This would be that interrupted ad that you won’t skip. 😉
Hey guys!! Well, I think it’s about time that I make a pinned post. I’ve been wondering for a while how to write it, how to properly transfer the thoughts in my head into words. When things get overwhelm in my head, I usually like to write it down on my notebook and draw a cloud frame around it. That’s exactly what I’ll do so bear with me :)
☁️ Introduction (Myself): I don’t share my real name here, but I’ve always use Eden as my alias because it sounds similar to my chinese name and with that said, I’m of chinese descent, living somewhere in South East Asia (SEA). I’m a ‘93 baby, single and straight. Height, 166cm and my weight is… 🤫😂 As for my chronic illness, I have Discoid Eczema and I think WebMD would explain it to you more better than I do xD
☁️ Introduction (My blog): My blog is obviously 18+ and MDNI. You can ask me any questions that you have but all I ask in return is that you ask me privately through my inbox or DM and keep it respectful. As for my posts, I will not be posting as frequently as I have been doing so far because the eczema has gotten worst and I don’t have the right headspace and heartspace to do so. But, I will always be here to check the messages and reply to them so you can still find me there.
☁️ My K!nks: I try to be an open-minded person and I love a good “experiment” time. So I would say that I don’t have a particular favorite and that I love a little bit of everything that is in the k!nky category.
☁️ Conversation with me: I love dirty-talking as much as the next person but for me, dirty-talk depends a lot on the right time, right flow and right vibe. Honestly, if you’re able to hold a deep conversation with me in the first place? You’re already halfway there to my heart. And if you need a few topic ideas;
•Dad Jokes •Fiction Books •TV Shows/Films/K-Dramas •Jensen Ackles •My Bucket List (Both normal and naughty ones) •Tell me about your pet dog
☁️ Not that kind of girl: I don’t have an OF account or in any pør^ industry. I don’t have “special” content to sell. So please, please, please, DO NOT dm me asking to buy contents and NEVER send me DPs that I DID NOT ask for! Also, I’m flattered but currently not interested to be a sugar baby or to be “owned.”
☁️ Safe space: My blog, my DM is a safe space and judgment-free zone. Whatever you share with me will stay between me and you. Whether it’s a dark k!nk or you just need a stranger to talk to or a shoulder to lean on, I’ll be here. I may not reply as fast as an F1 racer but I’ll be here.
That’s about it, and like I said, you can still reach me through my DM anytime. Stay healthy, play safe, and may you be k!nk!er than yesterday, my loves 💋😉
haaiii I'm jeffthekillerzblog u can call me jeff OR if u know me personally u can refer to me as boba!! ^_^
joined this blog bc ticciwork is AWESUM plus i thought it'd be fun to share a blog w a bunch of friends !!
he/him for this blog
I really love jeff. im jeff irl. if u wanna see my cool ass jeff art n stuff OR just my other creepypasta content in general, you can check out my main blog, @jeffthekillerzblog
𝐓𝐇𝐄 𝐆𝐈𝐑𝐋 𝐈𝐕𝐄 𝐀𝐋𝐖𝐀𝐘𝐒 𝐁𝐄𝐄𝐍 ! ry. 𝜗𝜚 she/her , american , november 10th. oscar piastri’s irl wife! avid pinterest user! cuntry girl, ill yap your head off if you let me. fave drivers are op81, gr63, aa23, & ln4.
🦢ྀི ₊˚⊹ ──── masterlist !
𝜗𝜚 ( you are in love ) ── op81. sfw. oscar piastri is head over heels for his best friend, though he keeps his feelings a secret until his first formula one gp win.
𝜗𝜚 ( he said baby that’s what he called me ) ── op81. sfw. oscar’s plans for a date for him and his girlfriend after feeling bad for being busy all week, but ignoring how tired he’d been turns out to not be the best idea.
𝜗𝜚 ( i know aristotle ) ── ln4. sfw. smau x irl. y/n is the younger sister of world champion max verstappen and an author known for her young adult romance novels despite never being in a relationship herself. lando norris is a formula one driver and is secretly an old friend and a fan of her books since 2020. 1,
🐈ྀི ₊˚⊹ ──── important info !
𝐋𝐎𝐕𝐄 𝐈𝐒 𝐄𝐌𝐁𝐀𝐑𝐑𝐀𝐒𝐒𝐈𝐍𝐆 ! I only will write about f1 most likely. i don’t write anything to explicit or nsfw so don’t expect that! i’m newer to tumblr so i’m still working out how to use it but once i do i’ll prob open up requests!
𝜗𝜚 i love to make friends and talk to people so feel free to interact! i will talk your ear off about f1!
heyheyHII!!! welcome TO MY BLOG!! i'm Bird , your hHOST !!!!!! here i'll be posting KinitoPet art ;; canon, fanon, about MY AU ,, B:DW ((i'll get to that later) when some hyperfixations SLIP THEIR WAY IN !!!, and MORE MORE MORE !!!
she/they, minor above 14, filiPINO !! (GMT+8) timezone
basic DNI criteria (just dont be an overall a-hole pretty please<3) and KINITOPET ARTISTS/FANS/THEORISTS pleasepleaseplease interact AAAAAhGHGHG/silly
i ABSOLUTELY ADORE kinitopet askblogs SO YOU MIGHT SEE ME IN THOSE .... quite A LOT !!!!! using the SIGNATURE: -🕊️
uhh WHAT ELSE...my tags are: (#birdyfy art , #birdify answers , #birdsy rambles LOUDLY , #B:DW!AU (birdysdigitalworld) ,) and i draw uhhh comics and have recently been getting silly kinitopet requests<33 L;OVE YOU ALL YOURE SO KIND WAAHH I LOVE TUMBLR SM
ೋღ 🕊️ ღೋ
B:DW!AU (birdysdigitalworld) AU info down beloowowowowowo: (RAMBLERAMBLE) ((recommended to read if you want to send asks related to it ((most, if not ALL my art of kinitopet will be set in this AU
my kinitopet AU is set IN THE MODERN TIMES !! with the technology AHH EVERYTHING !! it's POST-CANON wherein the user (who i mostly represent as,,,ME, birdy) chose to STAY WITH KIN!! in this timeline the user first met/downloaded kinito on the old ass computer, and THEN relocated him to a more MODERN desktop !!!!
this is mostly a FEEL-GOOD AU where kinito has been redeemed and no one has to get sucked into code<3(at least, not yet) as the user teamed up with 'nito, agreeing on a VR-type environment. user gets to put on the VR headset with their own avatar and everything and see kinito DIGITALLY !!!!
kinito REPROGRAMMED the world he made for them both and put it in some kind of ,,, vr chat setting idk...oh also the user is experienced w/ programming
when asks are sent, it shows up on the "screen" if the user isn't in VR, and shows up in the "sky" if they ARE !! most asks will be shown as a png/image canonically that the user gets through their NOTIFICATIONS unnLESS the asks are embedded in some kind of . physical (digital) body. or an avatar. like if an anon wants to hug someone they'll have a physical body.....ouu..i;ll draw those LATER!!!
the "digital world" is mostly the lobby/hub for where i stage all my asks<333 the user is THE HOST and kinito is EVERYONE'S FRIEND !!
ok more stuff whne i post art about it<//3 HELP if you actually read thru all that i lysm<33/platonic
my fav music artist are the arctic monkeys, lana de rey, and alex g -‘๑’-
my favorite animals are cats ੈ✩‧₊˚
my tops movies have to be the outsiders, mid90’s, the breakfast club, the florida project , little women, and ladybird ⍣ ೋ
my favorite show is skins and young royals *+:。.。
•this is honestly because i don’t want anyone to think of the wrong thing or to confuse my age (also to show my interest). But again i am a minor please be respectful of that. I don’t mind any dms because i am bored and usually im doing nothing.
Please submit your own stories to be judged by the court of tumblr! Each story will come with a poll, judgements are as follows:
YTA=You're the asshole
NTA=Not the asshole (the other party is)
JAH=Justified asshole (you’re an asshole, but like, I get it)
NAH=No assholes here (everyone is some level of justified)
ESH=Everyone sucks here (you're all assholes)
INFO=Not enough information to judge (answer questions via reblog or reply, NOT my askbox please!)
Ready to submit yours? Read the FAQ first! (If it doesn't open for you on mobile, try opening it in your mobile browser instead of the app)
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
For some unfathomable reason, Tumblr has decided to suggest my blog to brand-new accounts to follow, so I've had a crazy influx of followers who, of the ones that are genuine accounts, probably have no idea what they've signed up for. (sorry.)
Oh, and I also have some new bittern-loving followers who have a slightly better idea but might not know the whole story!
So, here's your chance to escape, if you so choose.
Anyway, I'm Bob! I've been here since like 2012. I mostly make comics, but I also do some prose writing, game dev, and general shitposting. Should you choose to continue following me, you will be subjected to such content as
Canada geese.
Like... a LOT of Canada geese.
Also ferrets, the love of my life. And other art and general musings about my favorite animals, including but not limited to bitterns, grebes, pheasants, parrots, crayfish, eels, every single other type of mustelid, alpacas, etc.
But, because I can't be bothered to make myself a consistent "brand," I also make
Very Gay Comics.
I can't emphasize this enough, because I kinda suspect all those plumbing company blogs didn't know this before following me. I make very gay comics.
I'm working on a new webcomic called Into the Smoke that's gonna launch soon. It's about a gay medium who binds himself to a killer ghost, and I think my new follower with the car financing blog is gonna love it.
Lots more on that soon.
Anyway, I don't want to make a super long post. I just want to make sure y'all understand that if you follow me, you will get
You're dead.
Or, at least, you should be.
You remember what it felt when the bullet pierced your chest, the blood rushing out too fast, too much to stop.
The man in red smirking above you.
And yet, here you are. Alive. Safe in bed.
One week before the day of your death.
Redo; Rewind is a story about time. Of an ordinary person working an ordinary office job. Sure, you might work for an info broker and, sure, you sometimes (often) commit acts of corporate espionage for said job, but that's just business.
This is something far beyond that ordinary life.
Time travel. It seems you of all people are capable of it. To manipulate time and bend it to your will. It may not be something you asked for, but you need it now more than ever.
Someone wants you dead. And they've already succeeded once. You can't allow it to happen again.
(Please note that Redo; Rewind is currently rated 18+ for depictions of violence/death, references to drug and alcohol use, explicit language, and heavy themes.)
Play as a customizable MC! Choose your MC’s appearance, gender, skills, and more!
Romance, befriend, or antagonize any of the 3 romance options.
Learn how to master your time control ability and use it to your advantage.
Avoid past mistakes and inadvertently come up with new, much worse ones!
Try not to die. Again. And again. And again...
Victor/Victoria Zhang [M/F] - Your boss and owner of VZSystems, the front for their true work as an info broker. Clever, professional, and cold—a classic business major. That's how they appear, anyway. Having worked for them for sometime now, you know that, despite their intimidating appearance, they hide a much softer side underneath. Will you maintain the status quo as employer and employee, or will you cross the boundary set by your positions?
August Astaire [M] - Hitman, assassin, whatever you want to call him, the man's a killer. That much is clear after he put a bullet through your chest. But is that all there is to him? As arrogant and cruel as he seems, you can't help but wonder if there isn't more to him than meets the eye. Maybe if you play your cards right you could even turn an enemy into an ally. But, even if he plays for your team, how much can you really trust him?
Amara Ingram [F] - Your coworker of about two months now. You don't know her well yet, but she seems genuinely kind, with a good sense of humor and a sharp mind. Since being hired, she's quickly earned her place, proving to be an invaluable asset with her skill in engineering and programing. Undoubtedly, someone you're glad is on your side, but could your feelings for her extend beyond the professional?
[Demo] - Available Here! (Last update: March 23rd 2024)
You’ve ruled the Duchy of Akize, the southwesternmost duchy in the Kingdom of Ribaur, for 15 years, since the year 1107 ME.
15 years ago, your Liege had your parents executed for a plot they had no part in.
Despite becoming a ruler while only a teenager, your lands have done well - no thanks to your Liege’s proclamations. Despite the annoying interference, you would have been content to just administer your lands and pay your taxes.
But one day, your Liege goes too far, and wrongs one of your siblings - personally.
You’ve had enough. You and your siblings will chafe no longer under the yoke of that tyrant. You will be free from oppression - whatever it takes.
Choose your character's name, the name of their noble house, and whether they are a Duke (male), Duchess (female), or Dux (enby).
Choose which foreign land your mother hailed from - such as the northern court of Ostroway or the island nation of Sayland.
Pick the type of education you received - were you taught how to use the shadows of Intrigue? How to construct Martial strategies? Or something else?
Interact with your friends and family, possibly including your foreign cousins.
Choose how to deal with your Liege - will they be put on Trial, will you lead an armed Rebellion, or will you take to the shadows to have them Assassinated?
Pick from four gender-selectable ROs - two fellow vassals and two foreign nobles.
Deal with various interest groups - such as the Peasants you rule over, your fellow Vassals, the religious head known as the Hierophant, and more.
Ordinor Ultor takes palce in a low(ish...) fantasy world, with the protagonist's home country of Ribaur being inspired by medieval France.
I'm relatively new to coding, so I can't promise a concrete update schedule yet (also, if anyone has any advice and/or resources for me to use, I'd be very grateful!). That being said...
DEMO BY APRIL 29TH 2024
Project DARK is an 18+ character-driven SPY IF inspired by a rather eventful weekend binging on Mission Impossible movies. It can be described as Suicide Squad meets Mission Impossible. MC, a retired villain, will be a new operative in a team to bring down their old best friend.
You were a jewel thief and hired mercenary, outsourcing your skills at thievery and espionage for all types of...shady characters. Yeah, you were aiding in the possible destruction of the world in exchange for money, but details, right?
You were the best in the business alongside your partner, Spider. You're not supposed to get close to people in this business, but Spider somehow weaseled into your life and became your best friend.
But then they died, killed by operatives of Mission Shadow, the one organization that has been hunting you down since day one. You decided to retire, changing your name and identity in an attempt to make an honest and private life of what you have left.
Until Project DARK finds you.
Project DARK: an experiment to put the most together the most skilled shadow villains to train and defeat the biggest threat they've faced.
Your best friend, whom you thought was dead.
They need you and your skills. You know Spider best. No longer are you the villain, but a Project DARK operative joining as the newest recruit to the ranks.
Good luck.
Customize your operative from appearance, personality, gender identity.
Tailor your past: were you a merciful villain, or a merciless one? Did you make enemies or try to make friends? Liked for being kind and easy to work with or hated for being the literal worst?
Romance members of your team or your target, with some having special relationships.
Choose what kind of operative you'll be and shape the dynamic of the team.
Try not to fall into old habits and get sucked into the dark world of crime. You left that life for a reason.
THE TARGET | Spider [m or f]: your old best friend and the new target. They've been busy since their 'death' and have grown a network of connections that can dismantle the world as you know it. They're apparently planning something big. Big enough that the organizations of the world created Project DARK to take them down.
Special romance: can have had previous thing with them that was never confronted or simply have been best friends.
THE LEADER | Elias/Elena Steel: one of the best operatives, personally recommended by MI6. The only non-villain on the team, E is also appointed leader and doesn't like you much, considering the fact that a mission of yours ended with their closest partner dead. While you may have not pulled the trigger, E blames you all the same.
Strict and as cold as steel, it makes sense why E is the one with the team on their shoulders.
Special romance: enemies to lovers. E hates your guts.
THE SECOND IN COMMAND | Nick/Nina Sharma: second-in-command and a retired illegal weapons dealer, N is, surprisingly, E's closest friend. N has long given up that life, but before their new work as a operative, you knew them as a distant associate. You two have crossed paths on multiple occasions, most of them happening with them almost killing you or vice versa. N can't help but be nice, but you can tell they're not really a fan of you.
Special romance: may have had a lapse in judgement and have had a one night stand...or multiple.
THE BRAINS | Zane/Zena Omari: One of the most skilled hackers and a familiar face on the FBIs most wanted list, Z is on the team in order to be able to go back home without getting arrested. Oddly enough, they're not what the media says they are. Friendly, warm, comedic. Z seems to be having too much of a good time, even with the circumstances surrounding their presence.
THE WEAPONS EXPERT | Luca/Lucia Cruz: L doesn't know you much, and doesn't care to. Hyper-focused on the mission, L's disinterest in you is a breath of fresh air. You don't know what they did and how they got here, but you do know they were facing a life sentence. Still, things aren't always what they seem.