up some of my babies, that habit won't pop up anymore" ~Raye Penber, probably, i wish i was exaggerating

Raye is unbelievably dismissive of Naomi here. Not only does he not take her concerns seriously, he also follows it up with a 'joke' about directing her intelligence towards being his future wife. Now, I do believe that Naomi wanted to quit her job too but that doesn't make it okay for Raye to y'know treat Naomi like this. And Naomi (being genuinely apologetic) politely chuckles it off.

I think this brings us to an important aspect of her character: she has a sort of passive attitude. She is not that assertive imo instead preferring to be compliant and yielding. She values harmony in her relationships & avoids conflicts by being agreeable (at least with Raye).

Then Kira happens to Raye Penbar and other FBI agents. I find it interesting how these panels are placed next to each other:

These panels are juxtaposed to each other to perhaps show us that while killing the FBI agents may be like a game to Kira & L, there are real stakes involved for those related to Kira's victims- they become pawns in Kira & L's game-: Naomi being the prime example, who is shown grieving Raye's death.

She is intelligent enough to deduce that Raye was murdered by Kira.

Now instead of wallowing in her misery (remember what Ryuk said about women being tough in crisis? yeah this is what's happening here), the former FBI agent picks herself up, gathers her wits + composure, and gets ready to investigate.

We're then shown panels of Naomi travelling alone. I want you to remember that the emotional wound of losing her fiancé is still fresh & forefront in her mind (trying to catch Kira is a very close second). Even if her thoughts are not depicted (her ride to Shinjuku is deathly silent: with neither dialogue nor thoughts- meant to express how she deals with her grief- Naomi takes action and does so quietly), we get an idea of how she feels.

Alone. Torn between feeling lonely/helpless yet determined to catch the murderer who killed the man she loved. Still, she perseveres.

And she gets info from the bus conductor, that there were six passengers other than Raye during the bus-hijack. She figures that since Kira must've been someone out of those six people, Kira may be living somewhere near that bus route. It's a small lead but a lead nonetheless.

Naomi also infers that Kira is able to kill people by causes other than heart attacks too. More importantly, she is of utmost confidence that her finding IS a fact which means she wouldn't be shook off that belief any time soon. Which is really, really bad for Kira as it narrows down the list of Kira suspects considerably well.

I'm gonna focus on Naomi's POV (you'll know why later):

_____________________________________________________________

She enters the NPA building and the receptionists are being much help: saying that there's nobody on the task force here despite her appointment with them, which was made the previous day + asking her to just leave a message when she insists on meeting the task force personally.

This is important to her. Why are they being so difficult? She'd had an incredibly long day, her fiancé is dead and only she seems to have a clue of Kira's powers extend to killing people by causes other than heart attacks. She absolutely needs to tell this clue to the Task Force. If only somebody actually listened to her. (Even Raye, when he was alive, refused to do that).

Then a young guy, who introduces himself as the son of the task force Chief, comes in and talks with the receptionists about a case he had helped solve in the past. Whatever. That information does not help her in the slightest. She came here for one purpose and one purpose only: speak to the Task Force. Why are the receptionists so warm towards him while being so useless to her? And then the boy says something interesting:

He (if she heard correctly) may be able to beat L in solving the Kira case. He's definitely got her attention now. Either he's way too confident or there may be a degree of truth in his statement (well, they did just say how he helped them solve a case when he was a high schooler). Still, it's not like this guy can help her catch Kira when he's not even in the task force, right?

She's just about to mentally dismiss him when:

...he shares valuable information with her- something which the receptionists haven't (even if they had their reasons) and even better, offers to help her (he's the first person to do so ever since Raye died). He chooses to trust her (he had no reason to do that but does so anyway maybe due to the goodness of his heart? (she doesn't know- still he has helped her out a great deal already)).

It feels weird accepting his help but the boy is very polite + willing to help so she does. And offers him her sincerest thanks.

He also seems to think that Kira has greater powers than people think. That surprises her.

To think this young guy has deduced something which she had too...she chooses to confide in him a little (not so much, just a little without details, just as vague as his statement was) that that's why she's here.

The stranger tells his name. Light Yagami. And asks for hers. She's not taking any chances. Raye died because of giving his ID to someone in the bus (who, she's sure, was Kira) and while this kid seems relatively harmless, she's cautious. She has prepared for this. So she gives him an alias. Shoko Maki.

It seems she hadn't heard the end of his deductions. According to him, Kira can also control people's actions before they die- and she finally has someone intelligent enough, trustworthy enough (he trusts her AND has helped her out a lot) who is willing to listen that she cracks, offering him the final piece of the info she has puzzled out: that Kira can kill by causes other than heart attacks.

More information trickles out her (the kid, Light Yagami- she reminds herself- is surprisingly great at putting her at ease)...she tells him about her fiancé meeting Kira before his death. He's silent. When asked about it, he tells her it is due to the shock of hearing that.

Light is a patient listener, asking her details, offering his views on the matter so she doesn't mind telling him everything she has concluded thus far with utter conviction:

He's initially skeptical of course:

Still, he agrees that it's worth investigating into and that's what matters to her.

After thinking about it for a while, he informs her that he's convinced of her theory. Not only does he take her seriously, he also takes notes of the details of the incident.

Light has been as useful as a person in his position could have been and she's really grateful. She wishes to tell the task force herself so she heads back to the NPA.

He's still following her. Maybe he's doing this out of politeness? She tells him that she'll be fine on her own and thanks him for all his help. She turns. The kid approaches her again.

Only to tell her why the members of the task force were said to be absent.

Now she's suspicious. Why does this kid know so much about this investigation which ought to be kept secret from the general public? So she asks him. Only to get hit by this bombshell:

He is, if he's telling the truth, a member of the task force. Well, that explains a lot.

He tells us that all the members of the task force have been hand-picked by L.

Then she doesn't need to go back to the NPA, as she has already spoken to Light who, by his own admission, is a member of the task force which means her insights will be passed on to L.

Now that she knows that L selected Light himself, she allows herself to trust the kid enough (as she completely trusts L) to tell him that she worked with L on a case 2 years ago when she was in the FBI.

Naomi reveals that she'd been reluctant to trust the police and even the task force compared to L who has her complete trust (her plan was to ask them to let her speak to L directly, i.e., she didn't even want the task force to know her insights). Light asks her then why did she tell him something which should've been for L's ears only.

She gives him her reason.

She feels that Light & L are similar somehow (I think it's her gut feeling) and since she trusts L, she also, kind of, trusts this kid as he reminds him of L.

Then, something crazy happens. He asks her if she would like to join the investigation... She is flabbergasted, to say the least. She had come thinking that she'd be lucky if she got to talk to L directly but joining the task force herself?

Still, she has to admit the kid is nothing if not convincing. She feels indecisive. She doesn't know what to do; she's been feeling lost since Raye died. They were in Japan for a short while only. Hell, they were going to get married & get settled permanently in the USA. And now none of it was possible.

Raye was dead. She had to accept that.

What should she do?

But when the kid brings up how she's still a young beautiful woman for this dangerous investigation, she finds her doubts shattering and her resolve hardening. She realizes that she has gotten a new purpose now.

With her fiancé gone, she's got nothing left to lose anymore. Getting Kira (who was responsible for his death) is the only thing that matters to her anymore, as she says in her outburst. She'd do anything, regardless of risks to her life, to make sure that Kira is caught.

She's very determined now to join the investigation and requests Light for the same. He asks her some proof of her identification.

She hesitates, but feels this can't be helped: she reasons to herself, as she apologizes for giving out a fake name earlier. He praises her carefulness. And she gives him her driving license. He asks her some details about the time she was in the FBI. And keeps glancing at his watch strangely often enough to prompt her to ask him why:

He, once again, looks down at his watch as he replies.

He is Kira.

Light Yagami is Kira.

She is horrified, with realization dawning at her eyes that she has already given him her real name, and is filled with dread of what is to come.

And just an instant later, she turns sharply (not unlike clockwork) away from him. She feels as if she's in a trance. He is speaking something to her.

What's the matter?

An answer comes unbidden to her lips, as if that's what she's been supposed to say all along, like she has practiced this chat with him before,

"There's something I have to do."

The words feel foreign to her, and yet she feels that that's what she was destined to say anyway.

Didn't you want to talk to my father?

The words are a blur as she replies mindlessly.

"No. I have nothing to say to him."

_____________________________________________________________

...well, that. was. Dark.

No, really, it's so fucked up how Light taunts Naomi in her final moments that's why I hate him during this scene.

But anyway, I wrote those 1.4k words talking from only Naomi's POV so that we may understand why she allows herself to trust Light.

I think the argument of her trusting Light "that easily" is uh... debatable? If you pay attention to the plot, it's not that hard to believe that Naomi comes eventually to trust Light.

I think people take this panel at its face value...

...which is just Light self-congratulating himself AFTER he got Naomi's real name (only to think 'that was a close call...' in the next panel itself) like? You guys, don't fall into his trap thinking that Naomi trusted him way too easily.

This guy cognitive-restructures his way out of every setback. Just because Light wants to convince himself that it was that easy to overcome this setback of a woman, doesn't mean you have to be fooled into thinking the same as Light too. This is just his hindsight-bias talking.

We know how hard it was for him to figure out a way to get Naomi's real name after she gave him an alias (while being as cool as a cucumber too). Do not forget that before you chide Naomi for being too naive (yes she IS a little naive (y'know the trusting L a 100 percent? after working with him through a computer screen?) but we shouldn't blame her for giving Light her real name). She was being careful all along.

Until Light, with his genius social skills (remember he's exceedingly polite & helpful + just. a. Kid in Naomi's eyes), focused all his intelligence to achieve his goal of getting Naomi reveal her real name and succeeded as he's an excellent manipulator and got luck on his side while Naomi's degree of luck is exceedingly low.

Also remember that Naomi is freshly grief-stricken and this polite kid is the first one to stop and listen to her (+ agree with her respectfully). And then too she gave him an alias. But was forced to give out her real name because the situation called for it.

(I don't put much stock in htr13 stats but I think we can safely conclude that it's correct about Naomi lack of good luck. Also, she dislikes stalkers and Raye stalked Light (yes he was just doing his job but still you have to admit it's a lil funny that she was gonna marry a stalker- ok I'm done now with the htr13 discussion)). Moving on!

After Naomi's death (she was only 28 at that time), L accepts the phone call from her parents reporting her as missing and comes to know that she's Raye Penber's fiancé. L finds her name familiar and has Watari look her up, to find that she arrested the preparator of the LABB case, which reminds him that he worked with her on that case.

When Aizawa & Matsuda suggest that she may have killed herself after hearing news about her fiancé, L disagrees with them saying that the Naomi Misora he knew had great inner strength and was an excellent FBI agent. He thinks that she's try to go after Kira (and he's not wrong).

And that's all the info about her that the manga canon offers us.

In conclusion, I think Naomi is very intelligent yet a little gullible/trusting of people (she chooses to believe in the good of the people methinks), polite, quiet, introverted, a tad passive, and tremendously emotionally tough (seriously tho, she's in grief sure, and that makes her vulnerable to Light's tactics to get her to trust him & all that but it takes guts to go after a killer who can kill just by knowing your name & face just after he killed your future husband).

Canon!Naomi is far more complex than the girlbossified fanon version of her and I love her <3

#death note #naomi misora #light yagami #l lawliet #raye penber #ryuk #yuri death note #musings #p #long post #meta #dn meta #my meta

[momentofmemory]

If you were going to add an episode to Teen Wolf, what would it be about?

Oh i so got u bestie; i have so many thoughts about a bonus episode in between Codominance and Sword and the Spirit (5x13 to 5x14)!! The overarching theme of the episode would be trust—how it's been broken, how it's been healed, who you choose to put your faith into (and why), etc.

A-Plot

Scott seeks out, finds, and confronts Deucalion, in response to discovering Theo is looking for him at the end of Codominance. I think you could still keep the tension of whether or not Deucalion is double crossing Scott or triple crossing Theo, and then that final showdown will feel less out of nowhere

The main people involved here would be Scott, Kira, and Stiles, as Kira processes what all happened with the skinwalkers, particularly re: her test, and gets some closure between her & Scott re: her fox

In order for it to make sense that she goes back to the skinwalkers after Codominance highlighted how much she doesn't want to be with them, this episode would have to do some groundwork of her realizing she wasn't in control when she killed the oni and "beat" the test. We see her break her sword in the next episode, so i think maybe she should try to use it again in this one—and fail. This provides some really interesting stakes for Eichen & Scott's faith in her

Also i think scira deserve a talk about scott lying to her, and feel like this could be related to the crater in his chest he also won't talk about. I think his trust in Eichen could really elevated if Scira had a scene where Scott tells her the truth about just how big her fox is, and he trusts her not only with that information, but that she can still do it

Also also Scott and Stiles actually talk about Scott dying for heaven's sake!!! We needed it so bad and I think this would be a good time for it, especially as Kira finds out about it for the first time. Then we get a sciles hug bc i said so

How their varied fears of the nogitsune vs kira's kitsune plays in very heavily here, too

Ahem so anyway this resolves with a tense scene between Scott & Deucalion where you're really not sure if you can trust him at all, and afterwards Scott is worried he's making a bad call—and Stiles says it's okay, because he doesn't trust Deucalion, he trusts Scott, and Kira follows him up by saying that either way, this time, the pack will be there to back him up.

B-Plot

I hate Eichen so bad but I think it would've helped if Lydia had had scenes with Valack when she's more cogent/given more agency—maybe something that clarifies what he was doing with Peter at the end of s4 and how that led to her?

I feel like this would have to be in a mindscape, same as she has with Meredith, so Lydia is able to respond coherently/isn't just a prop to talk at

This could also clarify some of Valack's goals/motivations more concretely and foreshadow Lydia's victory over him in Lie Ability

C-Plot

Instead of Theo telling Malia he'll help her at the end of Codominance, their arc would be drawn out over the episode. This would heighten the tension of her having to depend on him, while allowing her to wrestle more explicitly with whether or not she's looking so she can kill the Desert Wolf, or to save Deaton

At the same time Scott is reckoning with his death, Theo is reckoning with Scott's resurrection—prompted, perhaps, by Corey having realized Scott was scared of Theo in the tunnels, the same way Corey was scared of Scott

Misc

I'd love a scene with Liam & his Dad—a werewolf reveal, preferably, +Liam processing his choices re: Scott & Hayden with someone that loves him, but is removed enough from the situation to comment on Liam's responsibility

I could get a Deaton & Corinne scene, as a Treat<3

#teen wolf #scott mccall #kira yukimura #stiles stilinski #theo raeken #malia tate #lydia martin #liam dunbar #s5 #teen wolf meta

[thecarnivorousmuffinmeta]

What if, after dying at the end of Death Note, Light Yagami woke up in the body of Bella Swan just as she’s arriving in Forks?

"Ah, so this is Nothingness," Light muses to himself, having been told by Ryuk already that there is no afterlife for humans, that we each instead enter Mu, the great nothingness, and cease to exist. It's a lot more American and feminine than he expected.

Slowly, Light realizes he's actually been reincarnated. His ID tells him he's an American girl named Bella Swan, seventeen years old, from Phoenix Arizona. The year is also 2006, which oddly puts him back in time several years (Light died in 2010).

Even odder yet, he sees no signs of Kira, when Light was very much active during 2006 and had been for a few years by that point. While he knows Japan was very central to the Kira case, given it was confirmed he was in the Kanto region and thus likely Tokyo by L to the national public, America had been paying attention as had everyone else.

There wouldn't be no sign of him.

Light reluctantly has to conclude he's in a kind of parallel reality or perhaps a dream world (this dream world theory growing stronger when he learns that Bella Swan's father is the chief of police, who has similar qualities to his own father).

He's not sure how he feels about this.

Towards the end of his life he'd purposefully alienated himself from his family and then Kira had done the rest.

His father, who had always been a workaholic, became even more of one with the Kira case and then died believing Light was innocent.

Sayu was kidnapped by Mello and never the same afterwards.

His mother was left to deal with the aftermath of both his father's and now his own death. Leaving him to wonder, of course, what the task force decided to tell them of why Light didn't come home.

Now he's living someone else's life, and she's estranged from her family as well, having left the mother she'd always lived with and moving in with a father she appears to barely know.

"Am I being punished?" Light wonders to himself.

He gets to school and he's certain of it. There's some kind of yokai there, the Cullens, who look in their own way more inhuman than Ryuk. In Biology he's confronted by one and becomes certain it's intent on killing him when he has no access to any notebook and is in a much weaker, clumsier, body than he'd ever been in life.

When, however, instead of dying painfully he finds out Edward ran away...

Light finds himself mildly intrigued. Alright, this universe is annoying, his work was wiped away, he has no means of becoming Kira again, and it appears ayakashi/yokai/mononoke are pursuing him, but something here is happening and it could give him a clue as to what this world really is.

And Light finds himself playing a familiar game he played with many women before, charm Edward Cullen.

As Light's very quickly able to pinpoint what it is Edward wants in a woman, he avoids an untimely death, and canon proceeds unhindered until Light realizes. Oh no. This demon actually really does want a relationship with him while hungering for his blood. Light's read those folk stories.

Light takes the Paranoid Bella route until the Volturi alternative presents itself, and while hating the idea of being subservient to these warlords, he does appreciate the cause of murdering man eating demons and it gets him away from Edward.

#twilight #twilight meta #twilight headcanon #twilight renaissance #death note #death note meta #death note headcanon #light yagami #bella swan #edward cullen #anti edward cullen #meta #headcanon #opinion

[muffinmoonn]

introducing some ocs here, i wanna make em into a comic

Amy and Bella are the main couple. Amy knew Bella in highschool and Bella looked up to her. Now Bella’s cool and butch and wants to sweep Amy off her feet but Amy’s having a hard time for some reason…

Bee and Avery are the first side couple. Avery used to be a smart stoic beauty in highschool and Bee hated her bc she thought she was stuck up. Now they live in the same apartment complex. Bee initially thought Avery was a cool guy but now her feelings are mixed

Kira and Melody are the second side couple. They are childhood friends who became estranged after highschool bc Melody moved away and transitioned. But now Melody is back in town but Kira doesn’t know that Melody is her childhood friend and Melody doesn’t know how to tell her

Here’s a relationship chart. Amy, Bee, and Kira are all highschool bffs

#oc #original character #muffin art

[thewintersoldierdisaster]

happy halloween - have a few, quickly-written little headcanons on the svech babies and their halloween costumes 🎃

evie’s six months old for her first halloween and you go a little nuts buying a bunch of different costumes but she ends up going as a little bunny, complete with a stuffed carrot and everyone freaks out over how cute she is

you and andrei also wear bunny ears to go as a little bunny family

alina’s only three months old for her first halloween and evie’s almost three so you go for a family costume again - this time it’s winnie the pooh characters. andrei is tigger, evie is pooh, you’re eeyore, and alina is piglet. the costumes are so freaking hot so you’re glad it’s actually a cold halloween in raleigh for once

when you zip andrei into the giant onesie, he shakes his head and laughs, “didn’t think i would be so damn happy to dress up in an adult onesie, solnyshka.”

kira is eleven months old at her first halloween and walking, but none of the girls want anything to do with a family costume since they all have their own choices. except then it’s two days before halloween and the bigger girls both decide they hate their costumes and want new ones - daddy to the rescue. disney princess family costumes here you come

evie is sleeping beauty, alina is ariel, kira is cinderella and they’re all very very excited about the twirly dresses

andrei has a wicked look in his eye when he pulls a fourth and fifth costume from the giant box - a yellow ball gown for you and a prince costume for himself - belle and the beast

“my hair’s even long enough,” he grins, having been too busy to get a haircut. he’ll never admit it, but he’s just as into the family costumes as you are

by the time dimitri is born, he’s only two months old and you’re exhausted. andrei handles halloween again - the girls go as different superheros (wonder woman, supergirl, and batgirl) daddy’s wearing a batman mask and a huge goofy grin

dimitri gets a little teddy bear onesie, complete with ears and little tail, so he can be warm and bundled while you push him in the stroller as the girls trick or treat. andrei has a little superman shirt that he puts on over dimitri’s onesie because he “has to match the rest of us, solnyshka”

“i’m not dressed up to match you guys”

“don’t worry about that, i have just the thing”

andrei produces a t-shirt that says “super mom” on it for you and a little matching cape that he hooks around your neck with a kiss to your cheek

maks is just about a month old for his first halloween - he gets dimitri’s bear onesie and one year old dimitri is in a little elmo from sesame street

there’s a period of several halloweens where both boys only want to be daddy for halloween and traipse around the neighborhood in their svechnikov jerseys and helmets, insisting on carrying around sticks until they get bored and you end up carrying the sticks

evie bosses her younger siblings around one year because she wants to be dorothy from wizard of oz, but needs her cast of characters. so. kira and alina end up as the wicked witch and glinda, respectively. you’re the scarecrow, andrei is the tin man, dimitri is the cowardly lion, and poor little maks ends up as toto

the year the kids all decide to do their own different costumes and don’t want to do a coordinated family one is a dark year for andrei - he pouts and complains about the kids growing up, so you promise to do a couples’ costume with him and that’s how you end up dressed in matching pirate costumes with andrei’s hand up your skirt most of the night and a brief pregnancy scare six weeks later

#andrei svechnikov #andrei svechnikov x reader #andrei svechnikov x you #andrei svechnikov headcanon #andrei svechnikov fic