#Birds Paradise | Explore Tumblr Posts and Blogs

undergroundrockpress · 1 month

Text

London Transport Bus converted into a mobile boutique Birds Paradise, 1967.

#60s photography #60s fashion #Birds Paradise #swinging london #1967

245 notes · View notes

pop-art-sixties-seventies · 4 days

Text

Boutique mobile Birds Paradise, 1967.

#Birds Paradise #1967 #fashion

27 notes · View notes

ur-daily-inspiration · 4 months

Text

Pigeon wings under a UV light

#animal #animals #birds #bird #birdblr #photography #aesthetic #nature #naturecore #cottagecore #landscape #paradise #adventure #explore #travel #tiktok #cute animals #baby animals

68K notes · View notes

daily-spooky · 3 months

Text

#vampires #birds #birdblr #photography #animals #cute animals #landscape #paradise #nature #adventure #goth #gothic #witchcore #wicca #alternative #grunge #soft grunge

5K notes · View notes

milagro24 · 19 days

Text

2K notes · View notes

stickynotebirds · 2 months

Text

275. Superb Bird-of-Paradise

#todays bird #birdblr #artists on tumblr #birds #bird of the day #bird #Superb Bird-of-Paradise #requested by #anonymous

3K notes · View notes

ybon-paramoux · 3 months

Text

Buko Juice in Paradise

#art #photography #nereyda bird #buko juice #coconut #tropics #paradise #melanin #ebony #black tumblr

3K notes · View notes

10piecechickenmcnugget · 7 months

Text

“mojang should add this” “mojang should add that” mojang should add more BIRDS

#10piecetalks #minecraft #mojang #i want HAWKS and FALCONS DAMN IT #I want birds of prey in minecraft #and maybe some cooler birds of paradise

4K notes · View notes

herpsandbirds · 8 months

Text

King Bird-of-Paradise (Cicinnurus regius), male, family Paradisaeidae, Aru Islands

Photograph by Dustin Chen

#bird of paradise #cicinnurus #Paradisaeidae #bird #ornithology #europe #animals #nature #New Guinea

4K notes · View notes

smoosie · 8 months

Text

Birds of Paradise

#Crowley #good omens #good omens fanart #david tennant #anthony j crowley #fanart #green is my favorite color but I don't get to use it often #also these plants are really called birds of paradise in case you were wondering #I also came to realize that I almost never draw canon!Crowley... °°#mine

3K notes · View notes

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)