Seven(ish) Sentence Sunday ✍️
Tagged by the über talented @wikiangela and @lover-of-mine 💕
Have more than seven sentences from the scene that was fighting me and causing grief from stuck now so long, we just got the start wrong aka rival firefighters 🚒 prev snippet
“What is up with you today?” Buck licks his lips as he shifts on his feet slightly, waiting for Diaz’s answer.
“Excuse me?” Diaz looks taken aback and okay Buck gets it, the guy who constantly flirts and teases you is suddenly asking you a legitimate question of concern? Buck would be shocked too.
“Something’s obviously crawled up your ass today, so spill.” Diaz pushes past Buck without responding, Buck hot on his tail with no brain to mouth filter working it seems because he can’t stop himself from adding “Is it me? Though if I’d been in your ass, I’d definitely remember it.”
Diaz whirls on Buck with fire in his eyes. He looks pissed and fuck is it hot. “Do you even hear yourself when you talk?!” He steps into Buck’s space, pointing an accusatory finger in his face.
Buck brings his hands up to push Eddie away but before he can make contact Eddie jolts back as if repulsed by Buck's touch. “What is your problem, man?”
No pressure tagging: @hippolotamus @spotsandsocks @watchyourbuck @callmenewbie @fortheloveofbuddie @thewolvesof1998 @athenagranted @rainbow-nerdss @exhuastedpigeon @the-likesofus @eddiebabygirldiaz @theotherbuckley @wildlife4life @ladydorian05 @loserdiaz @evcndiaz @try-set-me-on-fire @spagheddiediaz @malewifediaz @devirnis @disasterbuckdiaz @fiona-fififi @giddyupbuck @hoodie-buck @honestlydarkprincess @jeeyuns @jesuisici33 @jamespearce9-1-1 @clusterbuck @captain-hen @bekkachaos @monsterrae1 @mellaithwen and all others who want join in on the fun 😄
79 notes
·
View notes
PLEASE, LOVE ME. PT 1
simon riley / reader
FIND PART TWO || read the full thing on ao3
tags: childhood friends, friends2lovers, virgin!reader, soft!simon, protective!simon, afab!reader, hurt/comfort, angst with a happy ending, MDNI
cw: reader is over 20, pining, masturbation (reader), loss of virginity, explicit workplace sexual harassment/assault, so much crying, one-sided love, not-really-unrequited love, vomiting, panic attacks, depression, crying, sex related shame, PTSD (reader), codependency but cute, self-deprecating thoughts, slut shaming, wet dream, dry humping, simon fucks up tho, reference to suicide & suicidal ideation, really nasty argument, reader hits simon sorry, apologizes tho!!!, reader struggles to orgasm, drinking, fooling around while drunk (no sex), breast play, fingering, orgasm denial, simon's a tease, p-in-v, cunnilingus, multiple orgasms, creampie, mating press, missionary, simon's dirty mouth, dirty talk, wet&messy, big cock, uncut simon bc i said so, reassurance & encouragement, some pain upon penetration, clit spanking, post-coital crying!!!!!!, aftercare, briefly edited so apologies for any lingering mistakes
note: any triggering acts such as harassment/sa are done by a third party, not simon!!! also the sa is not vague or implied, there is a written out scene so please be mindful when you read! thank u to @allsaiint for reading over this and helping!
you've loved him since you were children. after a confession when you were 14 went rejected, you vowed to never let your feelings be known again. but after an incident that left you hurt and fragile, you find it hard to keep that promise.
part 1: 17.8k
total: 35.8k
Your muscles were stiff, thighs twitching and trembling as you laid in bed, staring at your water stained ceiling. Your chest rose and fell in time with rapid breathing. You had worn yourself out, caused a wet spot on your bed, yet you remained completely unsatisfied. Your fingers were cramped up and you let out a groan of frustration, rolling over to crawl out of bed.
It had become a daily ritual at this point, you with your hand between your thighs, rubbing and touching, only to get into the shower completely unsatisfied and embarrassed at your own inability to get yourself off.
People your age didn’t struggle like this, you convinced yourself. Your cheeks burned as you stepped under the warm spray from your showerhead, the creaking pipes just background noise to you now. You were broken, that was the only explanation you could think of.
By the time you got out of the shower and changed your sheets, throwing the dirty ones into the washer, it was evening and a familiar knocking rang through your apartment.
You didn’t even have to answer it before the lock was clicking and the large form of your best friend Simon ducked in.
“Hey, Simon!” you called cheerfully, excitedly bounding into the room and wrapping your arms around him in greeting.
He grunted, harshly patting your back in the familiar way he always does before kicking his boots off. When he straightened up, his eyes narrowed as he looked down at you.
“What's with you?” he asked, a thick, dark brow raised suspiciously.
“Um,” you stepped back, shrugging as you tried to look nonchalant, “What do you mean?”
“You look…” his eyes raked down your body, clearly assessing you, “You look tense.”
Immediately, your cheeks erupted into flames. Your face felt so hot that you had to bring your hands up to cool them before laughing nervously, “That’s no different than usual.”
He was silent for several, long, grueling seconds before grunting and breezing past you to the kitchen, clearly letting it drop. You took a moment to catch your breath before following him, finding him hunched over looking into your barren refrigerator.
“Where’s all your fuckin’ food?” he snapped, straightening back up with a huff when he heard you come in behind him.
“Didn’t get a chance to shop this week, Si,” you replied stiffly, crossing your arms over your chest.
“Why?” he demanded, slamming the appliance closed before heading to your cabinets to do inventory there too.
“Paycheck was short again this week,” you answered, speaking quietly in hopes he wouldn’t look into it anymore than that.
He angrily slammed a cabinet closed and leaned on his palms against the counter, head hung between his shoulders, “Your boss fuckin’ stiff you again?”
“I-It’s not a big deal, Simon–” you attempted to quell him.
“Not a big deal?” he snapped, slamming his hands down on the counter, making you flinch at the noise. You knew Simon would never, ever hurt you but his anger was something to behold nonetheless, “It is a big deal when you can’t even afford to fuckin’ eat!”
“Simon…” you whisper, anxiously picking at a string on your cotton shorts, “I wasn’t going hungry, I have like…ramen and stuff…”
He says your name through gritted teeth, letting out a frustrated sigh, “Why didn’t you tell me that you couldn’t afford proper groceries?”
“I didn’t want to bother you with it, Si,” you mutter, “I-It’s my problem, not yours.”
He gives you a long, unblinking stare. His usual soft, puppy dog brown eyes now felt intimidating. One thing about Simon was that he never hid it when he was clearly upset with you. And knowing he was right now made you hang your head pitifully.
He moves suddenly, tugging his wallet out of his back pocket, pulling out a small stack of clean bills, slapping them on your countertop.
“Simon, no–” you attempt to reach out for them, willing him to take the money back.
He grabs your hand immediately, shoving the appendage away from the money, “You’ll take this and you’ll go to the store tomorrow and get some damn food or I’m going to go to the bar and wrap my fuckin’ hands around your boss’s throat until he coughs up your money.”
“You don’t have to do this, Simon!” you argue, exasperated, “Y-You don’t have to take care of me like this.”
“Yes, I fuckin’ do!” he counters, “You’re my responsibility and I’m not going to let you exist on fuckin’ cup noodles until that shithead pays you properly, not when I can take care of you. Now stop arguing and put this in your wallet now.”
He used that damn Lieutenant voice, leaving no room for argument. You bit your lip and slowly picked up the bills from the counter.
“Thank you, Simon…” you whisper, clutching the money close to your chest as you offer him a wobbly smile.
“Shut up and go,” he huffs, though his voice is much softer and affectionate now.
You turn on your heel and go to the table by the door, slowly taking the time to place the money safely inside. You felt tears pricking at your eyes. You were so, so lucky to have someone in your life that did everything in his power to take care of you, to look after you and make sure you had food on the table. No one had ever cared about your well-being the way Simon did, and your heart felt incredibly full because of it.
You could hear him still stalking around the kitchen, grumbling to himself in annoyance. He comes out of the kitchen, phone in hand, before he’s taking a seat on your old, creaky couch. His knee is bouncing up and down in that way it always does. It’s like he’s always a live wire, ready and waiting for something to happen.
“Is something wrong?” you ask, still standing by the table.
He grunts, shaking his head, “Orderin' dinner.”
“Oh,” you mumble, “What’re you getting?”
“Gettin’ from that breakfast diner you like,” he responds quickly, not looking up from his phone.
“You don’t even like that place,” you giggle, “In the mood for a breakfast sandwich?”
“Not for me,” was his clipped response.
“What?” you whine, “Simon, don’t order me food!”
“Did you eat today?” he asks quickly, placing his phone on the table, clearly done with the order.
“I had cup noodles!” you point an accusing finger at him, “So yes!”
“That’s not real food,” he leans against the back of the couch, closing his eyes with his arms crossed over his chest. End of conversation.
You sigh, shaking your head. You debate continuing to pester him about it but you hear your washing machine begin to ring the jingle signaling the cycle is finished. You cast one last, unseen glare to the man on your couch before heading to the washer, methodically taking the now clean sheets out.
You finish placing it in the dryer and turning the machine on, stepping back into the living room when there’s a knock on the door. Simon is on his feet in seconds and at the door before you can even react. When he slams the door shut, he holds the bag of food up for you to see, dropping it on the coffee table before taking a seat again. He resumes the same position, arms cross over his chest and eyes closed.
“Are you tired?” you ask softly, taking the empty seat beside him. He hums in response, “You want to spend the night?”
“Guess so,” he responds after a few seconds, “You work tomorrow?”
“Tomorrow night,” you mumble, reaching for the bag of food, untying the knot so you can get inside, “I hate working Friday nights.”
“I can stop by tomorrow if you want,” he offers, finally opening his eyes.
You think it over for a minute. It wouldn’t be the first time he sat in the bar on a busy Friday night, nursing a half-drunk bourbon, as he waited for you to get off, “I think it’ll be okay. Last week was fine.”
He simply stares at you in silence before sighing through his nose. But he doesn’t argue and you’re thankful for that.
Simon’s been looking after you like this since you turned 18 and moved out on your own. There have been many, many days and nights that you’ve taken up his time and energy and as you grew older, you tried to do it less. He had an incredibly busy job and life and the last thing you wanted was to add weight onto his already heavy shoulders.
The evening turned to night and before you knew it you had a full belly and leftovers to store in the fridge for breakfast. You folded your dried sheet and placed it in the hallway closet, acutely aware of the sound of Simon showering in your bathroom.
It wasn’t a very big shower and you sometimes wondered what it looked like for him in there. Surely he had to hunch down to properly wash his hair and shoulders. But those thoughts always turned into something less than innocent.
You imagined what he looked like, all wet. How big he surely looked in there, no doubt he would dwarf you. He would be able to easily crowd you in the corner, make it so you couldn't escape as he blocked the exit – not that you would want to escape.
You slapped a hand against your forehead, shaking your head violently to rid yourself of those thoughts. You tugged a spare blanket out of the closet and slammed it closed, rushing to your bedroom to place it on your bed.
Your cheeks burned with shame over having such unsavory thoughts about your best friend. As much as you liked to pretend that the crush you had on him when you were children had faded like typical puppy love, you knew your feelings were alive and well deep inside where you had pushed them when he rejected you when you were 14.
It was just because you were so pent up, you convinced yourself, you would have those thoughts about any man that was inside your shower!
You crawled onto your side of the bed, flopping back into your pillow as you waited for him to come in. You completely ignored the throbbing between your thighs, a feeling you were more than used to by now. But your fingers itched to reach down, slip beneath the band of your shorts and touch your clit, the little bud throbbed so desperately that when you clenched your thighs together, a shiver would go down your spine.
Just as you started to reach down, just to try and relieve the ache that settled there, the bathroom door opened. You yanked your hand back up and tried to look casual as you heard his heavy footsteps move towards the bedroom door.
He pushed the door open wider so he could come in, having to duck his head down to avoid hitting his head. He placed his towel in the laundry basket and slowly crawled into bed beside you, placing his pillow flat so he could comfortably lay down.
Some people may find it strange sleeping with him like this, but your couch was much too small for him and he would rather cut his own fingers off than make you sleep on the damned thing. It was old and so uncomfortable that it caused you to be sore if you sat on it for too long. Plus, you never felt uncomfortable having him in the bed with you like this. He was warm and safe and he always smelled like your grapefruit body wash after he showered.
It made your heart thump in your chest, knowing he walked around the next day smelling like you.
“Goodnight, Simon,” you mumbled, reaching over to turn your bedside lamp off.
He grunted quietly, rolling over so his back was facing you. You smiled in the dark and snuggled down into your own blanket, closing your eyes as well.
The next morning, you woke up and the bed was empty. As usual.
Even when he was home, Simon functioned off of the strict military schedule he’d been accustomed to for his many years in the military. You sat up and stretched your arms above your head, tossing your blanket off of you. The floor was chilly against your bare feet, making you shiver.
After going pee, you ventured out into the living room. Simon was lounging, quietly watching TV – the morning news, it seemed.
“Good morning,” you called.
“Eat,” was all he replied, not even breaking his gaze off of the TV.
You purse your lips but do as you’re told – not because he said so, but because your stomach was painfully growling and the breakfast sandwich in the fridge sounded delicious.
As you heated it up in the microwave, you hummed to yourself.
“I’m going to go to the store after I eat,” you called, “Do you want to come?”
“Nah,” he grunted, “Gotta go soon.”
“Oh,” you tried to hide your disappointment, “Will you be back tonight?”
“Probably not,” he responded, your disappointment only growing at that.
The microwave beeped and you pulled your plate of food out, bringing it back to the living room to eat it beside him. He took up an absurd amount of space given how large he was and how small your couch was – but you didn’t mind being pressed up against him. You didn’t think he minded either because he never bothered to move away.
You quietly ate your breakfast, finishing up just as the news segment ended. Simon stood, knees popping as he did, patting his pockets to make sure he had his keys and wallet before pausing, looking around.
“You leaving?” you ask, placing your plate on the table as you followed his lead, standing.
“Got to,” he mumbled, still glancing around, “Where’s my phone?”
“You leave it in the bedroom?” you offer.
He sighs and disappears down the hall for a split minute before returning, tucking the device into his pocket. He grabs his coat off the table by the door, slipping it on and zipping it up. You approach him by the door, watching him slip his boots on and tie them.
“See you later, Si,” you say, trying your best to hide your disappointment at him leaving.
You never wanted him to leave, always feeling painfully lonely without his presence in your home. Since he was gone for long periods so often, you liked to enjoy his company as much as you can when he’s home. But you would never be the type to ask him to stay when he couldn’t because you knew he would run himself ragged to keep you company even when he was exhausted and had other things to do on top of it. You never wanted to be a burden to him.
He straightens up, stomping his feet a couple times to make sure his boots were on fine. He wraps an arm around your shoulder, pulling you against his chest. You wrap both arms around his middle and hug him tight.
“I’ll come by when I can,” he mutters, pulling back to press a kiss to your forehead.
Then he’s gone, the door slamming closed and leaving you by yourself in the doorway, already feeling an emptiness that would remain until he returned.
Just as you promised, you went out and bought groceries, courtesy of the money Simon had so kindly given you. You made sure you had some meat, fruit, and veggies, along with some canned goods. You made sure you didn’t buy cup noodles because he certainly wouldn’t be thrilled to know you bought that since he was so vehemently against them being in your diet.
When you got home, you put all the groceries away and quickly realized that you had some time to spare before you had to get ready for your shift at the bar.
As you sit on the couch, mindlessly watching some random show you’ve seen a hundred times before, you suddenly realize you’re squeezing your thighs together.
And your panties are feeling awfully sticky.
Your body heats up as you find yourself cupping your breasts through your shirt and bra. But you quickly realize that’s doing nothing for you and you strip your shirt off, pulling the sports bra over your breasts to cup them without the fabric restriction. You sigh and relax into the couch as you pull and pinch your nipple, tugging them and rolling them beneath your fingers. Your thighs clench and rub together as you tease yourself.
But you tire of that quickly, knowing you could do something that felt so much better.
Your fingers tremble as you tug the button of your jeans open and kick them off, letting your panties go down with them. You take note of the fact the center is completely sticky and wet. God, how long had you been dripping into your panties like that?
You lean back on the couch, placing your feet on the cushions, letting your legs open nice and wide. Your folds flower open, embarrassingly wet and shiny. Your clit is hard and swollen between them and you can practically see the bud twitching.
With two, shaky fingers, you reach down and swipe over the bud. Your entire body twitches at the contact and you sigh as you slowly circle it, using your own slick as lubrication.
You bring a finger to your entrance, prodding at the stickiness there. It’s embarrassing how wet you are. Your pussy makes loud noises as you touch but it doesn’t really provide you much pleasure so you bring your finger back to your clit.
You circle it, pinch it, and roll your fingers over it. You’re quietly moaning, lidded eyes hazy as you watch your fingers play between your thighs. It feels good, a warm feeling settling in your gut the more you touch yourself.
But then the inevitable happens – it’s like you hit a wall.
You whine in frustration, speeding up your movements to hopefully reach the edge that you know is right over the wall. But you don’t get any further, if anything you feel that warmth vanishing at an alarming rate.
Tears sting your eyes, “No, no, no…” you beg no one.
You grit your teeth in frustration, yanking your hand away to watch your pussy clench and throb over nothing, drooling and dripping slick onto the couch. But you’re too frustrated to try anymore.
You close your thighs and flop down onto the couch, letting a few tears escape.
“What the fuck is wrong with me?” you quietly complain, slapping the couch out of frustration.
Your lamenting is interrupted by your phone going off. You look at it on the table and see it's the alarm you set to let you know to start getting ready.
Great, you spent 45 minutes playing with yourself and still didn’t get any further than you had for the last 20-something years of your life.
You were starting to think you should schedule an appointment with a doctor and find out if you were well and truly broken, but quickly decided against it. That would be fucking humiliating.
What would you say, “Hi, I can’t make myself orgasm and never have, please doctor, tell me if my vagina is broken?” Absolutely not.
You collect your clothes from the living room floor and toss them in your laundry basket in your room before you take a very fast shower just to clean your own mess up. Then, you get dressed and ready for the shift you know is going to suck at the bar.
At the door, you make sure you have your belongings. You turn out all your lights and lock the door behind you before setting off to the bar.
It’s not a long walk, about 15 minutes away. But just the idea of stepping foot inside the bar fills you with dread.
It was a little hole in the wall place, shady and seedy were the best ways to describe it. You got pretty good tips from the patrons most nights but your boss was the biggest piece of shit you’d ever had the misfortune of being in close proximity with.
He had a very bad habit of putting his hands where they didn’t belong and cutting his employee’s pay for no reason – or reasons he completely made up. Your last paycheck was short because he claims that you ‘got enough in tips to make up the loss’ – you didn’t. And when you argued, he threatened to fire you.
You were already living in the cheapest flat you could afford; it was run-down and poorly maintained. But it was better than not having a roof over your head. And it was a fight to even get hired at the shitty bar you worked at now, you weren’t willing to go back to looking for work.
So you simply bit your tongue and took what money you could get. It wasn’t the first time he did it and you were sure it wouldn’t be the last.
You got to work as soon as you clocked in, greeting your coworkers with a tense smile that they returned. Everyone was in the same boat as you, after all. No one would choose to work here unless they were down on their luck like you.
The night started slow, slower than usual for a Friday night. Despite the place looking like it was going to fall down around you and the occasional rat that scampered across the floor, the bar was actually kind of a hotspot. The alcohol was cheap and your boss never cut anyone off so patrons were free to get as sloshed as they wanted.
That also meant the customers tended to get rather unruly.
Which is exactly what happened when the night inevitably picked up. More people came in, more drinks were ordered, and you were running around the place like mad to get drinks where they needed to be.
You cast a glance to the clock behind the bar, sighing in relief when you realized you had 10 minutes left of this hell.
You were sure you were a sight, clearly run ragged and ready to get the hell out of there and go home. Your feet were sore from the old, worn shoes you wore. They looked fine on the outside, cute, but the soles were worn down and provided absolutely no cushion. It was hell.
“This goes to the corner table,” the bartender called over the loud voices of the bar. He was a nice guy, couldn’t be older than 20, but you honestly couldn’t even recall his name.
You took the tray of shitty beer from the counter and quickly made your way to the corner table in the back, careful not to spill a drop. You placed the tray down and gave the guys at the table a charming smile.
“Here’s your drinks,” you said, placing a glass in front of all 4 of them.
“Thanks, beautiful,” one of them slurred, given a drunken wink.
“Um, is there anything else you need?” you asked, ignoring his flirting, as you picked up the tray.
“Maybe,” another one chuckled, leaning back in his seat, raking his eyes down your body. You wished you could crawl into a hole at the feeling of his gaze on you. Despite being fully clothed, it made you feel incredibly naked – like he could see through your clothes.
It certainly wasn’t the first time a customer or two flirted with you. It was sort of a rampant problem in this bar, if you were honest.
“What is it you need?” you asked, wishing so badly you could just be free from the conversation.
One of them pulled out a stack of money, waving it in front of your face, “I’ll tip you this if you show us your tits.”
Your cheeks burned hot in humiliation as the other three laughed and jeered. You shifted on your feet, tapping your fingers anxiously against the metal tray in your hands, envisioning yourself slamming it over their heads.
“N-No thank you…I-I don’t think that would be appropriate,” you hope that they can’t hear the way your voice trembles over all the noise in the bar.
“Come on, sexy,” the one with the money grinned, licking over his teeth as his eyes narrowed on your chest, “Bet they’re real nice. C’mon, you need the money right? Why else would you be working at a place like this? Go on, just lift your shirt up and let us see them tits!”
“M-My shift is over, I really need to go,” you shakily smile and take a step back, “I-I hope you enjoy your night, boys.”
Your attempt to diffuse the situation and get out of it proved futile because when you attempted to flee, one of them clapped a firm hand around your wrist and tugged you forward. You stumbled on your feet, dropping the metal tray with a gasp, finding yourself nose to nose with one of them. The smell of alcohol was potent on his breath and it made your lip curl in disgust. You tried to tug yourself free of his grasp but his grip was too strong.
The guy sitting on the other side of the one who had a hold on you reached over his buddy to yank the neckline of your shirt down, the cheap, worn material stretching with ease until it tore at the weakest point. You let out a horrified cry when your bra became visible to the group, all of them cheering and shouting degrading things right in your face.
The one across the table reached down, you felt his hand against your breast through your bra and a lightning bolt of pure terror ripped through you. It was like everything happened in slow motion.
You could feel his thumb hook under your bra and start to tug, tears flooded your eyes and dripped down your cheeks. You raised a hand and as hard as you could, slapped the one still holding you clean across the face.
The entire table went still but his grasp loosened enough for you to turn on your heel and bolt as fast as you could into the staff room, covering your exposed bra with your arms as best you could. You passed one of your coworkers, her eyes wide in concern when she saw your state.
She followed you into the staff room, closing the door quietly behind her. You stood in front of your locker, ripping it open as you attempted to collect your things but your mind was running too fast for you to actually make any meaningful movements.
Your coworker called your name and you paused.
“Hey, take a breath,” she whispered softly, placing a hand on your back. You realized you were hyperventilating. You attempted to level out your breathing, wiping the tears off of your cheeks only for more to replace them.
“What happened?” she asked softly, “Do you want me to call someone? The police?”
You shake your head, opening your mouth to respond but only a little sob comes out. You couldn’t even find it in yourself to be embarrassed. She looks nothing but sympathetic, softly patting your back and encouraging you to breathe deeply.
The staff room door suddenly slams open, making both of you jump. Your boss storms in, completely red in the face and furious.
“Get out,” he snaps at your coworker.
She casts an apologetic look to you, squeezing your hand before she ducks her head and leaves the staff room. He slams the door behind her, locking it for good measure – leaving both of you alone.
He advances on you faster than you can react, he wraps a hand around your throat and slams you against the lockers. It hurts but you can’t get a noise past the grip around your neck. You blink back the tears that are still coming, trying to see him more clearly.
“Are you broke in the fuckin’ head?!” he screams, a volume that makes your ears ring. You wonder if the patrons can hear it outside, “You put your hands on a customer?!”
“Th-They put their hands on me first!” you defended yourself, hoarse and choked under his grip, “They touched me!”
He only looks more furious, eyes falling to your ripped shirt and exposed bra. He grabs one side of the already torn shirt and yanks, ripping it the rest of the way. Your eyes go wide and your first instinct is to kick him but you’re panicked and uncoordinated so it misses its mark.
“I don’t give a shit if they forced you over the table and fucked you!” he howls, spitting all over your face in his rage, “You better think fast and hard about how you’re going to rectify this. Do you understand me?”
His grip tightens a bit more around your throat and you hastily nod, blubbering mindless apologies to try and appease him. He doesn’t look any less angry but lets you go nonetheless. Your knees are too shaky to hold you up so you slide down the lockers until you’re sitting on the dirty floor.
“You go out there and you apologize to them,” he hisses through clenched teeth, “Or I’m going to fire you and you’re gonna be out on the fuckin’ streets, got it?”
You nod your head, holding back your sobs but can’t control the tears that fall down your cheeks. He sends you one last glare before turning back to the door, unlocking it and throwing it open.
You’re left there, trembling on the floor and quietly crying to yourself. Your heart is racing and you’ve never felt more terrified and humiliated in your life.
The door opens again and you look up in horror at the idea of your boss coming back. But it’s your coworker again.
She quietly crouches next to you and gives you a once over, “Are you okay? Did he hurt you?”
“I-I have to apologize t-to them,” you manage to choke out.
Her eyes widened, “No way! You didn’t do anything wrong!”
“I can’t lose this job,” you sob, pressing the heel of your hands to your eyes as you cry, “I need this job. He says he’ll fire me if I don’t apologize!”
“Okay,” she whispers, “I’ll go with you, okay? You can apologize and then you can go, that’s it.”
You nod your head and stand up, using the lockers as a crutch. Your coworker helps you steady yourself before she sees your shirt is ripped even more than when she left.
She whispers your name, “Are you sure he didn’t…”
“He only ripped it,” you assure her, sniffling softly, “But I can’t go out there like this.”
It dawns on you that you forgot a jacket. It was a little warmer today than it had been in days and you had simply neglected to bring one.
“You can borrow my hoodie,” she assures, opening her locker to tug it out, handing it to you, “Go on, you can return it to me another day.”
“Thank you,” you whisper, clumsily sliding it over your head. You feel much better now that you’re covered up, you feel less vulnerable. You quickly collect all your belongings so you can leave as soon as you get this over with.
You let her lead you out of the staff room. The second you’re out, the blaring noise immediately proves to be too much. You wipe your eyes, using the sleeve of the hoodie. You make a note to wash it properly when you return it.
You feel the eyes of strangers on you and it just makes you feel worse with every passing second. You want to go home. You want to shower. You want to crawl into bed. You want Simon.
You let her lead you to the table, all the men are still there laughing and drinking their beers. They fall silent when you approach, four pairs of eyes falling on you, making you feel humiliated and small. They look expectant, the one who ripped your shirt tapping his fingers against the table.
“There you are!” the one who had held your wrist grinned. It was a predatory smile that made your heart race anxiously, “Thought you were gonna run away without apologizing for bein’ a raging bitch.”
You flinch at the insult and your coworker squeezes your hand in support, “I-I’m sorry for slapping you.”
“That’s fuckin’ right!” another one jeered, “Practically ruined our night. How are you going to make it up to us?”
“I’ve got a few ideas!” a different once laughed. The other three joined in eagerly.
“How about you stay back late and really make it up to us, huh?” you squeezed your coworkers hand in yours, already feeling the tears returning with a vengeance.
“How about I bring you a round on me, huh?” she quickly intervenes, “I’ll buy.”
That seems to do it for the 4 men and they rambunctiously cheer and slam their hands on the table obnoxiously. You think you hear her promise to be back with their drinks as she pulls you away from the table. You both hide away in the staff room again and she holds both your hands in hers.
“Go on home,” she says softly.
“I-I’ll pay you back for the drinks–” she shushes you quickly when you start.
“Don’t even worry about it,” she coos, “Go home.”
With a gentle nudge to the back entrance, she casts you one last kind smile before slipping out of the staff door.
You don’t even remember the walk home, your mind completely fuzzy. But you’re sobbing again by the time you stumble into the door. You collapse onto the floor in front of your couch, wailing into the cushions as the weight of the night fully and entirely collapses on you. You can barely breathe through your tears, hiccups and coughs breaking up the endless crying only to resume when you catch your breath.
You have no idea how long you sit there, crying louder and harder than you have in a very, very long time.
You hear your front door creak open before the living room light flips on. You go completely stiff, your crying finally going silent as you hear the familiar heavy footsteps step into the living room before they fall still when he sees you.
He calls your name, soft and gentle in a way that is completely unlike him. Simon isn’t soft, he talks to you in a cold, apathetic and teasing tone. He’s always clipped and blunt. Sure, he’s kind but never gentle.
Just the sweet tone makes your lips wobble and suddenly you’re sobbing again. His boots hit the floor fast, taking quick, big strides so he can reach you as fast as he possibly can. Two strong hands hook under your arms and turn you towards him. He takes a seat beside you on the floor and tugs you into lap.
You melt into his chest, secured by his embrace as he holds you. One hand cups the back of your head and the other wraps around your back.
“You didn’t answer your phone when I called,” he explained his arrival, lips pressed to the crown of your head, “Got worried so I rushed over.”
You grip his hoodie in your hands, anchoring yourself to him as you cry and cry. He remains silent, content to hold you and let you cry out everything you’re feeling.
Just having him there, holding you and comforting you, is enough to ease your tears until you’re just a hiccuping, sniffling mess. You’re taking those quick, stuttering gasping breaths that signify the end of your meltdown and Simon slowly eases his hold on you.
He cups your cheek in one hand, raising your head up so he can really look at you. He rubs a thumb under your eye, wiping away your tears. He looks so concerned, brows furrowed and a frown on his lips.
The sight of his face makes your lips wobble again, “Si…” you finally manage to choke out.
His gaze softens immediately, his other hand coming up to cup your face as well. He leans forward and presses a lingering kiss against your forehead.
“You want to tell me what happened?” he finally asks, letting go of your face to hold your waist, keeping you curled up in his lap.
You think about it. You want to tell him all about it, to get it off of your chest and figure out how the hell you’re supposed to move past it. But you know that if you tell him, he’s going to march his ass to your job the second he gets a chance and put your boss’s head through the wall and find those assholes from the table.
You really can’t afford to lose your job. Your bills are tight enough as it is, you’re scraping by by the skin of your teeth. If you’re jobless for even a week, it’s going to fuck everything up. You’ll never make rent and you can’t end up on the street.
“Just a…bad shift…” you supply lamely.
Simon stares at you, jaw set and tense, “I don’t know what’s worse. The fact you’re lying in the first place or the fact you don’t think you can tell me what really happened.”
“Simon…” you whine, pushing yourself off of his lap, “Just let it go, please.”
He follows your lead when you stand up. He still hasn’t taken his boots off, still too concerned about you to care. Every step he takes is a loud sound of his weight in those boots.
You pace back and forth, arms crossed over your chest.
“I’m not letting it go,” he responds, “I think you know me better than that.”
“Simon, please!” you feel the tears returning again and you suddenly realize how tired you are from crying. Your eyes are sore and you just want to sleep.
“I want to know what happened,” he argues, clearly growing exasperated.
You know he’s not going to let it go. He knows you too well to believe any lies. You press your hands to your face and let out a noise of frustration and despair. You can feel his eyes on you, unwavering and firm. You feel hot, like you’re overheating and suffocated. With trembling hands, you haphazardly tug at the hoodie – you need it off or you’re going to go mad.
Simon reaches forward to help you, watching your rising panic but you slap his hands away. He looks stupefied at your reaction but retracts his hands.
But you can’t get the damned thing off, you’re uncoordinated and clumsy, unable to pull your arms through the sleeves so you can get it off. Why won’t it come off?
“G-Get it off,” you finally cry, completely unaware of the pure horror in your voice.
Simon’s hands are back, “I’ve got you. I’ll get it off ya.”
True to his word, he tugs it up and it slips over your head with ease. You feel like you can take a deep breath finally, feeling the cool air of your living room against your skin again. Your chest rises and falls rapidly as you attempt to calm yourself.
He says your name softly but you can’t bring yourself to open your eyes. You jump when you feel the ghost of his fingers against your stomach – the skin is bare and it makes your eyes fly open. You look down and remember that your shirt was completely torn open, the hoodie had been hiding it, and now Simon is seeing. You can see the realization in his face.
He’s not an idiot. If anything, he’s more intelligent than anyone you’ve ever known.
Suddenly your stomach turns and you place a hand over your mouth. You’re running down the hallway, dropping to your knees in front of the toilet as you heave.
You don’t hear any movement from Simon. He doesn’t follow you to the bathroom. You’re briefly thankful for the escape as the nausea disappears before you suddenly crave to have him near you again.
“Simon!” you cry, his footfalls an immediate response.
He crouches beside you, placing a hand on your back, “You finished?”
You nod, spitting one last time into the toilet, “I-I want to shower.”
He’s quiet for a moment before he stands, stepping past you to turn on the shower for you. He places a consoling hand on the top of your head in passing before he goes to leave you alone. You reach out and grab his hand before he can get too far.
He pauses and looks at you, easily understanding. He brushes his thumb over your hand, “Not goin’ anywhere, love.”
He takes a step outside of the bathroom and stands there, hands held in front of him as if he were on guard, like a security guard. You flush the toilet and shakily strip your clothes off before stepping into the shower, letting the warm spray ease your sore body and clear your sinuses. You’re terribly stuffy from crying so you can’t even smell your grapefruit body wash this time.
You finish your shower, making sure you scrub your body as best you can before you step out and wrap a towel around your body.
“Are you hungry?” Simon suddenly asks.
“No…” your tone is flatter than you had intended and you realize that you’re completely emotionally drained.
“Alright,” is all he says in reply.
You approach the door, where he’s still standing. You place your hand against his back and he quickly steps aside to let you by. You hear his boots behind you as he follows you to your bedroom.
You sit on the bed, completely exhausted. Simon makes himself busy with going through your dresser, pulling out some clothes for you to wear before he places them on the bed beside you. You don’t make any movements.
He sighs, softly saying your name before crouching in front of you, taking your hands in his.
“Was it your boss?” he asks softly.
“Him and some assholes I was serving drinks to,” you tiredly answer. You don’t have it in you to fight in anymore.
“Why didn’t you want to tell me?” he pries, squeezing your hands.
“Because I know you, Si,” you sniffle, “You’re going to go down there and put them all in the hospital when you find them.”
“And?” he scoffs, “They fuckin’ deserve it. No one gets to put their hands on you like that and get away with it.”
“Because I can’t lose my job, Si!” you finally cry, “I barely make ends meet as it is! I-If I lose my job, what am I supposed to do? I won’t be able to afford rent. I’ll be on the streets!”
“I would never let that happen,” he says firmly, “You will never be on the streets, love. I will always take care of you, you know that.”
“I can’t do that to you, Simon,” you mutter, sniffling again, “Y-You already have so much on your plate I don’t want to be another problem you have to deal with.”
“Is that what you think?” he scoffs, standing up, “That I deal with you? You’re important to me, I take care of you because I never want anything to happen to you. I’m not going to let you work at that shithole for a minute longer.”
You hang your head, unable to supply any arguments to him anymore.
“I’m going to make you something small to eat. You’re going to eat and drink some water and then you’re going to get some rest, understood?” he gives a satisfied hum when you nod your head in compliance.
Once you’re alone, you go over his words again. You’re important to him, that’s what he said. It was the most clear he had ever been with his feelings towards you since you confessed your feelings when you were young.
As you methodically got dressed in the clothes he picked out for you, you reminisced. Memories of him were always something that made you inexplicably happy – except for one memory.
You were 14 and he was 17 at the time. You’d known each other for your entire childhood after his mother had brought him over for a playdate despite the age difference and the fact you were closer in age to his brother.
He had always looked after you and taken care of you, walking you home after school and simply looking after you when your parents were busy. It was inevitable that you would grow feelings for him. You remember the way your heart would race every time you looked at him. You remember telling your friends that he was your boyfriend, hoping he wouldn’t find out.
You had told him one evening when he was hanging out, having dinner with your family, that you liked him – like liked.
You remember how you cried into your pillow night after night when he rejected you. Told you flat out that you were an idiot and to drop it and never, ever bring it up again. That he didn’t feel the same. And that was that.
You never brought it up again.
But the crush never once waned. You decided that his friendship was more important than your feelings for him so you would never let him know. And that’s how it had been ever since.
Simon’s voice calling your name ripped you from your reminiscing. You tied the drawstrings of the sweats he had picked out and quickly made your way to the kitchen.
Simon was washing a pan by the time you arrived but he nodded to a plate he set on the counter for you. It was just a small omelet he made, complete with a light drizzle of ketchup.
He knew you well, you couldn’t deny. You picked up the fork he’d placed on the plate for you and slowly began to eat.
After being sick, your stomach was painfully empty so you were happy to have something on it once again. Simon quietly finished washing the dishes he had dirtied before he placed them on the dish rack and dried his hands.
“Um, Simon?” you called softly, receiving a grunt in reply, “Didn’t you have something going on tonight?”
“Was gonna be out the lads,” he responded, “Doesn’t matter, can hang out with those idiots anytime.”
“You shouldn’t talk about your friends like that,” you said, shaking your head as you took a final bite of your omelet.
“Aint my friends,” he reached down and took your plate from you, tossing it into the sink.
“Simon Riley doesn’t have friends?” you asked, eyes following him as he locked up your apartment and started to turn out the lights.
“Got you,” he said as you followed him down the hall, “All I need.”
A fond smile made its way across your face as he yanked his shirt above his head. You began to make yourself comfortable in bed, trying to keep your eyes off of him as he got dressed for bed. Despite the way you wanted to take the chance to look at him.
Friends. That’s what you were, you reminded yourself.
Finally, he climbed into bed beside you, making himself comfortable before you turned out the light.
Yet, despite your exhaustion from the night, you felt like you couldn’t close your eyes. You felt like you couldn’t relax. The tension in your body was so much that you were sore. Like you had gone to the gym instead of went to work.
“Simon..?” you whispered into the dark. He was silent for a second before he hummed in response, “Can I…tell you what happened tonight?”
He was quiet again but you felt him move, a hand blindly reaching over to you to find your hands. You took it in both of yours, nervously fidgeting with his fingers.
“This stupid group of guys were sloshed beyond belief,” you began to tell him, aware of his gaze on you through the dark, “They were just chattin’ shit, saying they’d tip me if I showed them my tits,” he scoffed beside you, clearly displeased, “I said no and tried to leave and they wouldn’t let me. One of them ripped my shirt and tried to pull my bra up so I slapped him.”
“Fuckin’ bastard deserved to get his teeth knocked down his throat,” Simon growled from beside you.
“I got away and went to the staff room but my boss came in and he was so fucking angry, Si,” your voice shook as you remembered the way his face had been so red and a look of pure hate had been in his eyes, “He grabbed my throat and pinned against the lockers. He was angry that I had struck a customer.”
“Of course that’s all that bastard would be angry about,” Simon spit, not bothering to hide his distaste.
“I tried to tell him that I was defending myself but he said–” your voice broke and you struggled to blink back the tears. Simon sat up a bit, pulling you into his chest, letting you curl against him, the rapid hum of his heart loud in your ear, easing you immediately, “He said that he didn’t care if they put me over the table and fucked me, he would fire me if I didn’t apologize to them.”
Simon’s arms tightened around you immediately, cursing under his breath, “He made you apologize to them?”
You nod your head, “It was so humiliating, Si. B-But I just didn’t want to lose my job. They just laughed at me and made a joke of it.”
“Pieces of shit,” he hisses, pressing a kiss against your temple, “They better hope I don’t find them.”
You’d really love to see them blubbering on their knees, crying and terrified like you had been. They wouldn’t be so awful in the face of a guy bigger and stronger than them – someone like Simon.
“I should have gone to the bar tonight,” he sighed, “Even though you told me not to, I wanted to.”
“It’s okay, Si,” you sniffle, “I’m just glad you’re here now.”
You wrap your leg around his waist and snuggle deeper into his chest, finally feeling content to sleep so long as you got to be in his arms.
You wake up late, well into the afternoon. You’re groggy and struggle to pull yourself out of bed. Simon isn’t in bed, so you force yourself up in search of him.
As you left, you noticed that the clothes you were wearing last night were gone and weren’t in the laundry basket. You knew for a fact that you left them on the floor.
He’s relaxing on the couch as usual. His hair is wet and you can smell your body wash wafting off of him when you crawl onto the couch beside him. He reaches a hand out and pets your head gently as a greeting.
“Sleep well?” he asks. You nod your head, “Hungry?” You nod again.
He huffs through his nose and stands up, pressing a fleeting kiss to the top of your head to go prepare something for you to eat. The sound of Simon bustling about the kitchen filled the apartment and you found yourself relaxing into the couch.
“Simon?” you called, getting to your feet to make your way to the kitchen.
He had his back to you as he fried up something in the pan but he hummed in response nonetheless.
“Where did my clothes from last night go?” you ask softly.
He pauses his stirring of the food, “Threw them out. Figured you wouldn’t want to see them when you woke up.”
“Oh,” you respond.
Your heart feels full at his show of care. It was quiet actions like that that just made you feel so…in love, you think before correcting yourself. Fluttery. Cared for. Loved.
No, he doesn’t love you.
You shake your head and move to the fridge to pull out a bottle of water, going to sit on the couch to wait for Simon to finish cooking.
The day was spent like that, just you and Simon in your flat. Him just keeping you company and keeping your mind off of things.
You were curled up against him, listening to the beating of his heart and watching the movie he had decided to play. It was peaceful. He smelled nice, like you. And he was so comfortable beneath you, firm and big.
His thighs were spread wide, one of your legs thrown over one of his, only serving to make you more aware of how big and firm he was. Solid. Well-built.
Handsome.
You cast a glance at his face. His brown eyes were half-lidded as he mindlessly nibbled at his bottom lip. They looked soft and shiny. You wondered what he tasted like, how he kissed.
Was he rough? Soft? Did he like to use tongue.
You’d never kissed anyone before. You wondered if he would be okay with that. You knew some guys liked experienced partners and some liked them inexperienced. You wonder what he preferred.
Just the idea of kissing him had your heart hammering in your chest and your face burning. You quickly looked at the TV, snuggling closer to him. He squeezed you closer, hand mindlessly rubbing up and down your back.
Kissing Simon…you pictured him over you, cupping your cheeks in the way he always does. You imagine him pressing his pretty lips against yours, moving them softly against yours. You imagine what it would feel like for him to pin you down, sliding his tongue into your mouth as you moaned and whimpered beneath him, unable to move anywhere because he’s so much bigger and stronger than you. In charge.
Your pussy clenches around nothing, already starting to drip into your panties. Suddenly you sit up, eyes wide and cheeks flush. Simon looks perturbed, an eyebrow raised at your sudden movement.
“I’ve got to take a shower,” you shakily supply before fleeing to the safety of the bathroom.
You look at yourself in the mirror, hand over your mouth to quiet your heavy breathing.
What the hell was wrong with you? How the hell could you be thinking about sex and getting turned on after yesterday? How could you be thinking about Simon like that when he was right there? What the fuck was your problem?
You hastily reached over and turned the shower on, the pipes clanking loudly as the water flowed through them.
Shouldn’t you be the opposite of horny after what happened yesterday? Maybe you really were broken.
You strip and quickly step into the shower, turning the water as hot as it would possibly go. You needed it to hurt so you would stop acting like such a freak. Like a slut.
You fight back tears as you begin to wash up.
By the time your shower is done, you’re exhausted again. You dry off and wrap the towel around yourself, opening the door to find Simon standing on the other side. You jump and gasp, placing a hand over your heart to calm the beating.
“You scared me!” you whine, slipping past him to the bedroom.
“Wanted to check on you,” he says, following slowly behind you, watching as you pick out clothes.
“I’m fine,” you assure him, “I just got really tired and I’d like to turn in early, that’s all.”
“Alright,” he replies, standing there for a second before making his way back to the door, “Just call if you need anything.”
“I will!” you offer him a smile, watching as he leaves, closing the door behind him.
You quickly dress and climb into bed, turning the lights out before squeezing your eyes shut to will yourself to sleep. Surprisingly, it came quickly and easily – maybe you were more tired than you thought.
Little did you know that Simon took the opportunity of you sleeping early to slip away and take a little 15 minute walk.
When you start to dream, you’re acutely aware that it’s a dream. You’re not sure how but, you just know that you’re sleeping and none of this is real.
But god it feels real and you want it to be real so you go along with it.
Simon is there, you’re both in your bed. He’s got his shirt off and he’s on top of you, kissing your neck softly. Sweetly.
He doesn’t smell like your body wash anymore, he smells like his – a crisp, musky scent that you love so dearly. And he’s so warm against you.
You realize that you’re only wearing a pair of panties when his lips suddenly attach to your breast, mouthing at your nipple. His tongue swirls over the bud and it feels so good you can’t help but moan.
“Si…” you sigh, reaching down to run your fingers through his hair. He rewards you by surging up and pressing his lips against yours. He tastes vaguely like mint and it’s intoxicating. So simple, nothing special or poetic. Just mint. Simon.
You wrap your arms around his shoulders and eagerly kiss him back. Kissing is easy, you hazily think. You just move your lips in time with his and it falls into place.
Simon’s hips move against yours and you cry out when you feel the hard swell of his cock press against you through his sweatpants and your panties. He’s so hard and it's so hot even through the layers of clothes.
“Si…” you whimper again.
“I’m here, love,” he coos, “I’ve got you.”
He rocks his hips against yours and fuck, it feels good. You eagerly spread your legs and find yourself wishing that the panties weren’t in the way. You’d love to hear the sticky sound of your pussy against his cock through his sweats. You’d love to see the stain of your slick against them, knowing that you marked him as yours like that.
You feel hot, that tense warmth growing in your tummy. The promise of pleasure that you’ve never been able to experience. Maybe Simon could supply it. You’re sure he could, actually, you convince yourself.
If he just keeps going, keeps rutting his hips like that, you could cum all messy in your panties. Just for him. Only for him.
Just as you swear it’s going to wash over you, your eyes fly open and you gasp. Your entire body feels hot and sweaty and you realize you’ve thrown your blanket off of your body. The sun is shining through the window and Simon is nowhere to be seen in bed.
You swallow, your throat feeling painfully dry.
Suddenly, the bedroom door creaks open and Simon comes in with a laundry basket. He casts a glance at you and seems to relax when he realizes you’re awake.
“Was doin’ some laundry,” he explains, turning to open your drawers to begin putting the clean clothes away.
“Oh,” you whisper, sounding hoarse, “Thank you, Si.”
As you watch him, you realize he seems tenser than usual. You sit up and bed and watch him put the clothes away until he’s finished. He stands there for a moment before looking over his shoulder at you.
“I uh,” he clears his throat, “I’ve gotta go tonight.”
“Go?” you ask, eyes going wide. You don’t want him to leave, “Go where?”
“I’ve got some work to take care of,” he replies, “Paperwork I’ve been puttin’ off. Gonna pull a late one to get it done.”
“I-I don’t want you to go,” you confess softly, trying to blink back the tears that sting your eyes. You feel so pathetic, crying because he needs to leave. But you haven’t been without him since it happened and you’re scared to be alone with just your thoughts.
“I know,” he hums, taking a seat at the foot of the bed, cupping your cheek, “I’ll just be a call away, you know. If you need me, I’ll be there.”
“Promise?” you ask. He nods, teasingly pinching your cheek before you smile and bat his hand away. When he pulls it back you notice his knuckles – bruised and split open. They weren’t like that last night you were sure of it, “Simon…”
He catches you looking and gives you a tense smile, “Don’t worry about it.”
He stands up and kisses your forehead before turning and leaving the room, leaving you to get ready for the day.
Thankfully, Simon remains around for the day. You notice he’s on his phone a lot more, typing away. It’s unlike him, he’s more the type to do phone calls rather than text. When you ask him about it he just waves you off with an explanation about Soap being on his ass.
You have a feeling he’s lying but you don’t pry.
Before he leaves, he makes you dinner. You walk him to the door, unable to stop the pout on your face when he puts his boots on. You can’t help but wish that he’d change his mind at the last second and stay with you after all.
But he doesn’t. He pulls his balaclava over his face and slips his hood up before turning back to you.
“Don’t cry, love,” he coos, wiping a stray tear away, “I promise I’ll get all my work done and I’ll be all yours for a good long while.”
“Okay…” you sound so miserable but you can’t bring yourself to care, “I’ll miss you.”
He brings you in for a hug, making sure to squeeze you nice and tight before he pulls back. He can’t give you his normal kiss because of the mask and that only makes you sadder.
You don’t want him to go. You don’t want him to go. You want him to stay. You want to keep him close. He makes you feel safe. He makes you feel complete. You love him so much.
You hold onto his hoodie for as long as you can until he has to shake you off and close the door behind him. And you stand there for a long time. Like a puppy who's been left home alone for the first time, just waiting for its owners to come back because it’s scared it’s going to be alone forever.
By the time you bring yourself to leave the door, the food Simon made you is cold. That only seems to make you feel worse.
Then you sit on the couch and watch TV, feeling hopelessly alone. You wished you had Simon to curl into and snuggle with. The tiny couch has never felt bigger.
You shower and brush your teeth, pouting at the sight of his toothbrush, another reminder that he isn’t there.
Before that night at the bar, you never would have felt so isolated without him; lonely, sure. But now that you’re experiencing this gut-wrenching emptiness, you feel close to tears every time you think about him. He was truly your rock, the only thing that brought you comfort. You loved him.
You flop against the bed and let the tears fall down your temples. You love him. You do.
You’re so fucking in love with him that it hurts. Your heart aches in your chest. You want him there to hold you.
You know he doesn’t feel the same, you know it will never become anything. But you’re willing to take whatever you can get. Just his company. You can be content so long as he’s with you, as long as he’s in your life.
But you can think about him, imagine yourself telling him how you feel. Imagine that when he holds you close that he feels the same too. That he loves you. You want him to love you so desperately.
You wish that he loved you.
You curled into his pillow, sniffling pathetically as you closed your eyes. You cry yourself to sleep.
Your eyes fly open and the gasp you let out changes to a sob. All you can hear is your heart pounding in your ears. All you see is flashes of their faces in your head. All you can feel are their hands on you.
A nightmare, your brain supplies but it does nothing to quell your anxiety and fear.
You reach for Simon, instinctive and desperate. But you only touch the cold mattress and you’re reminded that he isn’t home tonight.
You fumble through the sheets to find your phone.
I’ll just be a call away, you know. If you need me, I’ll be there.
He promised.
You can barely see the screen as you look for his contact. You call him, hands trembling as you hold it to your ear. It rings and rings and rings. Then beeps and goes to voicemail.
You hang up and try again. And again. And again.
He doesn’t answer. Why won’t he answer? He promised.
You call him again but it goes straight to voicemail. You can practically feel your heart shatter in your chest. He was ignoring your calls. He ignored you.
But he had promised he would come when you needed him. And you needed him.
Your phone becomes completely blurry through your tears as you begin to cry in earnest. You feel hurt, betrayed, disappointed, and angry. You’re fucking angry.
You suddenly need to let it out. So you take your phone in your hand and throw it, listening to it slam against the wall. It’s loud and the light on your screen goes out. But you don’t feel better. You’re still a mess of volatile emotions. It feels like it’s all bottled up inside you and it hurts.
You take his pillow and grip it in your fists. You want to rip it to shreds, want to tear it open and release all your anger on it. Instead, you just slam your fists against it.
Then you do it again. And again. And again.
You punch the damned thing as you cry and cry. You’re sure you must be a sight. You must be making so much noise as you sob and shriek.
You were angry at what happened to you, you were angry you had apologize to them for hurting you, you were angry because you couldn’t even sleep peacefully without being plagued by a nightmare the first night you were without Simon, and you were angry he broke his fucking promise.
Before long, all you were doing was sobbing into his pillow – wailing and crying your broken heart out. You tire yourself out, completely exhausted of all emotions. You lay there, quietly hiccuping and sniffling, just staring into the inky darkness.
You’re there for hours, unable to fall back asleep. The sun slowly creeps over the horizon and begins to cast an orange glow around the room.
You can’t even find beauty in it. You’re so exhausted. Your heart aches. It’s agonizing.
It’s early morning by the time you hear your front door open. You don’t feel excited to see him. You’re not happy he’s back. You don’t feel anything, actually. All you can do is slowly blink, gaze focused outside the window where you can faintly hear birds chirping.
You wish you were a bird so you could fly away wherever you want. You would fly away from here right now if you could. You wanted to leave.
You didn’t want to see Simon. You were so angry at him. You’ve never felt like this about him before. You don’t know what to do. All you can think right now is how much you hate him.
God, you hate him.
He’s surprisingly quiet as he walks through your apartment. You hear him push the door open, your back to him. But you can feel his eyes on you, can feel how he hovers in the doorway.
He wanders further into the room before pausing.
He rounds to your side of the bed and sees that you’re awake, simply staring out the window. He holds your phone up, screen clearly shattered before he places it on the table beside you.
“You called,” he says softly, shifting anxiously on his feet. Simon’s never anxious. But he is right now, “I’m sorry I didn’t answer. I was just…busy. Had some unruly recruits, you know how it is.”
Your eyes finally move from the window, landing on him. He’s wearing the same thing he was last night. Just some jeans and white t-shirt. It’s a nice one, it fits him well and it looks comfy.
Simon stands there under your gaze, growing increasingly uncomfortable. He’s not used to feeling scrutinized. And that’s exactly what your gaze feels like.
Your eyes wander to a strange discoloration on his shirt. It’s tan, just a light stain. There’s a tiny smear of black as well. Then you spot the red on his collar, ruby red.
He looks guilty. He would look like a kicked puppy if you didn’t know any better. This isn’t guilt because he missed your call. He’s guilty because he was too busy getting his dick wet to answer you.
That’s why he ignored you? To fuck someone?
You’re no longer numb. You’re angry again. That overwhelming feeling that you have no idea how to let out. It’s like it just boils up inside you, like a pot boiling over. It has no place to go but out.
You’re moving before you even have a chance to register it. You just need to show him how angry you are. Fucking furious.
You grab the empty glass on your nightstand and wail it in his direction harder than you thought possible. Simon barely dodges, slamming himself against the wall as it shatters behind him.
Now he looks angry. Good. Maybe he’ll feel a fraction of what you feel right now.
“Are you out of your fucking head?” he snarls, animosity dripping off of every syllable.
You don’t even answer, grabbing a book that you have stacked there before throwing that too. Then the second book. Then the third book. Then you throw your phone at him. Then you take the lamp, rip the plug right from the wall and throw that too.
When you’re out of things to throw on the table you throw your pillow. It’s when you’re about to throw his pillow that he finally has enough. He rips it from your grasp and tosses it across the room.
He’s standing there, fists balled at his sides and his shoulders heaving up and down as he tries to calm himself.
“I hate you,” you finally spit, standing on your knees. You don’t have anything to throw so you slam your hands against his chest. You hit him, crying and sobbing as you wail over and over about how you hate him. You hate him so fucking much.
“I hate you, I hate you, I hate you!” you scream. You’re so loud you’re sure the neighbors can hear but you don’t care. It feels good to let your anger out on him, to punch and slap and claw at his shoulders, chest, and arms. He doesn’t do anything but stand there and let you. He’d never lay a hand on you, even when you’re doing it to him, “I needed you and you were too busy fucking some stupid whore?!”
He doesn’t say anything but he’s trembling now. You’re not sure if he’s just that angry or if he’s holding himself back from wringing your neck.
You pause to look up at him. His jaw is set hard but he’s staring at you, his usual lazy, lidded look nowhere to be found. He looks enraged.
“Aren’t you going to say something?” you spit, raising your hand as if you’re going to slap him across the face but you stop. You don’t want to do that.
“Say what?” he finally responds, voice so cold you swear it drops the room’s temperature, “I have a life that doesn’t revolve around you. That’s the difference between us. You need me but I don’t need you.”
You sit back on your heels at that, the hurt clear on your face. Simon doesn’t seem to care in the slightest now, as tears trickle down your face. You must look a sight, pathetically gazing up at him as he glares down at you like you’re dog shit on the bottom of his shoe.
“You hate me?” he scoffs, “That’s just fine. We’ll see how long you last without me before you’re hanging from a bloody rope.”
He turns on his heel at that and storms out of your room, slamming your bedroom door behind him. It practically rattles the walls. Then you hear the same thing from the front door.
And you’re all alone. And you can’t do anything but cry about it.
You find it impossible to get out of bed after that. You lay there for the rest of the day. Then all night. You fitfully sleep when you can’t bear to be awake anymore and then wake when the nightmares hit.
Then you watch the sun come up and decide that it’s a good day to spend in bed. So you do. You sleep on and off, only waking to cry when you’re plagued with nightmares.
You occasionally think about Simon. More than occasionally, actually. He’s always on your mind.
You think everything over and come to the conclusion that this was all your fault. From the beginning, really. You’d been keen on staying in his life since you were children, attached yourself to his side and weaseled your way into his life. Really, you gave him no choice but to put up with you.
He was everything to you. He was right, you needed him. You didn’t have anyone else. No friends, no family, not even a pet. Just him. Always just him.
What choice did he have other than to put up with you day after day? He didn’t need you like you needed him, after all. He’d surely been spending his days in dread of you – of your texts, your calls.
This was probably what he was waiting for; an escape. He probably wanted to leave a long, long time ago. You were in love with him and he wanted nothing to do with you.
What were you thinking? Actually believing that he would want to spend his days with you, taking care of you. Who were you kidding, you were just an idiot for letting yourself believe otherwise.
You wake up one day and realize you’re not angry anymore. Just sad. You almost prefer the anger and emptiness compared to the unending waves of sadness.
You cry all the time. Day and night.
You try to use your phone, you want to call him but it’s broken. The screen won’t even turn on. You’re completely alone, can’t even contact somebody – not that you have anyone but him.
God, that was embarrassing now that you thought about it. There he was going out and getting laid and you’ve been holding out for him since you were a kid.
You’re suddenly aware of the fact you haven’t showered in days. You’ve barely eaten, only getting up once or twice to find something to nibble on in the kitchen – a slice of bread is what you usually settle on.
You pry yourself up from your mattress and stumble to the bathroom. The clanging of pipes is louder than it’s ever been but the hot water is completely welcome.
When you stand there, under the burning heat that makes your skin raw, you slowly sink to the shower floor. You haven’t cleaned it in a while but you can’t bring yourself to care.
You let yourself cry again, since it’s all you can do. By the time you’re done, the water is running cold and you stand up to quickly wash yourself with soap so you can at least be clean for the next few days until you can bring yourself to shower again.
It’s when you’re crawling into bed that it suddenly dawns on you that you don’t have a job. You hadn’t shown up to your shift in days. And you don’t have Simon anymore.
Panic takes shape and you realize you can’t relax. If you don’t find a job soon you’re going to be on your ass and homeless by next month.
You haul yourself out of bed and begin rooting through your drawers for something to wear.
Maybe you can go back to the bar and beg for your job back. You’ll do anything if you have to.
You’re going to prove to yourself and to Simon that you’ll make it without him – and you won’t end up hanging from a fucking rope.
The sunlight practically burns your skin from not feeling it in a while. Winter is coming in and it’s already damn cold out and you can see your breath. But you ignore it, wrapping your jacket tighter around yourself as you book it for the bar.
You’re filled with utter dread as soon as you open the door. There’s a couple patrons already drinking and you wonder what day it is.
You look around, searching for your old boss. He’s nowhere on the floor so you make your way to the staff room and ultimately his office in the very back.
You only realize you’re trembling when you raise your hand to knock on the door. But you bite back your fear when you’re reminded that you need the job. You need it.
“Enter,” you hear his chilling voice call. You take a breath and push the door open. He freezes the second he lays eyes on you, he sports a black eye and a busted lip, “You.”
“M-Mr. Dawson,” you shakily whisper, “I-I know I haven’t showed up in a few days and I’m really sorry but–”
“You want your job back,” he finishes, tossing his head back to laugh, “You want your fucking job back? After you sent that fucking lunatic here?”
“Sent who…?” you ask softly, willing your knees to stop quaking.
“That asshole in the skull mask. Beat the shit out of me and my blasted customers. You think I’m going to let you back in after that?” he laughs again, “You’re out of your fucking mind, you dumb bitch.”
You wince at the insult, “I-I didn’t send him. H-He was a friend of mine and he did it on his own but–”
“You can have your job back,” he says suddenly, making you freeze, “If you come over here and bend over my desk for me.”
“What..?” you ask softly, watching him sit back and lick his lips as his eyes raked down your body.
“You heard me,” he snickers, “Bend over my desk and let me fuck you and I’ll let you have your job back.”
Granted, for a second, you think about it. You really do. To just let him do it. But you can’t. You know you can't, you would never do that to yourself.
“N-No,” you find yourself whispering, “I won’t do that…”
His smile fades quickly when you say that and his lip curls in disgust and anger, “Should have let those blokes take you out back and leave you bloody in the alleyway like you deserve.”
You leave with your head hanging low and find yourself standing on the street, fighting tears. You only feel worse than before you went in.
When you get home, you stand there and cry. That’s all you’ve been doing lately, crying. At this rate, Simon’s prophecy is going to come true and you’re going to be hanging from a damn rope. It sounds nice right about now, actually. Anything to stop the horrific pain that you feel.
You crawl back into bed and don’t get back up that night. Or the next day.
The only thing that gets you up the day after that is a painful twang in your stomach. You stumble your way to the kitchen and pull out the loaf of bread you’ve been nibbling at but frown when you see some pieces have begun to mold.
You take a look in the fridge, finding it painfully empty. The vegetables and fruits that were in there have gone bad now. The meat you had bought was all used up from when Simon cooked. You didn’t even have any cup ramens because you opted to not buy any last time.
So you resort yourself to tearing the moldy parts off the bread and eating what's left.
As you stand there, you realize you feel so tired. Like your legs can’t hold you up, so you allow yourself to sink to the floor, back leaning against the cabinet.
You almost want to laugh at yourself over what you’ve become. Eating moldy bread on the kitchen floor and crying to yourself.
You place the bread in the refrigerator in hopes that that will stop its rotting process but you don’t have much hope.
Then, you’re back in bed. And you’re so exhausted. It’s impossible to keep your eyes open any longer. So you sleep.
But then you have another nightmare. You can’t even remember what it was about, you’re too exhausted to even jolt awake like you usually do.
Instead, your eyes open and they’re already filled with tears before you even get the chance to register the fact you’re awake.
So you lay like that. For a long time. Just staring at nothing. The tears stop on their own and you’re left exhausted as usual. It’s become your default state and you begin to wonder if you’re going to feel this broken and hurt forever.
You zone out, letting your mind go hazy and erase all thoughts from it.
You don’t even hear your front door open. Don’t hear the boots on the floor. Don’t hear your bedroom door open.
You hear a call of your name and that gets your attention. But you don’t hear anything else.
Your imagination? You don’t have a lamp anymore to turn on. You’d thrown it at Simon and it broke.
Suddenly, light floods your bedroom and you bolt up in bed. A large, familiar figure blocks your doorway, a silhouette against the now illuminated hallway.
He calls your name again and your heart skips a beat.
“Si?” you whisper, choking on a sob when he steps further into the room.
He’s got you gathered up in his arms faster than you can think. He’s so warm and it feels so good to have him in your arms again. You wrap your arms around his neck and cling to him – hold him so fiercely that you’re worried you may actually break him.
“Shh,” he coos into your ear, “It’s alright, everything’s alright.”
“S-Simon…” you can’t help but wail, clawing at the back of his hoodie as if you can feel him any closer than he already was.
“I’m here,” he sighs, kissing the top of your head, “I’m here. It’s okay. Shit, just let it out. I fucked up, sweetheart, I did. Just breathe and we’ll make everything better, alright?”
“I’m sorry,” you find yourself apologizing through tears, “I-I don’t hate you, Si. I don’t, I promise. I-I was just mad. I’m sorry I was mean.”
“You don’t have anything to apologize for,” he consoles you, cupping the back of your head as you sob, “I’m the one who fucked everything up. It was a fuckin’ mistake.”
You can’t even formulate a response, too choked up with your cries that you let out into the soft cotton of his hoodie. You feel nothing but relief at having him in your arms again, you’re almost scared that he’s going to disappear if you let go.
But he stays there, shushing you and occasionally kissing the top of your head as he rocks you back and forth on the bed.
Before long, your cries finally quiet and you’re left curled up against him, quietly sniffling to yourself. His grip on you remains firm, unwilling to let you go.
After several, long minutes, he finally speaks, “Why don’t you go wash up, hm? Nice, hot, shower. I’ll fix you up some food, sound good?”
You sniffle and blearily look up at him, your lashes sticking together from your dried tears, “I don’t have anything.”
“I’ll make you some ramen cups,” he responds.
He doesn’t like them being part of your diet but it seems he was willing to overlook it just this once so could get something on your stomach.
“Don’t have any,” you sound completely congested as you talk, sitting up a little to wipe your cheeks.
“None?” he asks, keeping his hands on your body even as you move off of his lap.
You shake your head, “I didn’t buy any last time I went shopping.”
“What the hell have you been eating then?” he mumbles, slowly standing up from the bed.
You wince when you hear his knees and back pop from the movement, “I haven’t had much of an appetite but I’ve got some bread…”
Simon is silent after that, nonsensically looking around the room, seemingly taking stock of what's around him. Then he sighs, running a hand through his cropped hair before patting you on the head.
“I’ll order then,” he assures you, “Go ahead and shower, yeah?”
You do as you’re told, eager to wash the drying tears off of your face and hopefully wash away the lingering sadness. You know that you and Simon have a lot to talk about, but you figure it can wait until you’re both mentally prepared for it.
You feel more refreshed than you have in days when you step out of the shower. You feel a surge of anxiety in your chest when you think maybe he had left while you were showering but when you pause to really listen, you can hear him shuffling about the flat.
When you slip into your bedroom, you’re shocked to see that your bed has been completely stripped. He also swept up the broken remnants of the glass and lamp you had thrown at him and picked up the books. He had picked up some scattered pieces of clothes and put them in the laundry basket where they belonged.
You get yourself dressed and place your dirty clothes in the basket so you don’t undo the work that Simon had done.
You hear a knock on your door and it makes you jump but Simon quickly answers it. He calls your name to let you know the food has arrived and you quickly make your way to the kitchen.
He’s methodically separating the food he had ordered into two separate groups, clearly having ordered for himself as well.
It smells positively delicious and you find your mouth watering as your stomach growls.
You turn to the fridge, opening it to grab a bottle of water out of it. You notice that the loaf of bread you had in there is gone, most likely thrown out by Simon when he realized it was moldy.
You feel your cheeks burn in shame when you imagine him knowing that you had been eating moldy bread because you couldn’t afford to buy groceries – although, even if you had all the money in the world, you were sure you wouldn’t have felt like going out to get any. You wouldn’t have been able to order since you’d broken your phone.
You open the styrofoam tray and immediately start devouring the chicken tenders he had ordered for you. It was simple, easy, and tasty. He clearly didn’t want to order you anything too hefty given the fact you’ve been existing on bread.
He had a burger, taking slow bites of it and occasionally nibbling at his fries. You took the opportunity to look him over.
He honestly looked the same as ever. He didn’t have dark circles or bags under his eyes like you did. He didn’t have red-rimmed, bloodshot eyes from crying for days. For some reason that made a pang of resentment surge through you. He seemed completely unbothered by everything that had happened. Unbothered, even.
His words ring out through your head like a bell.
“We’ll see how long you last without me before you’re hanging from a bloody rope.”
Tears sting the back of your eyes again but you bite them back, choosing to take a bite of your french fries. You realize now that you can hear the washing machine going. Clearly, he had put your bedding in there to wash.
Maybe he was right, you couldn’t survive without him. Couldn’t even wash your own damn laundry.
“What’s goin’ on in that head of yours?” he interrupts your self-deprecating thoughts.
“Oh, um,” you scramble to think of what to say. Something not depressing or something that could upset him, “I was just wondering what you’ve been up to these few days!”
You try your hardest to sound chipper and interested. You’re positive he doesn’t buy the act in the slightest from the soft, pained look he gives you. But he thankfully plays along. You’re grateful because you don’t want to cry again.
“I was uh,” he cleared his throat and took a sip of water, “I was on base, actually. Nothin’ interesting, really. What, uh, what about you?”
You feel your smile falter and you look down at your food, “Nothing interesting. Tried to get my job back but that was a bust,” you chuckled, playing it off like a goofy anecdote, “Turns out your ex-boss doesn’t like when he gets beat to shit because of you!”
Simon drops his burger into his tray and his nonchalant expression turns sour in half a second, “You tried to go back to work at that shithole? Why the fuck would you do that? You know it’s not good for you!”
All over again, you feel your body flush with anger, and you’re shouting at him before you know it, “What the fuck was I supposed to do, Simon?! You left and I had no idea what the fuck I was supposed to do without you. I assumed you were gone forever,” you voice pathetically broke but you ignored it, tearfully glaring at him, “All you said was that I was gonna end up killing myself and I was doing everything in my power to prove you wrong.”
“You should have known me better than that!” he shouted, slamming his hands on the countertop, “I never would have left you–”
“That’s exactly what you did!” you shriek, pointing an accusing finger at him, “You left me! You ignored me when I needed you to go get laid and then left like I was nothing to you! Look at you for fuck’s sake, I’m a fucking wreck and you look like you couldn’t have fared better! I almost let that scumbag fuck me just to get my fucking job back, Simon! All because you left me.”
For once in his life, Simon seems utterly lost for words. The only sound in the small kitchen was the steady dripping of your leaky sink and you’re stuttering, sharp breaths as you force yourself to not break down all over again.
“I should have known you better?” you whisper, resting your hands on the countertop, hanging your head so you can catch your breath, “Apparently I should have. Maybe then I would have known better to depend on you like that.”
Simon stands there, across the counter from you but feeling like he was miles away. You could hear his breathing stutter every few seconds, like he was gearing up to say something but he seemingly changed his mind every time.
The washing machine jingle rang through the apartment and he immediately stepped away.
Typical. Simon was never the type to truly let himself be emotionally vulnerable so there was no reason for you to expect it now.
With him out of the room, you took the chance to wind yourself down, taking a few more bites of your tenders. You could hear Simon moving the laundry to the dryer, slamming it closed before turning it on.
But he doesn’t reappear, evidently hiding out in the tiny room off the kitchen where your washer and dryer were. He was probably collecting himself just like you. But he appears a second later, lingering out of the corner of your eye. You can see him looking at you but you can’t bear to look back at him.
“I didn’t…” he pauses, taking a breath, “I wasn’t…” he lets out a sound of frustration before he tries again, “I wasn’t okay while I was gone.”
He doesn’t say anything more. It was evident that that was all he was willing to give up in the moment. But you want more from him, you need more.
“I don’t know how I’m supposed to get past this, Simon,” you whisper, “Everything’s so fucked up. I’m fucked up.”
“I am too,” he says softly, drumming his fingers against the counter, “We’ll fix it.”
His assurance marks the end of the conversation and you both resume eating the dinner he had ordered. But it’s silent and neither of you make an attempt to fill it.
Once the food is eaten, you take a seat on the couch, knees pulled up to your chest as Simon takes your laundry basket from your bedroom and puts the clothes in the washer.
Your eyelids feel heavy and you wish so desperately that you could crawl into bed and sleep. You suddenly realize that you have no idea what time it is.
“Simon?” you call out when you catch him passing by. He stops at your calling, raising an inquisitive brow, “What time is it?”
He reaches into his back pocket and pulls out his phone, unlocking it so he can see, “9:20.”
“Oh…” you respond, tucking your head back into your knees.
Simon walks away at that and you briefly wonder what he’s doing now. But your eyelids are so heavy and you’re finding it so hard to think clearly.
You’re pulled from your sleep a soft hand petting over your head. Your eyes slowly drift open and you’re met with Simon’s sweet, brown eyes.
“Made your bed,” he says so softly, thumbing over your cheek, “Go ahead and get some proper sleep.”
You nod your head and sit up, briefly wondering how you managed to flop over on your side without waking up. Simon takes your hands and helps you to your feet.
You stumble down the hallway and immediately toss yourself onto your bed. You don’t even bother to crawl under the blanket, simply drop your head onto the pillow and let sleep overcome you.
When you wake up next, it’s from a nightmare. You gasp into consciousness, eyes wide open in the inky blackness of your bedroom. Your heart pounds in your ears and you find yourself panting, trying to stabilize yourself.
A heavy weight tosses itself over your middle and you almost panic before you smell Simon’s cologne. Immediately, you relax and sink back into the bed.
“You’re okay,” he whispers, voice thick with sleep, “I’ve got you.”
“I want it to stop,” you find yourself whispering, feeling so utterly exhausted, “The nightmares.”
Simon tugs you over to him, tucking you securely against his chest, his arm like a heavy weight draped across your abdomen, “We’ll get you fixed up.”
As you close your eyes and sink into his embrace, all you can think is that you should have never been broken in the first place.
You finally sleep through the night but you wake up feeling far from refreshed. What’s most shocking is that you’re still wrapped up in Simon’s arms – and he’s still asleep. The sun is well risen now, he should have been up and about a while ago. He never strays from his schedule.
You find yourself staring at him. It wasn’t often that you got the chance to see him so peaceful. His lashes were so long, brushing his cheeks. You rest your head against his chest, listening to the steady beating of his heart and the deep sound of his breathing. Your eyes slowly drift closed again and you let yourself drift off to sleep once more.
When you wake up next, it’s because Simon is trying to carefully move you off of his chest so he can get up. You whine and find yourself clinging to him again.
“Didn’t mean to wake you,” he mutters, settling back against the headboard. He wraps his arms around you and lets you melt against him again, your head resting against his chest.
“You slept late,” you find yourself commenting.
“Yeah, uh,” he clears his throat and softly rubs your back, “I haven’t had the chance to sleep much. Base is pretty loud.”
You want to mention that it’s never been a problem for him before but you bite it back. Instead, you hum in response.
As you’re left in the still quietness of the late morning with him, you realize that you still have no idea how you feel about him. You don’t know how you feel about him being back. On one hand, you’ve missed him so, so dearly and you feel so complete with him by your side. You feel safer and more whole, like you could actually start healing again.
But on the other hand, there feels like there’s a wall separating you two. The fight you two had is a heavy weight that seems to continuously pull you under the water despite how hard you fight to resurface for air.
You love him, you really do.
But you’re still so angry at him.
And it feels like neither of you are going to actually talk about it properly.
The two of you eventually make it out of bed and get moving around. You still don’t have any groceries but Simon simply orders something for breakfast again.
“Somethin’ I need to ask you,” he says, suddenly terrifyingly serious as the two of you stand in the kitchen eating.
Anxiety flares through you but you try to appear calm and cool, “About?”
“You said that,” he takes a second to collect himself, seemingly searching for the right words, “You almost slept with that guy for your job back.”
Your heart dropped to your stomach, “Yeah…what about it?”
Simon paused when he heard the defensiveness in your voice, “You really almost did that?”
You frown, “So what? I can do what I want, Simon.”
He sighs softly, holding his hands up, “I’m not tryin’ to fight, love.��
“I don’t know why it’s your business,” you mumble, using annoyance to hide the shame you feel, “I just needed a job is all.”
He nods, “You don’t need to worry about that, alright. I’ve got you.”
You take a bite of your sandwich, intent on trying to take the attention off of you, “There’s something I wanted to ask you too.”
“Go ahead,” he says softly, sipping on the drink he ordered – some kind of soda if you had to guess.
“That night…” you start, pausing when you notice the way he stiffens immediately. He plays it off by going back to his food, “You, um, you left to hook up with someone, right?”
He places his sandwich down and sighs, “Yeah.”
“...Why?” you finally ask, “I mean…”
You trail off and Simon remains silent. The tension is so thick you could practically see it between the two of you. Your heart hammers in your chest, anxiety steadily festering the longer he’s quiet. You think he isn’t going to respond at all and start to give up, hanging your head.
“I wasn’t thinking clearly,” he finally says, “It was a…last minute choice and it shouldn’t have happened.”
He says it but you don’t feel any relief. That concrete weight on your chest isn’t eased in the slightest. It’s an excuse, something he’s saying to get you off his back. And that doesn’t feel good.
“I um…” you clear your throat to get rid of the way it sounds thick, “I’m sorry for that time, by the way. When I was throwing things and I-I hit you. I shouldn’t have done that, it was wrong of me. So, I’m sorry.”
“You don’t have to apologize,” he says softly, shrugging his shoulders dismissively, “You were upset.”
“Simon…” you mumble, food completely forgotten in front of you, “I want to talk. About everything,” Simon seems annoyed immediately but he tries to hide it. You know him too well for that, though, “I-It was a lot and I think we should talk about it – really talk about it.”
He says your name exasperatedly, turning to open the fridge so he can put his leftover food inside before he slams the door. “I don’t want to talk about anything.”
“But I do,” you say, following him as he storms out of the kitchen, “You said some really mean shit, Si. I want to talk about it!”
He storms into the bedroom, slamming it open as he busies himself with picking up inside. You can tell he’s uncomfortable and simply trying to take his mind off of it. But you’re not going to let him avoid it.
“I don’t,” he snaps, final and harsh.
“I do!” you argue again, “I-I want to know why you said that to me. I want to know how you could–”
“Fuck sake!” he hisses through clenched teeth, ripping his hoodie off of a chair he had tossed it onto.
He pushes past you, tugging it over his head. You follow him out of the room, watching with wide eyes as he picks up his mask from the coffee table. He tugs it on, painfully silent as he fits it into place.
“What are you doing?” you finally ask when he gets to the door, slipping his boots on with a grunt, “Where are you going?”
“Out.” he growls, jerking the door open so hard it rattles on its hinges.
“Don’t run from me, Simon!” you cry, grabbing hold of his sleeve to keep him from stepping out, “Are you ever going to tell me you're sorry? Are you ever going to look in my eyes and tell me that you're sorry for what you said to me? For leaving me? Or are you just going to do it again?”
You can’t fight the tears as you cry out, trying to tug him back into the apartment. But he gives you one final look before he rips his arm from your grasp and slams the door in your face. You’re left alone again, frustrated, sad and utterly confused.
You wished he would stop leaving.
You decide to stay up a little later than you had lately, waiting for him to come home. The oven clock read a little past midnight when you finally called it and crawled into bed. Tugging his pillow to your side, you wrapped yourself around it and tried to imagine that it was him in your arms again. Closing your eyes, you will yourself to fall asleep, no matter how much you want to stay up and wait.
You’re jostled awake by the weight shifting on the bed. Your eyes flutter open as it creaked under the additional weight. You know it’s Simon, even though your back is to him. He remains silent, clearly trying not to wake you and unaware that he already has.
The heat radiates off of him in waves, comforting and nice. But despite that, you feel tears welling up until they finally trickle down your cheeks. You can hear Simon’s soft breathing and you can feel him shift every once in a while as he tries to sleep.
“I can’t do this, Simon,” you find yourself whispering. It’s quiet but you know he hears it, “I want to feel better again. I want to stop being so fucking angry at you but you won’t let me. You just leave me again and I want you to stop. I want…” you suck in a breath and find yourself struggling to continue, simply dissolving into cries. You quiet them as best you can into your pillow.
Simon is painfully silent and still. You’re positive he’s not going to say anything. He’s going to pretend to sleep so he can avoid talking about it because that’s what he does best – avoid. When things get too hard or emotional, he avoids it like the plague.
You suppose it’s from the way he grew up. A mama’s boy who was punished by his father for showing any kind of emotional vulnerability. It led to him being terrified of it as an adult – he refuses to let himself show that kind of weakness, even to someone who means something to him. And you know that you do – mean something to him, that is.
“I’m sorry,” he finally whispers, just an echo in the darkness of the room. But it draws you to silence, “I’m sorry,” he repeats, voice thick with emotion, “For what I said to you and for the way I acted that night. I fucked up, I know. It never should have happened. What I said should have never–” he lets out a heavy breath, “I never should have said it.”
You roll over, blinking the tears out of your eyes, which tumble down your cheeks. With a sniffle, you scoot closer to him, his warmth welcome and comforting. He opens his arms for you, letting you situate yourself against him. You rest your head against his shoulder, letting your hand rest against his chest. His own hand comes up to take it in his, bringing it up to press a kiss to your knuckles.
“You mean…” he trails off again but you remain patient, knowing it’s difficult for him to fight through his desire to flee, “You mean a lot to me. I never want to lose you. You’re…important.”
You nuzzle your head against him, a silent acceptance of his apology. He kisses the top of your head and pulls you more firmly against him.
“I’m sorry,” he whispers again for good measure.
He didn't look you in the eyes and tell you he was sorry but he did the best he could. In the inky blackness of your bedroom, as you shared a bed, and he held you so sweetly, he finally said what you needed to hear. And that's truly all you could ask for.
PART TWO.
do not modify, translate, or repost.
5K notes
·
View notes
!!PLEASE READ END MESSAGE BEFORE REBLOGGING!!
So guess who got a big break from their projects and was also informed about Clowns boundaries? <XD Me!!
I was super cautious to draw fanart of these characters at first.. But after getting some informative comments (thank you guys!) and thinking it though.. I don't think any of my artwork would cross a line. So here I am! And BOY do I have a lot of experimenting to do on these partial redesigns.
I'm sure you've noticed Sally is bright blue and very spikey. I was going for a young blue star look, but now that I'm looking at it.. ehh,, blue might not be her color, idk. Also her cool glow effect took so long to draw that I only drew it on 1 canvas. So definitely gotta think of a better way to draw her glow.. Barnaby needs some work too. I don't like how his fur patches came out. They look spray painted on.. Also Frank's vest and Sally's sweater took AGES to draw. I either need to find a faster way to draw them or just redesign them all together. Same with Poppys feathers, they took forever to color-- aaaa
ANYWAY, you guys get the point XDD First time drawing these guys to the fullest and my interpretations need some work. But I hope you like these drawings none the less!
Also important note!!
To avoid any potential drama or uncomfy stuff, please only tag this post as the individual characters, and "Welcome home arg" No other tags of any kind. No ships, canon or not- No exceptions. Just avoid any and all potential problems by tagging simply. Individual characters and the series name. This would be very much appreciated and would encourage me to come back and draw more Welcome Home stuff. Thanks you guys! <:)
6K notes
·
View notes
gonna make another post since that usually helps with reach
teehee poll for reach. please read the rest of this if you can
HI IM DELILAH AND IVE GOT LESS THAN 4 MONTHS BEFORE IM HOMELESS WITH NO OPTIONS FOR PLACES TO LIVE
heeyyy its me delilah. im an autistic plural trans girl with ptsd, and im living in an abusive household with my adoptive "father" that absolutely hates me. in less than 4 months, i am going to be kicked out, and i am trying to raise the money i need to survive this event.
ive been trying, pretty much every chance i get, to get a job, but i think because of this shitty small town in texas, everyone already knows who i am and nobody wants to hire me. this means i have to rely on stuff like this.
by JUNE 1ST 2024, i need to make enough money to move out, or else... well, i dont really know what will happen to me (other than vague "homelessness"), but im really scared that it wont end well.
on top of that im rarely being fed enough which is seriously fucking with my mood and making me feel like shit, so im having to balance saving and eating which.. with the money im currently getting, is not very sustainable. other than a few people giving a lot (who i am eternally thankful for and if youre able to do this i would basically do anything for you) im basically getting zero donations.
i get that this kind of stuff is annoying and maybe a bit slow, but just taking a few seconds, maybe a minute or two at most, to give me a small amount of money, would be a hell of a lot more helpful than doing nothing.
C*SH*PP - @delilahswagga
P*YP*L - @delilahkill
plenty of people use stuff like this to scam, so heres some info about me if you doubt that this is true. (copy pasted from previous post)
i have a really big love for performing, i fell in love with theatre years ago and performed the addams family musical as fester about a month ago as my biggest role on stage yet, and right now im in the process of getting ready for antigone as teiresius. i love music, and its one of my life goals to learn as many instruments as possible, and currently i own quite a few, though my favorites are my two ukuleles and my super cool electric guitar. i have 8 partners at the moment, and i have a very big desire to one day live with as many of them as i can. i pride myself on being the best partner i can be, and its been my goal to make all my partner's lives better (and i think ive been doing a good job at it :3)
i love cats an extreme amount, ive never had a cat myself (because my dad is insane and hates cats and tries to hit cats with his truck) but being around cats makes me super happy and always makes my anxieties go away, even when im having an anxiety attack or a panic attack. i really hope i can get a few cats one day, and i want to give them all silly food names :) my fursona is kind of a reflection of that, her name is bagel. some cat names ive thought of are mochi, chili, Supreme Pizza, or maybe french fry :)
im not sure if ill be able to achieve any of my goals if i dont get the financial support i need. ive been.. really close to giving up recently, but i dont want to have to do that, so im going to fight like this for as long as i can.
2K notes
·
View notes
Everyone Looks Better in a Sundress
Pairing: Spencer Reid x Reader (GN + AFAB)
Summary: The AC at the BAU decides to take a holiday during a summer heatwave, and when you decide the FBI’s dress code is merely a suggestion, you unwittingly catch Spencer’s eye.
Genre: smut (18+, minors DNI)
Warnings: Dom!Spencer, sub!reader, semi-public sex, fingering, car sex, degradation, name-calling, edging, praise-kink, dumbification, basically Spencer is a tease and the reader really gets off on using his official title.
Word Count: 3.8k
Authors Note: Hello! This is my first posted fic, so any feedback is welcome and absolutely appreciated (I tried to keep it GN!AFAB but if you notice any gendered pronouns pls lmk immediately!) I finally decided to start writing again after a few years, so I might be a bit rusty but I recently started rewatching Criminal Minds and I am so in love with Spencer! This little fic was inspired by @imagining-in-the-margins CM Summer Sunshine Fic Challenge, so big thank you to them for the inspiration! This could also develop into a multi part fic in the future, so if that’s something you’d be interested in, please let me know in the tags and comments! XOXO K
Part two!
After three years in the BAU, you should know that summers in Quantico, Virginia are nothing to play about. Sure, it could be cloudy sometimes, and summer rain did allow for some relief, but with a heatwave on the way and a week of office work ahead of you, it seemed every member of your team was excited for the office AC.
That was, of course, until the maintenance department sent out an office-wide email telling you it was “undergoing work” for the foreseeable future.
You received the email during your commute, and immediately turned around to change. There was no way you were surviving in your slacks and long-sleeve shirt, and, truth be told, you knew that your bosses wouldn’t mind if you were a little more relaxed in your workplace attire if you weren’t going to be spending time in the field.
It took all of thirty seconds to shoot a message to Garcia, telling her that you’d be a few minutes late for your daily carpool, letting her know the situation so she didn’t hack into your car GPS (which she still claims she absolutely did not do the last time you accidentally slept in, but would in an emergency just to know you were safe).
She quickly sent you a reply: “put on that floral number we picked up last week! Between you and Morgan, I'm hoping my eyes will be feasting today 😉.”
You let out a little chuckle as you read the message, and quickly complied. A sundress didn’t sound too bad right now at all.
The dress in question was perhaps pushing it slightly for office work. It was short, and you knew immediately when putting it on that you would spend the day pulling it down to a more appropriate length. But the shade of blue fit your skintone perfectly, and the floaty material was exactly what you needed to beat the heat.
Grabbing your keys again before you could second guess yourself, you didn’t let your mind linger quickly on the thought that perhaps the dress was a little attention grabbing. And perhaps there was someone in the office whose attention you wanted to grab.
-X-
The commute into the office wasn’t bad, but stepping out of your nicely temperature regulated car into a wall of heat made you thank yourself for your foresight. And it seemed that the rest of your team was dealing similarly. Walking into the office, you noticed that Prentiss had divested herself of her shirt, sitting comfortably with an iced coffee and red tank top, an electric fan inches from her face. Morgan was similarly outfitted in lighter clothes than usual, and you could audibly hear Penelope’s brain working to come up with the best heat related compliment for her work husband. You couldn’t see Hotch or Rossi, but you knew they kept their own back-up units in their offices, so they wouldn’t be struggling at all today. You assumed JJ, too, was in her office.
“Well, look at you Cutie. You’re gonna break some hearts today, I know.” You roll your eyes as you throw your bag down. You were used to Morgan’s playful teasing by now, but compliments and affirmations were always welcome. You grimaced looking down at your desk chair and realised you had another problem. Your very recent purchase of a black leather office chair was going to absolutely make your day a living hell. Before you resigned yourself to a day of sitting in the orthopedic seventh layer of hell, your heard the angelic call of your office BFF.
“It feels like the devil’s armpit in here, god, do not expect an miracles from me today, I’m collecting my laptop and immediately moving away from all the heavy heat-producing machinery in my cave. Anyone got any space at their desk for me to work at?”
“Yes!” You replied a little too quickly.
“Feel free to make yourself at home, Pen, I have to look over some files with Reid later anyways so I’ll just pull up a spare chair to his desk, it’s all yours.” You thanked your lucky stars that everyone was too hot to tease you about your imminent proximity to the office’s Boy Wonder.
It turns out hiding a small, tiny, stupid crush from a team of FBI profilers wasn’t the easiest thing to do, but you were confident in thinking the only one who had clocked on so far was Penelope. And that was only because of your weekly girls nights and an unfortunate habit of spilling secrets while intoxicated. Sure, the others still teased sometimes, but that was only because the two of you were the easiest targets. And they just didn’t know how on the nose they were sometimes.
She gave you a quick look, of the ‘we will be discussing this later’ variety but didn’t say anything else and quickly excused herself to collect her things.
You quickly pulled up a (non-leather) chair next to Reid’s and straightened out your dress as you started searching for the file you were looking for. Although you absolutely had an ulterior motive to intruding on his space, you actually did have work to do. But the heat, and the knowledge that you’d be working closely with Reid again any minute now did nothing to help you stay focused.
Of course, having worked on the same team now for three years meant that you’d been alone together before. In all honestly, he was your partner of choice for any field task and you complimented each other well. The two of you worked together on Geographical Profiles for the majority of your cases, using your people skills, and his practical knowledge to gain insight into the locations unsubs lived, worked, murdered and hid their victims. And of course, you were friends outside the office, too. But you felt there was a distance between the two of you that made itself known the minute you stepped off the Jet or out of the bullpen.
As you searched the desk, you let your mind wander to what he would look like in this heat. You knew he didn’t deal with the heat well, and could often be found with his shirt sleeves rolled up and top buttons undone on the cases in the warmer climates. You thought about him panting in the heat, pushing his hair out of his face, glistening with sweat and grumbling quietly about the heat. You specifically thought back to a case from a few weeks back, where the two of you had an awkward run-in with an automatic sprinkler when you made your way to interview a witness. His purple shirt had ended up soaked, and on day six of the investigation, his go bag was thankfully short of replacement clothing. So he’d sat in the precinct, shirt semi-transluscent, completely oblivious to your brazen oggling and sudden lack of anything intellectual to say. Or anything to say in general.
It was only as you felt yourself getting warmer (a particularly impressive feat on today of all day’s) that you had to pull yourself out of the fantasy. But of course, as you stood up to get yourself a cool drink, you realised you were face to face with the man of your fantasies.
“Y/N? Did you need something?” He looked down at you, with a soft smile on his face.
“Oh! No, it was Garcia, she, um, she needed somewhere to work because her office is practically a sauna with all those computers. And I was thinking, we still need to work on that report on the geographical profile from the last case, so I offered her…my…” You trailed off, noticing you were rambling and allowed yourself a second to look at the man in front of you properly for the first time that day.
It was going to be a miracle if you got any work done ever again.
Like you, he’d opted for a change in uniform. He’d rid himself of his usual waistcoat-cardigan combo and was left in a button down shirt. It was, as you’d hoped and prayed, open slightly more than usual at the top. You frowned unconsciously as you realised he had also pushed his shirt sleeves up to his elbows, unhappy that you wouldn’t get to watch him do it in-person, his veins popping out as he exerted himself in the smallest way.
A few seconds of silence passed, and you had to make yourself tear your eyes away from a droplet of sweat that was neatly making its way down his throat, tracing a line that you could only hope to one day follow with your lips. When you snapped your eyes up to his, he nervously did the same, gripping his bag a little tighter to him.
“Oh, yeah that sounds good, um, let me just put my bag down and we can, uh, get started I guess.”
“Yeah of course. I was just gonna grab a drink first, do you want one?”
“Sure, yeah, a coffee would be good.”
“Okay, I’m no expert but that cannot be healthy in this heat. I know you’re practically a caffeine addict at this point, but I’m getting you a glass of water and you’re going to thank me, okay Doctor?”
He rolled his eyes and settled comfortably into his seat, but made no complaints as you walked away.
-X-
“This is ridiculous, how can they expect us to work like this?” Agent Prentiss grumbled from her desk.
“Oh, come on now, Prentiss, you can’t be complaining about a little heat, now.”
You rolled your eyes at your coworkers playful back-and-forth, doing your best to not melt into your borrowed seat. You’d been working side-by-side with Reid for the last three hours and the heat was now unbearable. You were stuck to the seat in an uncomfortable way, especially with the extra exposed skin from your dress. It had ridden up your legs more than you expected it would, so you were constantly shifting in your seat attempting to keep yourself decent.
The heat rolling off your teammate didn’t help. You had assumed that his love of cardigans, scarves and layers in general meant that he usually ran on the cooler side, but he was practically burning up next to you, making any and all accidental touch near intolerable.
Each accidental brush of his fingers as you passed files between the two of you, each knock of your knees together under the desk as you moved to read over one-anothers shoulders, and every time you got up for another drink, it’s like he’s read your mind because he stood up at the same time and you had to awkwardly untangle yourself from the mess of desk chairs and office furniture. With every touch, you feel yourself getting hotter and hotter, the heat pooling between your legs embarrassingly.
It’s only when, later in the day, he brushes the seam of your skirt with his fingers when reaching over you with his other hand for a file you know for a fact he does not need, you realise that all of those accidental touches may have been absolutely intentional.
Lowering your voice to a whisper, you bring your lips closer to his ears.”Spence, what was that?” You try to keep your voice steady, but his fingers are stil lingering closer to your sensitive areas than you found comfortable.
He drops his eyes to yours, looking you in the eye for the first time since you started working together in a comfortable silence.
“What was what?” He asks innocently, his cheeks flushes as he starts drawing small circles on your thigh.
“You’re touching me. You’ve been touching me a lot today, Doctor.”
“Oh, I’m Doctor now, am I?” He smiles at you before quickly moving his attention back to the file he was reading.
“Don’t change the subject.” You feel your whole body flush, as he ignores you and continues his reading, not removing his hand from your leg the entire time.
“S-Spencer, I’m serious.” He looks at you again then, and your heart jumps into your throat as you realise he’s removed his hand from the hem of your skirt, only to have it return under the material, moving closer and closer to where you really wanted him.
“You know,” he whispers under his breath, so quiet you’re sure that no one could overhear, “you look really pretty in this dress.”
Your brain is short circuiting as you feel his hand on your inner thigh, failing to register the implication of his words as you do your best to stammer out a reply.
“A-actually, Garcia chose it out for me. She said that you would-” you cut yourself off before you can say anymore. You’re surrounded by a room of your close friends and teammates and you’re doing your best not to beg your incredibly attractive coworker to push his fingers into you right then and there. Biting your lip so you don’t say anything else, you try to stand and shift away.
But Reid is there, and with his other hand he maneouvers you even closer to him somehow.
“She said I would what, beautiful?”
He’s so close now and you find yourself again staring at his exposed neck, wanting nothing more than to bury your head in him and kiss and lick and bite until he gives you what you want. The little circles he’s drawing on your legs are removing your inhibitions quicker than any alcohol could.
But then he grips you a little tighter, and forces you to look up into his eyes again and respond.
“She said that you would, uh, she said that you would’nt be able to take your eyes off of me. We were shopping together and she was just teasing and, well, yeah.”
“All dressed up for me, then? You thought you’d test the theory and see if she was right?”
And suddenly he’s ghosting his fingers across your panties and you’re doing your best to not make any other noises as he looks you deep in your eyes.
“Do you think she was right, Y/N?” He asks. But before your brain can catch up and choose whether or not to answert, he’s pulling away. He’s standing up and he’s walking over to Morgan, file in hand, asking questions about another previous case file, and you’re left sitting at his desk questioning if any of that actually just happened.
-X-
You spent the rest of the day in a daze. Luckily, your team was so busy complaining about the heat that you were sure none of them noticed the tension you carried through the rest of your day. With the AC still not working, Garcia had gained permission from Hotch to head back to her own apartment to finish up the day with more appropriate equipment, and had quickly evacuated your desk, allowing you to retreat back to your own space.
Emily had finished her own paperwork early due to a well-timed bet with Morgan, and had taken herself off to JJ’s office, and Morgan was meeting with Hotch in his office to discuss a potential death row intervew. So with the end of the workday in sight, only you and Reid remained in the bullpen.
After your little run in, you knew that you weren’t going to get any effective work done. Emily had once joked that Reid’s high IQ gets slashed to 60 every time he comes in contact with an attractive woman. At the time, you’d laughed, joked along. Nowthat it was your reality, it wasn’t as funny to you.
He’d played with you, called you beautiful, had his hands on you in the most frustratingly dizzying way- and then just as soon walked away from you. It wasn’t as if you wanted him to take you right then and there, in front of the entire office.
In fact, you’re quite sure that no matter how horny you were, you’d have stopped him before he went any further that publically. But you weren’t as sure you wouldn’t have dragged him off to a supply closet and forced him down on his knees and under your skirt.
To be short, you were pissed. He had left you, hot and bothered, on a day where you literally could get no relief from the heat.
You watched him work for a while after that. His desk faced away from yours, which meant you could covertly watch him whilst he worked and he would be none the wiser. After catching yourself staring a hole into the back of his head for the fifth time in an hour, you grunted out a curse and started packing your things up for the day. Unfortunately, you were just loud enough to catch the man’s attention.
“Leaving so soon, princess?”
“Yes. It’s hot and I’m tired and I just want to go home and take a cold shower and get into bed.” You started packing your things up again, but you quickly noticed that Spencer was doing the same.
“Are you leaving as well?” You asked, your stomach doing a small flip in apprehension of his answer.
“Yeah. I’m also hot, and tired and a cold shower sounds amazing right about now.”
You flushed at even the slightest change of a double meaning. Did he want to shower with you? Was he really going to step over that line?
He continued to pack up his things calmly, and you did the same. You walked towards the elevator, and it wasnt until he reached from behind you to press the call button that you realised he was so closely following you.
“And besides, your bed sounds amazing right about now.” The hairs on your neck stood up as he whispered into your ear, his hot breath fanning against your neck as you felt heat pool between your legs for the second time that day. You froze up like a deer in headlights, and as the elevator dinged open, you felt Spencer walk you in, press the button, and close the door before making his next move.
“You didn’t answer me earlier, you know? When I asked about the dress? Do you think Garcia was right?” He had crowded you into one corner of the elevator, and your brain was still short-circuiting. Shit, maybe you were the one whose IQ was cut in half, because the man in front of you seemed more confident than you had ever seen him before.
His placed his hands on the guard rail either side of you, as one of his legs found its way between yours and you let out a small whimper, then cursed yourself when you saw the smirk growing on his face.
“Come on, Princess, use your words.” He teased again.
“She wasn’t right.” You breathed out. “You looked at me a few times, but nothing too long and nothing…inappropriate, but-”
“But what?” He pushed his leg further into you, moving his hands to grip the fabric at our waist, and suddenly you were counting your blessings that no other agent in the building had decided to use the elevator right now.
“But you can’t keep your hands off of me.” His lips crashed into yours the second you finished your sentence, as you desperately grabbed at his hair, desperate to feel more and more of him against you despite the sticky heat.
He pulled away reluctantly as the elevator came to a stop in the basement carpark, but you still desperately clung to him, pressing kisses into his jaw and down his neck as you breathed in the scent of his sweat on his skin. Your words had failed you, but your body was desperate to communicate exactly what you needed.
He chuckled as he pulled you off of him, stroking your hair as he pulled you to your car. Opening the passenger side door for you and taking the keys from your bag, he placed a kiss to your temple, pulling away only enough to whisper into your ear. ”Which one of us can’t keep their hands off the other now?”
You were hot and delirious and you were not going to interrupt him now. He climbed into the driver’s seat, something you knew he didn’t do often, and placed his hand on your leg again as he drove.
“Spread your legs,” he ordered as soon as you were far enough away from the building. You complied immediately, not wanting to interrupt anything the man might do to you. “Good girl,” he mumbled as he immediately picked up where he left off earlier, rubbing your sensitive nub through your underwear. Your dress was pushed up now
“You know, Garcia was right” he spoke again, his fingers snaking their way under the elastic of your underwear. You could only moan in surprise, desperately close to getting exactly what you wanted.
“I have been staring at you this whole day. You came in this short dress, practically on display for anyone to see.” His fingers were now slowly circling your clit, going torturously slowly as you bucked up your hips for some much needed friction.
“When you got me that glass of water, I followed you, you know. Watched you reach for the glass on the top shelf, saw your skirt riding up. We’re you so desperate for me to notice you that you put yourself on display for the entire office like a little whore?” You moaned in surprise as his words registered in your mind.
You tried to reply, to deny and protest your innocence, but he chose that minute to thrust a finger into you, the awkward angle forced by your position in the car creating a beautiful friction. You started rocking your hips quicker against his hand, opening yourself up to him fully, and grabbing his wrist so he couldn’t pull away for a third time that day.
“You can’t even deny it, Look at you using my hand to get yourself off. Are you gonna come for me? Gonna do it right here in your car?” You moan out a yes as he adds another finger, stretching you out further as you whimper around him.
“Fuck, yes Spence, I’m a whore, your little whore.” You feel that familiar coil in the bottom of your stomach tighten and soon your releasing yourself all over his hands. Gasping for air, your head falls back on the passenger seat, and you release your grip on Spencer’s hands.
“Good job, princess, you did so well for me. We’re almost home now, let’s get you in that shower.” You whimper a little, nodding as you allow your brain to settle once again, completely comfortable with letting Spencer take control and do whatever he needs to do with you for the rest of the night.
-X-
7K notes
·
View notes
𝐉𝐔𝐒𝐓 𝐋𝐄𝐓 𝐌𝐄 𝐋𝐎𝐕𝐄 𝐘𝐎𝐔.
⟣ sypnosis. you had been in your first ever relationship with suguru for a couple months now. neither of you have taken your relationship to the next level; suguru was extremely patient and never brought the topic of sex up until you one day decide you were ready.
⟣ note. first fic for my event :3 i spent way too much time on this fic so it turned out very detailed, long, romantic and fluffy. i hope you all enjoy and appreciate it teehee. this post contains smut, proceed at own risk ! wc: around 6.1k
⟣ tags. soft dom!geto suguru x virgin!female reader. fluff + smut. slow burn. age gap (reader 20-ish, suguru around 29/30), little talks about insecurity, loss of virginity, breast play, edging, teasing, fingering, lots of praise, dirty talk, size difference!, p in v — unprotected (dont b like reader and use protection please), creampie, aftercare, suguru’s really romantic and just a softie for u, suguru being a good ‘dad’ to mimiko and nanako and teeny tiny bits of him secretly being a pervert.
never in a million years had suguru expected his girlfriend to be so upfront about such a big, personal decision. the thought of having you say those words had never crossed his mind.
“can you repeat that for me, sweetheart?”
could you blame him for asking you to clarify the words you’ve uttered? that man has seen you as an oblivious and innocent woman ever since the start of your relationship. of course, unbeknownst to him, your thoughts were anything but that.
you may be a virgin, but your mind was a place for the most lewd and nasty thoughts. it’s just that you’ve been scared of being intimate with a man—it’s frightening, especially when having heard the many online stories about how badly it could hurt. some say that such descriptions were over exaggerating, however your inexperience still lead you to believe everything you’ve read about the topic.
and then you started dating an older man named suguru. you’ve met him by chance at a mall in kyoto and he was the first one who approached the other. you remember how suguru politely asked you for some advice regarding what type of presents he should get for ‘two teenage girls’. of course, you agreed to helping him out and that’s how you two eventually ended up brainstorming about possible ideas in a cozy café.
once seated, chosen drinks in both your hands, you asked the man whether the gifts were meant for his daughters. somehow, that’s the first connection the neurones in your brain had made once suguru told you about the two teenagers he was picking out presents for.
you remember it vividly; the sweet, gentle sound of the laughter that accounted as your answer, the eyes of the then stranger looking rather nostalgic as they stared into the liquid in his cup. suguru responded vaguely; “i guess you could say that, yes.”
that little ‘date’—if you could call it that—ended on a wholesome note. suguru thanked you for your time and made sure that you safely got into the train you needed to take home. he did want to offer you a car ride, however he kept that question to himself since he knew that no woman would voluntarily agree to be taken home by a stranger. even if suguru had the purest of intentions.
there were a couple more dates that followed after that one; all where you both gradually got to know each other better. you’ve found out so much about suguru—the details about his own life being both fascinating and sad at the same time. likewise, suguru had also learned much about you. he always shows great interest in what you tell him, even if it’s a minuscule detail. he remembers it all as well—a feature which caused you to feel funny things in your stomach.
you realised you were catching feelings for that mysterious yet sweet and loving man; it was inevitable. the way he makes you giggle, his respectful and easygoing manner of speaking, the slight touches you two shared on accident.. all of it added to your little crush.
however, you didn’t actually think suguru was falling for you too. you only met up for a few times, plus, you seem out of his league—both due to your age gap and difference in the things you’re pursuing at the time. you were in college, trying to get your degree whilst he already had a job as a powerful leader of an organisation and was trying to achieve one of many goals with them.
there’s not a chance he’d like you, right?
wrong. you were confessed to a couple weeks after your first meeting and have been in a relationship for over 4 months now. it still felt like a dream; having your first boyfriend be such a gentleman. it truly felt like you already met the love of your life whenever he was near.
suguru’s been nothing but sweet and caring to you, has never asked you to engage in any sexual activities nor even ever dared to touch you in places you haven’t consented to. the furthest you’ve gone in terms of intimacy in those four months, were make-out sessions. just some tongue action here and there—adding sprinkles of neck kisses and hickeys.
there were times where you wanted to let things escalate, however you couldn’t bring it upon yourself to ask your lover. suguru wasn’t the person to decide your feelings for you either—if there was no verbal consent coming from your lips, he’s not going any further. even if he wanted to as well.
you were grateful that suguru was that willing to wait for you, no matter how long it might take. not only were you anxious of the possible pain the sex would bring, but it was partially due to the fact that your lover was much more experienced in that field.
what if you were lacking? what if it wasn’t satisfactory enough for him and he’d eventually leave you for it? it’s obvious that suguru wasn’t the type of man to actually do that, however you couldn’t stop the many possibilities from running free in your brain.
your change of mind was rather spontaneous; it was today when you suddenly came up with your final decision. you were staying over at suguru’s, the sun was out and he was sitting on his balcony, reading a book whilst sipping on his coffee. what caught your eye was his bare back and the muscles which were on display to you.
suguru was shirtless and the seams of light were making his skin glisten—the view making your own body hot and bothered. you bit your lip and approached your boyfriend from behind, wrapping your arms around his shoulders before kissing his neck. that skin-to-skin contact made you sure of your decision; you needed him. in more ways than one.
that’s how you ended up saying what you said. the statement left suguru baffled since you uttered it in his ear out of the blue. he couldn’t deny one thing however; the idea certainly did send a shiver of excitement down his spine.
“i said,” you repeat with a little mischievous grin, leaning in closer to your lover once he turned around to face you properly—as if searching for any hints that your words were indeed not his imagination, “i wanna lose my virginity to you.”
it wasn’t. you actually said it—the words that would take your relationship a step further. although, suguru couldn’t help but wonder where your sudden decision came from. his hands found their way to yours and he held onto them like they were two delicate flowers.
“i’m happy to hear that, though i’m curious,” your lover starts off carefully as he places chaste yet soft kisses on your palms, “why so sudden?”
you shrug nonchalantly like you didn’t feel that twinge of nervousness in the back of your mind as you felt suguru’s lips on your skin. ‘it really was happening now, was it?’—that kind of feeling was the cause of your subtle anxiousness.
“well, ehh— you just looked good.. sitting there.. i guess.” you mumble, voice trailing off in embarrassment whilst your eyes darted around the balcony in attempt to avoid suguru’s gaze. your flustered expression and adorable confession makes him laugh gently. it was not a mocking laugh at all—more of an amused one;
“just when i thought you couldn’t get any cuter..” the long-haired man muses, the locks of his bangs grazing ever so slightly against your hands as he keeps holding them, “you never fail to surprise me, do you know that?”
suguru had a way with words that made you weak in the knees. or maybe it’s simply because he’s shirtless and kissing your palms so romantically. you don’t know which one it was.
“but, love,” suguru continues carefully as he stands up, your eyes following his as he towers over you, “are you a hundred percent sure? i don’t want to do anything you aren’t comf—“
“yes.” your answer cut your boyfriend off and he’s left in shock once more. your eyes were filled with determination, yet the faint glint of nervousness in them didn’t escape suguru’s sight. you’ve given your verbal consent and are even the first one to suggest the idea— what more could he ask of you?
there hung a silence between you two, the breeze blowing through suguru’s dark locks making him look even more majestic than he already was. you had no doubt about it; today was going to be the day. it had to be.
“then, if you’d let me have this,” his low voice sounded more sensual than it had ever been as his hand found its place on your cheek, fingertips rubbing against your ear, thumb softly pressing onto your skin—
a slow and romantic kiss followed straight afterwards. it had caught you slightly off guard, even when knowing fully well that this was what you were longing for.
his lips moved in tandem against yours, the soft touch making you feel certain emotions that you hadn’t even thought existed. this man whom you called your lover had never been unable to expose you to new sensations. and soon, he’ll grant you another one. a much pleasurable one.
one arm circled your waist, the other held up, hand on the back of your head to deepen the passion-filled kiss you shared. his lips parted your lightly trembling ones, the tips of your tongues attentively rubbing against one another as if to test the waters; was it fine to go further? are we actually doing this?
you were. it was set in stone as your throat formed soft noises of satisfaction, shaky breaths being exchanged by the two lovers on the balcony—not one of you realising that the weather was changing in the background. the sun was setting, creating the perfect mood for the situation as you were still engrossed by each other’s moves and touches.
it was only for the sake of catching your breath that you had pulled away. your cheeks felt hot, as did your entire body which was still pressed against suguru’s—chest to chest. the proximity was one you both had enjoyed many moments before, however this instant was unlike any other. you both knew as you stared at each other in silence, your quick breaths doing the talking instead.
“will you let me..” the voice of which you have grown to adore spoke to you, the owner grasping your attention once more by holding onto your hand. suguru’s fingers smoothly slid across your skin until they found the puzzle they were meant to complete—that being the gaps between your own fingers. once your hands were tightly intertwined, the man finishes his sentence;
“will you let me love you?”
his face was still close to yours as he uttered those beautiful words to you, warm breath lightly fanning the thin strands of hair on your cheeks to the side, lips subconsciously trying to brush against yours once more. but, they could wait. they could wait until the agreement leaves your mouth.
“of course.” the answer escapes before you could even register it properly. this makes suguru smile against your lips as he captured them in another sweet kiss. he muttered a small ‘thank you’ and then swept your legs off the floor—strong arms placed under your thighs to hold you up against his body whilst the hungry kisses continue.
suguru doesn’t know how he got there; carrying you over to his bed, settling you down onto the soft mattress, his body caging yours underneath him, eyes fluttering over every detail of your exposed skin. he hadn’t had you like this ever before; he hadn’t had you in his bed for a reason as sinful as this, only ever for cuddles or sleep.
“you’re beautiful.” the dark-haired man whispers as he carefully takes off the clothing covering your figure—the gorgeous skin his hands still have yet to explore. suguru can’t remember the last time he has treated anyone like this; like a treasure he’s had the honour to find and keep to himself. there hasn’t been a single woman in his life that he’s cared for this much—you’re the only one capable of mellowing him and his heart.
“stunning,” another compliment; another breath spent to praise you. your lover’s fingers teased the edges of your bra, lips kissing down your collarbone and towards the centre of your chest—each touch being done with precision. your bra became undone a second later and you let the straps fall of your arms, all the way until your breasts were fully revealed.
suguru’s breath hitches, mouth forming more saliva than in any previous instants, the liquid being pushed down his throat with a gulp. you didn’t have the chance to feel conscious of yourself in a moment like this; the dim light of the bedside lamp shone on suguru’s face, his lips glistening with a mixture of your saliva whilst his gaze was lingering on the new sight in front of him—he was utterly obsessed.
“may i?” his hands were already reaching out for the plump flesh and they came in touch once you nodded shyly. his palms were warm as they kneaded your breasts and his fingers brushed against your nipples, which made you whimper from how sensitive they were now that someone else has finally touched them.
suguru took notice of your reaction and put pressure on both small buds once again, thumbs rubbing your areolas in circular motions, “that good, princess?”
“mhmm— y-yes,” you mutter through a moan. your body was pushed further onto the mattress as your lover put more of his weight on you, your entire chest area getting covered by licks and kisses, slow and deliberate ones that left you yearning for more. suguru’s eyes gazed up at yours for consent once his parted lips hovered just above your sensitive nipples, his breath on them alone making you squirm already.
with another nod, suguru wasted no time taking one nipple into his warm mouth—wetting it with his saliva as his tongue slid around the area. his long fingers squeezed, twisted and pulled on your other nipple to give you both stimulations at once.
“mm, so good.” his muffled voice caused goosebumps to appear on your skin. suguru slowly lets his lips travel across your tits, sucking on them, even kissing down the curves until he reaches your torso. he gives that area the same amount of love and attention whilst your fingers were tangled around his smooth, long hair. suguru clearly seemed to enjoy the sensations; he let out small moans and hums against your bare skin to indicate that you should continue playing and tugging at his locks.
his tongue abruptly came to a stop right above the waistline of your panties—the barrier he was about to reach past for the first time. the hesitation was visible in his body language, however his fingers eventually tugged at the fabric, preparing to take it off.
your heart was beating out of your chest as you watched suguru slowly pull the last piece of cloth away. your thighs pressed together on instinct, stopping your panties from exposing your bare cunt.
“should i stop?” suguru asks with a raised eyebrow, fingers pulling away from your underwear now that he’s seen you close your legs. you didn’t want him to stop—it’s just the nerves that made your body move on its own command;
“please— no,” you shake your head, biting your lip as you swallowed your own saliva out of pure desire. you craved him now that it’s come this far, “need you. need you so bad, suguru.”
those words caused suguru’s brain to shut down. any irrelevant thoughts were thrown out of the window; the only thing his mind was telling him to do, was to take care of your needs. your body was laid out on his bed—trusting eyes looking up at his in anticipation, pretty hands grasping onto his sheets like it’d calm you down.
“i’m all yours, sweetheart.” suguru sighs, fingertips slightly shaking as he pulls your panties down to your ankles, eyes pausing on the revelation. to say that suguru was simply rendered speechless, was an understatement. that man was on the verge of letting loose of any self-control and just dive his face right between your thighs, eating you out like he’s fantasised of doing for a while now.
“fuck.” your boyfriend closed his eyes for a moment to collect himself before opening them to smile down at you—the handsome smile that was one of the many reasons you fell in love with him, “i’ll be careful. i promise.”
naturally, you nodded along. you’ve built up enough trust between one another during the past few months to let yourself be vulnerable in front of him. the palm of his hands patted your thighs slightly before spreading them apart, once again showing your glistening folds, a slight wetness to them from your own arousal.
suguru couldn’t help but lick his lips at the sight. he’d already have devoured your dripping cunt if it wasn’t for his self-control. but, it was your first time. he couldn’t rush into things just yet.
“thank you, baby.” the dark-haired man whispered under his breath. he was showing his gratitude for the sight you allowed him to see—a sight only he had ever seen before. the only man to be able to witness the beauty before him. that fact alone made his eyes darken in lust ever so slightly.
his fingers carefully slid across your vulva, your bodily fluid coating the skin which makes him shiver and his fingers get bolder. the cute sounds that filled his ears were only making this even better for him.
the way your hips bucked up slightly into his touch—just asking for suguru to take you right then and there—was driving him insane. every vein in his body felt like it could pop with how much he was restraining his own self from acting out of line. his finger easily slid into the little hole and suguru almost couldn’t believe it; your pussy was clamping down on his finger, your insides tightly wrapped around him to the point that even he wouldn’t know if his dick would fit in.
“hnnngh, suguru, please— wan’ your cock already,” that dirty sounding sentence was one he didn’t expect to hear from a virgin. it made him shake his head with a small, delighted chuckle; you really never failed to surprise him.
“i know you do,” suguru purrs, pressing kisses against the curves of your tits whilst another finger of his joined to stretch your pussy out properly, “but i need to prep you enough if you wanna take my cock. can you be patient for me, sweetheart?”
“m’kay. gonna try..” his fingers pumped in and out of you, the feeling of them curling up deep inside you made your walls squeeze against them. you’ve played with yourself before, of course, however it was then that you discovered that nothing could ever compare to the real thing: suguru’s long and slightly girthy fingers.
just when you thought that it couldn’t get any better, you felt a third finger—not inside you--but on your clit, rubbing the small bundle of nerves like you could’ve never done to yourself. suguru was so precise and exact with his actions which showed his experience. that’s another reason of why you’ve put all your trust in him. getting your virginity taken by a sweet, older and experienced man was probably ten times better than losing it to any guy your age, who were probably only out for sex.
suguru was there to make love to you.
your back arched once you felt suguru’s fingers increase their pace, the wet and squelchy sounds echoing through the room as they got louder the more your pussy got played with, his thumb almost overstimulating your clit to the point of release already—that’s how superb your lover’s hand movements were.
“no, no. can’t have you cum on my fingers like that.” you whine once you felt suguru take his fingers back the same moment you were about to reach your first orgasm by someone else’s hands. the older man smirks at this and kisses you on the lips, pulling away slowly with your bottom lip between his teeth, letting it lightly flop back into place as he lets go; “i wanna have you cum together with me, okay?”
you couldn’t refuse such a romantic request, thus you nod. suguru smiles back at you once more before his hands move to take off his sweatpants, tossing the piece of clothing to the side. your eyes widened as you were propped on your elbows, gaze lingering on the massive bulge formed at the crotch area, his boxers not hiding much of the shape.
once the underwear was off as well—that’s when you realised that your underlying anxiousness was not for nothing. suguru’s cock sprung free, it was slightly curved near his pink tip, drops of pre-cum flowing down the length. you haven’t ever seen a dick in real life, only ever on the internet, so this had left you stunned. you didn’t know what the average size was for a man, but there’s one thing you knew for sure: suguru was definitely way above the average size.
“cat got your tongue, princess?” he teased, his hand absentmindedly pumping his cock to the sight of your naked body underneath him. suguru didn’t even know that he started doing that in front of you; it was out of pure instinct. he couldn’t hide the excitement in his body, his shaft twitching in his hand as if it desperately wanted to feel your tight cunt around it.
“uhm, s-suguru..” you stammer a bit, biting your lip as your eyes followed his hand motions which got faster once your sweet voice called out to him. something about you looking a tad bit intimidated by his size made him want to destroy your insides to mush—have you beg him to fuck you as he bullies his whole length into your poor, small cunt.
“i know, i know..” suguru reassures you, free hand giving you a few consoling head pats, “i’ll try to make it as less painful as possible, okay?”
you hum and watch how your lover settles between your legs, spreading them enough to kneel before you, upper body bending forward to place soft pecks on your forehead; he was encouraging and preparing you more in his own way.
your arms instantly wrapped around his back, sweaty palms set underneath his shoulder blades—you took a deep breath and closed your eyes, just waiting on that moment. that feeling you’ve been craving, yet also have been avoiding.
you waited for a bit, however the only sounds heard and sensations felt were the slight dent in the mattress near one side of your body, the bed creaking faintly. suguru was leaning on side of his body, one arm stretched out to open a drawer, apparently searching for a condom.
once you realised what he was doing, you shook your head and tapped his back twice to regain suguru’s attention. his gaze immediately flickered over to yours and his head tilted to the side in curiosity; “i want the full experience—no condom, please.”
his eyes widened at the request. you seemed to be dead serious, eyes glinting determinedly, lips forming a little pout— it was impossible to refuse you, although suguru knew that he had to play the role of the older, more wise and experienced lover in the back of his mind.
he parted his lips to list off the reasons why you should let him use a condom, yet the words died on his tongue. you were impossible to say ‘no’ to. not when you’re looking up at him with those pretty eyes.
“whatever princess wants, princess gets.”
suguru prodded your entrance with the fat head of his cock, circling the hole and wetting it more by using a mixture of his pre-cum and your own arousal. you took another deep breath and tried your best to hold tightly onto your boyfriend, arms wrapped tightly around his back with your face nuzzled in the crook of his neck—bracing for impact.
“tell me if it hurts too much,” suguru whispers in your ear, leaving one last kiss on your temples before pushing his hips forward, folds stretching out and apart to allow his cock through and into your pussy.
did it hurt like you expected? yes. it most certainly did. maybe even worse than you were prepared for.
“fuck— nhhh, fuckfuckfuck!” you hiss whilst your nails dig into the skin of suguru’s back, probably leaving red marks because of how much you’re clinging onto him—like your life depened on it. that’s quite literally what it felt like to you; body being forced to part and make way for suguru inside you, pussy feeling like it was burning by how big of a stretch it was to fit him in—if he actually would be able to push all of his inches into your tight hole.
“sshh, shh, it’s okay, try to relax for me, yeah?” your lover comforts you the best he could, stilling his movements for a couple seconds before gently slipping his cock further into you. it pained him to see the discomfort written over your face, however you hadn’t made any clear signs of wanting this to come to a halt. in fact, you were encouraging him to continue whenever he stopped at any indication of hurt.
“i can take it.. p-promise,” you manage to moan out. suguru breathed in deeply at your words and nodded, kissing your lips in hopes to distract you from any pain you’re feeling, “you’re too good to me, sweetheart. really.”
both of you exhaled deeply as suguru finally bottomed out, a long minute of reassurance and pushing now behind your back. your eyes had watered up a little, chest heaving as you tried to accommodate to the new feeling inside of you.
“take your time.” suguru utters gently, voice sultry and sweet whenever its directed at you. his lips graze against your cheeks, smothering the area with pecks to take your mind off anything else. the locks of black hair tickle your chin and nose, the hairtie that usually kept a good chunk of his hair in a bun now out of sight.
suguru hadn’t taken anyone’s virginity before and that’s what also made this opportunity special to him. he didn’t know how to thank you with words, so he showed his gratitude throughout his actions; lips kissing your shiny tears away, moving across your face to your forehead and eventually to your own round lips which had formed a cute pout.
you could feel suguru smile against your mouth, his tongue gently tracing the outline of your lips whilst mumbling words of affection and praise; “you’re taking it so well, baby. such a good girl for me— love you so much.”
you giggled lightly at your lover’s appreciative remarks, focusing on returning the kiss instead of the tingling feeling in your lower body. you pulled away after a bit and looked up at him with nothing but pure adoration; “i love you too, suguru.”
if suguru had the ability to freeze time, he’d want to do it during this moment, just to relive this bit over and over. he’s sure that this exact instant will be engraved into his memory for the many years to come.
and once you’ve given him the green light to move, he did it with caution, slowly but surely. his hips moved back and then forwards, girthy cock dragging along your walls at a leisurely pace, but just enough to make your pain transform into pleasure.
suguru’s big hands were placed on your hips, sometimes they’d leave their position to cup your chin and make you face him. he doesn’t want you to look away from his eyes; he’ll think you don’t like this if you do. besides, the thing he loves most about being in the missionary position, is that he’s able to hear how good he’s making you feel whilst looking into your eyes to see your face scrunch up in satisfaction. it’s so romantic and perfect. just like you.
“my little princess is so pretty.” suguru sighs in content and kisses your tears away, thrusting into your tight cunt in a comfortable pace—not too fast but not too slow, “the way you take my cock and still manage to look beautiful while doing it— you’re incredible.”
if the physical pleasure wasn’t enough, his added commentary would certainly be. you moan and whimper phrases that sound like his name over and over again; you didn’t know what else to say as your mind was foggy with the amazing sensations your body was experiencing for the first time. that was fine with suguru since all he wants was to see you enjoy yourself—this moment was for you. everything he did was for you—every thrust, every kiss, every touch.
“nhhg, too good, so good!” you mewl and leave more scratch marks across suguru’s back, ones which he didn’t mind at all. it only served as further proof of this special moment. the tip of his cock kissed the deepest parts of your insides, puffy folds parted widely to make room for more of his length until it felt like he actually was balls deep.
“mhm—you’re, haah, tight..” the once calm and collected man seemed to let loose of himself the more he felt your cunt swallow him all the way, gripping onto his dick as if you didn’t want to ever let go. suguru grunts and moves down to leave a couple hickeys across your neck, hips non-stop pushing against yours, “don’t think i can last long—fuck, yeah—you feel amazing, baby.”
your eyes roll back as the pleasure seems to build up in your stomach as well. it felt like a coil that threatened to snap at any moment and it’d release another immense wave of pleasure upon breaking. your body was on fire, sweaty and hot, just like suguru’s.
“can you cum with me, princess? can you wait and hold on for me?” he asks, and the questions sound impossible, however you could at least try your best to fulfil his desires. you’d also want nothing more than to reach your peak together with the man you loved.
“okay—mmhh—together.” you nod and your body tenses up, legs subconsciously moving to wrap around suguru’s waist, heels of your feet simultaneously tapping against his lower back along with his hip movements. you didn’t know how much longer you could hold out for as your breathing patterns changes, whiney gasps and choked up moans escaping the back of your throat as your clit bumps against his pelvis over and over.
“almost, almost—“ suguru curses through gritted teeth, his jaw clenching while yours did the opposite. your body rocked back and forth and the bed felt like it was shaking along as well. you could tell by the way suguru’s hips rolled against yours that he was close—his eyebrows were furrowed, eyes half-lidded but not closed to still hold contact with yours and his hands clutched onto your waist. all indications of his nearing climax.
“mnph, gonna cum— shit, shit, shit, i’m gonna cum—“ suguru swears under his breath a couple times more before snapping back into reality at the last few seconds. he realised once again that he didn’t have a condom on, so his first rational thought was to pull out and finish himself outside of your body.
you were also nearing your own orgasm, not thinking rationally due to the intensity of the moment, any other thoughts except for the man on top of you were thrown out of the window. you felt suguru try to pull his twitching and throbbing cock out before it could spurt its cum inside of your dripping cunt.
you whined and shook your head, pulling suguru in for a deep kiss while tightening the grasp your legs had around his hips; “w-want to feel you cum in me— want you to fill me up while i finish too.”
suguru’s breath caught in his throat, almost choking on his own saliva from your bold requests. his only rational thought instantly vanished from his mind, now all that’s left was pure love, pleasure and desire. the mental image of his cum spilling and filling your pussy to the brim drove him to the edge.
“all yours, i’m going to give it all to you, princess, yeah? fuck !” both of you relinquished in the feeling of bliss, the warmth and build up reaching its designated ending— the expected waves of pleasure washing over you both. series of soft moans, whimpers and groans filled the room as your pussy was flooded with lots of hot cum.
it was like suguru hadn’t came in years—that’s how incredible that orgasm was experienced by the dark-haired male. the same thing goes for you; your legs were shaking, hips squirming up in aftershocks as you squeezed down on suguru’s cock, quite literally milking him dry of every drop.
“nhh, haah— suguru, love,” your tired and powerless whispers caught his attention immediately. your trembling hand held onto his cheek in attempt to make him look at you. suguru’s fingers curled around your wrist, turning your hand away from his face and to the side so he’ll have access to your palm. his lips left a ticklish trail of pecks on them until his mouth found its home: your lips.
the two of you exchanged deep, exhausted breaths, your boyfriend eventually pulling out and rolling onto his side to cradle you into his arms—hand placed on the back of your head to rest your body against his chest. the following seconds were spent cuddling as you tried to regain composure.
“you were amazing.” suguru sighs, chin resting on top of your head whilst his hand rubbed your bare back in comfort, “are you okay, sweetheart? nothing feeling off or anything of that sorts?”
you shake your head and snuggle up against your lover, content with how things are right now. the afterglow of your little session—of your first time, made you happier than ever. you couldn’t believe it’d feel this good. maybe it’s due to the one you’ve lost your virginity to.
“i’m okay.” you mumble and lift your head up to look suguru in the eyes, faces only inches away from each other. there were no words in the dictionary that could describe how you two felt. the closest word to explain it would be flawless.
“i’m glad, baby. thank you for trusting me.” suguru flashes you a small smile and strokes your head. you stay like that, bodies intertwined in a deep and comfortable hug, whispers of sweet nothings filling your ears and subtle gestures of love making you feel secure.
a couple minutes later and suguru noticed how you started to doze off. he chuckled to himself before pulling away from your hug and standing up, only to have you pout and complain about the loss of warmth.
“i’m just going to clean you up, love.” the soft-spoken man utters to you, laughing quietly at the adorable state you were in at the moment. you were so dependent on him.
“should i prepare us a warm, relaxing bubble bath as well?” he asks, squatting down near the edge of his bed and taking your hands in his, maintaining eye contact as per usual.
“that’d be nice.” you nod and feel your eyelids close slowly, “can’t promise i won’t fall asleep, though.”
suguru lets out a soft exhale through his nose, corner of his lips curling upwards at your little comment. he couldn’t believe he ended up dating such an unbelievably wonderful girl. it’s a blessing in his life of curses.
“i’ll make sure to at least clean you up if you do fall asleep, don’t worry. you’re safe with me.”
you were sure he was an angel sent down from heaven. it was more than clear to you—even if it may not be to many others out there.
“thank you, suguru.” you murmur as your body relaxes into the soft mattress, “i love you.”
“i love you too. more than you could imagine.”
4K notes
·
View notes
for richer, for poorer
pairing: bang chan x female reader
summary: gift giving has always been something you've agonised over. for chan, just having you in his life is enough.
word count: 3.4k
warnings: insecurities (especially related to finances), feeling anxious, hurt/comfort
a/n: i know it’s still a long time until october, but i didn't write it in time to fit as like a holiday related fic. formatted this on my phone bc i'm lazy so please let me know if anything looks weird!
bonus: minho's reaction to his gift (included as a reblog of this post)
till death do us part collection | read it on ao3 | masterlist
Gift giving has always been something that you agonised over. You wanted so desperately to get something meaningful and special that nothing you ended up getting seemed special enough.
So when Felix had proposed throwing both Chan and Minho a party for their birthdays, you were more than happy to help plan. You could see that Chan had hesitated when Felix had told them about it, but he had ultimately agreed when he saw the way Minho had seemed to perk up at the idea.
It wouldn’t be anything too big, Felix promised, just inviting some close friends to have dinner and hang out. It slowly balloons into more than a simple dinner, but the opportunities for the members to have their friends gather are so rare that you swallow your concerns.
The night of, you can’t help feeling a bit nervous. You recognise almost everyone, but that's the part that scares you - you've only seen most of these people through your phone screen before. You know Chan and Minho have a lot of idol friends, but you didn't realise there would be so many at the party. You had discussed the guest list with Felix briefly, but your concern had been about the number of guests and not who they actually were. Now you’re starting to regret it, you aren’t mentally prepared to be face to face with so many celebrities.
The time passes surprisingly quickly with people trickling in as the night goes on. Dinner is casual, you’ve helped to cook a number of dishes and takeout was ordered to fill the rest of the counter. There isn’t enough proper seating so everyone is spread throughout the kitchen and living room.
You spend most of the time just wandering through and making sure that there’s no shortage of drinks, appetizers, and that the empty dishes or cups are cleared away. Of course, you greet everybody as they arrive and thank them for coming, but it’s hard not to be intimidated by all the famous faces.
Eventually Changbin drags the birthday boys to the living room, standing them in front of the TV to open gifts. Everyone else either crams themselves onto the couches, sits on the floor, or loiters closer to the doors.
Chan insists that he open presents at the same time as Minho instead of one at a time like Jisung suggests. Someone pushes a couple of matching boxes into their hands and steps away.
It's almost comical how different they open them. Chan takes his time, carefully pulling apart the ribbon that's wrapped around the box, sliding the lid off and putting it to the side, then slowly peeling aside the tissue paper. Minho on the other hand, manages to pull the ribbon off the box without untying it and flips the box to shake off the lid and reveal the contents.
They're complementary hoodies in the casual and oversized fit that the boys usually go for. You recognize the brand, have seen the members wear it on more than one occasion, and know that they most likely cost the same as your monthly salary.
The next gifts seem fairly innocuous, a beanie for Chan and a baseball cap for Minho, but you know their pieces often go for over a million won, more than you’ve ever spent on a single clothing item.
It continues on like this, the boys receiving items like music equipment, alcohol, and sunglasses. It makes you swallow hard when you think of your own, mostly handmade gift.
Maybe the worst part is that nobody else at the party even blinks an eye at it. You can’t blame them, it’s the nature of their occupation that has gotten them desensitised to being surrounded by luxury and it’s not like they can’t afford to indulge in getting more expensive things.
When you look down, wanting to stop staring at the pile of opened gifts, you see that you've partially crushed the packaging of your own gift. It already looked shabby enough, it was obvious you had wrapped it yourself and the paper you used was from the supermarket, but now it was even worse.
When you try to smooth out the crinkles, your shaky fingers somehow make it ruin it more. You bite your lip, hard, then stop, self conscious about your appearance around all these idols.
It suddenly feels cramped and too warm, sweat starting to gather on your forehead and back. The room starts to spin slightly and you become overly aware of your heart beating in your chest.
A burst of laughter from the crowd spooks you, pulling you out of your head. You use the opportunity to get to your feet and excuse yourself. You slip away as quietly as you can and breathe a sigh of relief when you make it into Chan's room without anyone following you.
You don’t bother to turn on the lights, not wanting anyone to check up on you, and sit on the ground with your back against Chan’s bed. With the door closed, the noise from the party is muffled and it’s significantly colder in this area of the dorm. You press your hands to your face and take a few deep breaths to try and calm your heart rate.
You don’t know what’s wrong with you because you know you shouldn’t feel like his. You had been looking forward to watching Chan and Minho open their gifts, you had spent a lot of time preparing them and you had felt confident that they would enjoy them.
Well, until you saw everything else that they received.
Now your ideas just seemed silly. You feel humiliated at the thought of everybody seeing the obviously cheap gifts and even worse when you consider how ashamed Chan might be for others to know that you were his partner.
Although you were working full-time at the moment, you had only graduated from university last year and your student debt was an ever present weight on your shoulders that you tried your best to hide. Everything you had went to paying it back and checking in bi-weekly to see the number get smaller and smaller was the only thing that made you feel better.
Chan knew that you often worried about money. You had been mortified the first time that he had walked in on you trying to organise your finances for the next few months. He had glanced over your shoulder before you had even realised he was in the room and all the red cells showing where you were in a deficit were hard to miss.
It had been early on in your relationship and the dates that the two of you had been on as well as a couple unforeseen events had meant that you had been spending way more than what you had anticipated. Of course, Chan had treated you on a number of occasions, but you refused sometimes because you felt guilty every time he offered to pay, especially since it had been only a couple years after his debut.
He had been more than understanding, but you had been so embarrassed and caught off guard that you couldn't stop the tears from streaking down your face. Since then, Chan and the members had never done anything to make you feel like they pitied you or thought any less of you for your financial situation, in fact they did the opposite.
When you had first started visiting the dorms, opening the food delivery apps was like a reflex for all of the boys once it was dinnertime. You were always hesitant to choose anything and felt even worse by the nonchalant way that they covered the costs each time. Even though you knew they didn’t think anything of it, you couldn’t help but feel like you were taking advantage of their hospitality.
Somehow they caught on to your reluctance to buy food and now it's tradition that you cook for them when you come over, enough so that they keep the kitchen stocked with more than ramen, chicken breasts, and protein powder.
In particular, Minho absolutely loved your cooking and had needled you many times on sharing how you made it. You had always denied him though, saying that you didn't use exact measurements and came up with things on the fly. That’s why for his gift, you had taken the time to create a recipe book, complete with pictures for each step and modifications that he could make based on the ingredients he had.
You had spent a few months thinking about what to give Chan. He was harder to shop for since you knew he wasn't overly fond of celebrating his birthday and didn’t want you to spend money on him, but was always touched when you got him something. Usually, you tried to do something he was more likely to accept.
Last year, you had organised with the company to give Chan a day off and had taken him out to a movie. It was a pretty standard date, but the two of you rarely had the opportunity to go out together and you knew Chan had resigned himself to watching the movie when it was released online instead of going to the theatres like he had hoped to. Having to spend a few days trying to sort out all the logistics of secretly rearranging Chan’s schedule had been more than worth it with the way that his face had lit up when you had told him about what you had planned.
You don't know how long you sit alone, but every time that you tell yourself to get up and rejoin the party, it feels impossible to move.
“Hey,” Chan's voice is cautious, but you startle anyway, scrambling to stand up. Stuck in your thoughts, you hadn’t even noticed him entering the room. “Is everything okay?”
“Yeah, I'm fine, I'm fine. Just needed some air, it was getting kind of stuffy in there,” you explain. “I didn't think you'd notice.”
“Of course I noticed. You were there one second and gone the next, I didn't know what happened.”
“It’s nothing.” You avoid Chan’s gaze, not wanting to see the concern that shines in his eyes.
Chan steps closer, then reaches out and tangles your fingers together, using your connection to pull the two of you to sit on the bed.
“Y/n, baby,” he says softly. “Talk to me. Tell me what’s going on in here.” He leans forward until the side of his head bumps into yours.
“It’s-”
“Don’t say it’s not important,” he warns. “It’s important to you and that makes it important to me, okay?”
“Uhm,” you pause for a moment, unsure of how you want to word your thoughts. You trust Chan, but it still feels scary being vulnerable. “I guess, I was just feeling… Insecure.”
“Insecure?” Chan tilts his head slightly. “About what?”
“Everyone-” you laugh slightly, embarrassed. “Everyone gave you guys such nice gifts, I feel like mine don’t even compare.”
“Y/n, you know I don’t care about that kind of thing. If I had the choice, nobody would be giving me gifts at all. Just having you in my life is enough.” Chan’s voice is painfully sincere.
“I know you don't mind. It just- It feels bad that I can't give you something nice like they can. It's dumb, I know, but I can't help it.”
“I can open it here, away from everyone else if you want,” Chan offers. “Or you don't even have to give it to me today, you can save it until you feel better. Or don't give it to me at all, it's all okay.”
“No no, I want you to have it,” you say immediately. Before you can think better of it, you reach down and retrieve the gift from where you left it on the floor.
“Whatever makes you feel comfortable,” Chan reassures you.
“This is fine,” you decide. “Just the two of us."
“Okay.”
“It’s not designer,” you say suddenly, fiddling with the ribbon that keeps the two packages together. Both of you ignore the fact that you’re just stalling at this point.
“I don’t need any more clothes, I barely wear everything I own now,” Chan jokes.
“Really, you might not like it,” you warn.
“Baby, when have I ever disliked anything that you’ve gotten for me?” Chan drops the teasing tone. You think for a moment.
“When you asked me to order noodles for you and I accidentally got you the spicy version and it made you cry?”
“Did I say that I didn’t like them?”
“No, you ate it all even though I warned you that it would make your stomach hurt for the next couple of days,” you say, smiling faintly at the memory.
You had gotten yourself the same dish and had found it to be bearable, while Chan’s face had turned bright red after the first bite. You had offered a few times to get him a non-spicy version so that he could enjoy himself, but he had been determined to finish, soaking his shirt and beanie with how much he had sweated. He hadn’t even been able to continue carrying a conversation with you, too busy trying to suck in air to cool his mouth.
It had been even funnier for you the next day, receiving multiple texts from Chan about his stomach hurting and having to continually pause dance practice to go to the bathroom.
“The pain was worth it,” Chan insists. “I'm actually convinced that I'll like anything you give me. Now come on, let me open my gifts!”
You hand over the gift and watch as he pulls away the ribbon to separate the boxes and peels away the tape on the first package. His brow is furrowed in concentration as he tries not to rip the wrapping paper.
This gift was more neutral, a set that contained a wallet and cardholder, both in black. Although Chan hadn’t complained at all, the wallet he had been using was from years ago and the synthetic material was starting to crack and flake away at the edges.
He looks delighted, examining it briefly before pulling out his old wallet and transferring all his cards and cash into this new one. Although it’s not a name brand, you had purchased it at a small shop specialising in handcrafted genuine leather goods at a surprisingly affordable price. It was good quality and suited the simplicity that Chan preferred.
“It's just what I needed,” he says, sounding pleased. “You pay so much attention.”
“I'm glad you like it,” you say, feeling relieved even though you had been pretty sure that he would be happy with it.
The unease comes back when he turns his attention to the second gift. Once again, he puts in effort to gently unwrap it, revealing an old chocolate box that you had repurposed from one of your dates.
You’ve always been on the more sentimental side and had saved it, wanting to remember the evening that Chan had taken you out and the two of you had spent 20 minutes in the shop, meticulously picking out the flavours that you wanted to try. The box is made of a surprisingly durable material and is the perfect size for this gift. You’ve painted over it too, concealing the original design.
Chan turns it around in his hands curiously, before sliding the lid up. You turn away to stare at your hands, overwhelmed by nervousness.
You already know what’s inside. It’s a deck of cards that you’ve transformed, with 52 things I love about you inscribed on one of the jokers. On the flip side, you’ve painted a picture of you and Chan smiling widely with your cheeks pressed together. It’s his favourite, one he always tells you would be permanently on his lock screen if he wasn’t an idol.
The rest of the cards are decorated similarly, a small drawing or painting on one side with the things, people, and places that Chan loves on one side, and something that you love about Chan on the other. The last joker is the only one that's different, you've treated it as a card and have a small message written on.
You had been so excited when you had thought of the idea, even though it was almost embarrassingly cheesy. Chan was often hard on himself, overly critical, and sometimes insecure. You tried your best to reassure him that he was doing well, both in his career and personal life, but you weren’t always able to be with him to do it in person.
As time goes by, your dread just continues to build, but you don't dare look up, not wanting to see Chan's reaction. Based on the silence, he’s clearly not thrilled with the silly idea that you had gone with. You can almost imagine his expression, jaw clenched and lips pressed together as he tries to think of what he can say to let you down easy.
Finally, you can't take it any longer and you lean forward, reaching out to grab at the cards that he's still reading though.
“I'm sorry, it's stupid, I know,” you say quickly. “You can tell me that you hate it, it's okay. I don't know what I was thinking, but just- give me more time, I'll get you something else, something nicer-”
It catches Chan off guard, and instead of successfully taking the cards away, you grapple with them for a second before they slip between both of your hands, scattering across the floor like confetti.
You instantly drop to your knees, scrabbling to scoop them up like the most awful game of 52 pick up that you've ever played in your life. To your horror, the task gets even more difficult as tears start to well up in your eyes.
“Y/n-” Chan says gently, reaching out and taking your wrists in his hands to stop your frantic movements. “Come here.”
You resist for a moment, but he pulls you into his arms, cradling your head so your face is resting on his shoulder. The tears leaking from your eyes soak into the fabric and you sniffle softly.
“I'm sorry,” you say, voice partially muffled. “I'm a mess.”
In response, Chan pulls back slightly and when you don't turn towards him, he taps a finger against your cheek until you face him. Your eyes widen when you notice that he also has tear tracks streaking down his face.
“What-”
“It's okay, I'm a mess too. I should have said it sooner,” he says, voice low and gravelly. Still in his embrace, you can feel the rumble of it in his chest. “I love it. I was overwhelmed, I wanted to say something but you left me speechless.”
“Don't just say it-”
“I've never had a gift so thoughtful, Y/n,” Chan says earnestly. “How could you think this was stupid? You must have spent hours and hours on it and I really appreciate it. It’s just- is this really what you think of me?”
“What do you mean?” you ask.
“Do you really love that-” Chan picks up the closest card to him and flips it so that he can read the message. “That I snore? Y/n, why do you even have this in the list?”
“Yes, snoring was one thing and it's because with everything, there’s always a reason to love it. It's not that I love that you snore, but with your insomnia, hearing you snore is a relief because it means you're sleeping, that you're resting. Even with your insomnia, I know you're busy thinking of every little way you can make things just right for you and the members. It's because you care so much, how could I not love these parts of you?”
“You- you really love all these little things?”
“Of course I do,” you say in a hushed voice. “Of course. When I was making these, I couldn't fit it all. I love everything about you, Chan.”
This time, it's Chan that breaks eye contact, shaking his head as if in disbelief.
“I don't know what I did to deserve you.”
“It's not about deserving. You didn't have to do anything, that's the whole point. I love you just as you are.”
“You know that's how I feel about you, right?”
“Chan-”
“Even if you never got me anything ever again, I wouldn't love you any less. You being in my life, by my side, that's the greatest gift you could ever give.”
till death do us part collection | read it on ao3 | masterlist
2K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Slashers with a significant other who is a cam girl and wants them to be in one of their videos? 💃
2 posts in 2 days who do I think I am? See ya'll in a year! /j
CW: NSFW
You do Cam Work and Ask the Slashers to be in your Videos:
Thomas Hewitt
Thomas is pretty conservative when it come to sex and such, but he's come around to your cam work, especially since you let him help with the details.
You like when he picks what you were or what scene you might do. You made Thomas feel like a part of it and that made him comfortable with it.
Still, he's very surprised when you ask if he wants to do a video with you. He refuses immediately and you respect that.
You ask again a while later but with more details. Like nobody would know who he was, you would keep his face out of the shot, and the two of you will do whatever he is comfortable with.
Your first video with him is of you riding him. His head isn't in the shot but the rest of his frame is. The size difference goes hard and your audience agrees.
Thomas is a flustered mess when you sit to read with comments with him. Everyone is talking about the new man in your video, gushing about how big he is and how attentive he is. Even with his size it seems your audience could sense his gentle soul, commenting on the chemistry you both have and how they would love to see him again!
Thanks to all the lovely comments, Thomas agrees to do another video even if he doesn't see himself putting his face on camera any time soon.
Michael Myers
Michael honestly does not care that you do cam work.
When you first ask him to be in a video, he pretty much ignores it.
But when you ask again some time later he doesn't see why not.
As long as his face isn't in the video or anything, you can film it, he doesn't really care.
The videos you make with him afterwards are pretty similar to your first video with him.
Usually you bent over while Michael fucks you to tears.
Michael is barely in the shot most of the time. Sometimes it just a close up on you, other times it includes Michael but only ever getting at high as his chest.
Everyone is obsessed with your mystery man. Where did he come from? What was that scar from? Can we see more of him please!!!
Jason Voorhees
We all know that Jason's comfort levels with sex is extremely low and it takes a while for him to become comfortable with physical intimacy. So cam work is certainly going to take some time for him to come around to.
And once he's become more comfortable with that, it's going to take a whole lot longer before he feels comfortable being in a video.
When he does decide to give it a go, he is a real hit!
He refuses to show his face on camera and you do whatever it takes to make sure he is as comfortable as possible.
Before Jason says you can use his name in videos and descriptions, your audience referred to him as 'the gentle giant', which is completely accurate!
No matter your usual content, Jason is nothing but gentle with you when he's in a video.
Brahms Heelshire
Watches your videos over and over again, he loves them. He'll watch you record them and watch them later once you've posted them. He can't get enough.
He's already got his pants off when you ask if he wants to be in one of your videos. You end up fucking even though you're not filming it.
He actually doesn't have much of a problem with having his face on camera. He's still a little insecure about his facial burns but you have alleviated most of that by this point.
And after the first video and he reads all those positive comments. Some are as horny for him as they are for you.
Fully embraces his new pornstar identity. He's insufferable.
He'll be in any video you want and your audience love watching you take care of your needy brat.
Bo Sinclair
Bo is in fully support of your work, it brings some money in and he gets to watch your videos. Even if his possessiveness still often gets the better of him. Whenever he reads comments of people praising you, Bo has an insatiable need to bend you over something just to prove a point.
Gets all cocky and arrogant when you ask if he wants to be in a video.
Needless to say, he agrees to do it.
And he takes to it pretty easily. He knows how to get all of his favourite reactions from you, how to get you pleading and begging for him, and he wants everyone watching to know.
Bo is arrogant and always smirking when the camera is on but it performs well.
He likes to how the camera and film himself entering you. He really does have a terrible ego.
Vincent Sinclair
It gets Vincent flustered, he could admit that, but he appreciates the artistic side of it all. It takes more effort and consideration than one might think!
He likes helping you get ready for a video and taking care of you afterwards.
He's hesitant when you first ask if he wants to be in a video. A part of him wants to do it with you but he's not confident enough in himself.
But he loves making you feel good and at this point he knows he's good at it, so he gives it a try. You can film them without posting them after all, like practise runs.
He may never show his face but he doesn't mind having his body on camera. Sometimes he even just hides his face with his hair instead of keeping his head out of the shot completely.
On Vincent's more self-conscious days, he'll film close ups of him fingering you instead.
He's very good with his hands and your audience agrees. They are very jealous of you.
Lester Sinclair
Lester is pretty neutral on your work, but of course he absolutely loves your videos.
He's mostly just surprised and flustered when you first ask if he wants to be in one of your videos. He thinks you're perfect so he understands why people would want to watch you, but he doesn't really see why people would want to watch him.
But he still agrees to it because he's your biggest supporter!!!
Your audience love the chemistry and intimacy between you both, leaving comments about how real your videos feel.
The videos that perform best are usually the ones where the two of you forgot you were even filming, just giggling together and enjoying each other. Lester gets all nervous and shy when the camera turns on, which is adorable, but forgetting that the camera is there really does help him perform better, the sweetheart.
Your audience love your more thought out and planned videos but appreciate the occasional more relaxed video with your sweet boyfriend.
Bubba Sawyer
Super flustered by your work but he's supportive.
Is super surprised and nervous when you ask if he wants to be in a video.
He agrees to give it a try once you explain that you can always delete it and nobody has to see it if he changes his mind or doesn't like it.
Bubba is just a big sweetie really, and you know just how to turn him into a squirming, blubbering mess.
And your audience love to watch you do it!
In later video's you do, you use the viewers' comments to fluster him even further. Using all the kindest and sweetest comments that say how lovely he is .
Come on, Bubs, they love you, they're being so nice. Why don't you say thank you?
Billy Lenz
Billy loves watching your videos and when you ask if he wants to be in a video with you, he is so excited!
He's completely down to make some home videos but he's a little unsure about putting it online for other people to see.
So you make it so his face isn't visible and let him watch the final edit before uploading it. He thinks it's so hot, he can't say no.
Honestly, you could do really well with just audios alone though. People will go wild for it. Billy unable to keep his mouth shut, all those desperate moans and whines and noises, the sticky wet slapping of skin. Honestly, a video element is just a bonus at this point.
And who gets off to the video the most? Billy obviously!
Asa Emory (The Collector)
Asa monitors your accounts anyway, even if you don't know it. He wants to know what you're posting and how people are responding. Don't want any bullies or trolls, right?
He's probably tried to manipulate you into suggesting it anyway.
He doesn't have much of a problem with your cam work, he's just a possessive bastard and would love to claim you in front of your entire audience.
The mask stays on!
Okay, he designs a new mask to avoid any chance of self criminalisation but whatever.
You two can make it big in BDSM communities.
Ties you up, blindfolds you, gags you. Whatever he feels like, but often seems to focus the camera on your reactions rather than on what he is doing to you. Studying his favourite little specimen.
Your audience already adored you of course, but they also love this new Dom you brought it.
There is no doubt as to who you belong to now.
Jesse Cromeans (Chromeskull)
Obviously Jesse has no problem with being on camera and he already has a pretty big ego, so he'll probably even wear the Chromeskull mask. It's his signature whether it's for his snuff films or your cam work.
Like Asa, you do absolute numbers in the BDSM community. Everyone is very pleased with his fully suited up, masked Dom that you brought in.
He already has his Chromeskull persona all fleshed out so he just brings that energy to your videos.
He's a sadistic Dom and you might have to upload an Aftercare video at some point just to reassure your more loyal audience that you're alright and always well taken care of afterwards.
Otis Driftwood
Is obviously a fan of your videos and isn't going to stop you from making them. You aren't actually fucking anyone else, so he's cool with it. And if he feels particularly jealous or possessive at some point, he knows he's the only one who can actually pin you down and have his way with you.
Oh yeah, he's down to make a few videos with you. He's probably got some old tapes of his own somewhere, long forgotten. He's not shy.
Says the filthiest shit, it kinda becomes his think on your platform.
Otis can be absolutely disgusting but, fortunately, there is an audience for that and they flood to your videos.
Calls you all sorts of names, asks you if you get off on knowing everyone is going to watch him fuck you. That everyone is going to see all the things you let him do to you.
Baby Firefly
Baby loves that you do cam work, she loves performing. She happily does your hair and makeup, she helps you pick out costumes and which toys you'll use in that video.
Hell, she's even filmed a video or two for you!
She's your number one supporter so of course she jumps on camera as soon as you ask if she wants to be in a video.
The two of you are all dolled up and she's magnetic, the audience love her as much as they love you.
The two of you are absolute menaces if you decide to do a livestream, pulling in huge donations because Baby is going to pout and taunt. Why should the two of you put on a show if they're not showing their appreciation properly?
Baby is the type to respond to very low donations with "it's alright, you can just say you're poor". She never promised to play nice and she just thinks you're worth more than that!!!
You end up apologising for her.
People are into it though.
Yautja (Predator)
Your mate doesn't quite get it but he's cool with it.
Is hard as soon as you ask if he wants to be in a video. Yautja's aren't very conservative or prudish when it comes to sex and nudity, so you weren't too surprised.
He loves the thought of taking you, of claiming you, and everyone knowing that you're his mate. That he's a worthy mate for you.
Even when he's a regular feature in your videos, he doesn't completely understand it, he just knows he's into it.
Everyone loves to watch you try to take him fully, the struggle, the determination, the satisfaction when you manage it.
You have cornered the Monster Fucker market. They don't know if it's real, if it's a very elaborate costume, or very realistic animation, either way they are eating it up.
All the other performers who use alien dildos and such are super jealous, obviously.
2K notes
·
View notes
𝐓𝐡𝐞 𝐓𝐚𝐮𝐫𝐮𝐬-𝐒𝐜𝐨𝐫𝐩𝐢𝐨 𝐚𝐱𝐢𝐬 𝐢𝐧 𝐡𝐨𝐮𝐬𝐞𝐬
PLEASE READ:
long post - thank you for 2k! i apologize for the wait but this took me a longggg time to prepare.
it’s also important to note that planets in taurus/scorpio will effect how you resonate with the interpretations below
reminder that readings are open! i’m now selling persona chart readings of planets/angles as well
take with a grain of salt
1st (scorpio) - 7th (taurus)❤️: relationships are a source of comfort and wisdom. scorpio risings’ experience of reality has to do with trust, hard truths, and taking back your power but their relations with others often bring a sense of peace and value into their lives. people may perceive you to be useful and smart in these similar qualities as well. your partnerships help to balance out the chaos and even insecurity you face at times with your identity and precense in the world
2nd (scorpio) - 8th (taurus) ❤️🔥: you are powerful in your resources/skills and in the way you support yourself overall. in this lifetime, how you find worth and appreciation for yourself and what you have (skills, physical resources, etc…). you may feel suppressed or face much controversy for what you value or for how you choose to support yourself monetary-wise or as a person. your biggest comeback story in life may have to do with self-esteem and with how you accumulate worth and value (physical or moral/mental) into your life and goals.
although there may be much turbulence and important realizations/truths that are found in how you support yourself and your goals, the transformations and scary things you face in life ironically enough can bring you lots of support if you choose to make good use out of it (which taurus is naturally good at). of course, this is the house of fears and traumas so a big part of your life story may include building your own sense of independence by learning from times of distress.
3rd (scorpio) - 9th (taurus) 💋: you could be especially sensitive to input from others and be able to pick up undertones and double meanings from others easily. communication, creativity (especially having to do with hands or written words), is your superpower. you grab others’ attention easily with your stories and artistic output when you learn to harness your fears/limitations effectively. this also makes you very intelligent of your community + gossip because scorpio rules over extremes as well
while in your everyday communication and daily life you may uncover and discuss skeleton’s in other people’s closet and may be doing a lot of activities that use a lot of your energy (scorpio is ruled by mars, planet of action), this makes you very comfortable (taurus) in being able to adapt to different environments and perspectives (9th house). having taurus in this house can make someone very wise because they find value and meaning in variety.
4th (scorpio) - 10th (taurus) 💄: people with scorpio in this house have usually had some sort of significant event or trauma regarding their family or childhood or may have regrets as to their actions in the past. these people could be born out of either extreme poverty or wealth too. these people’s sense of safety/privacy can be very important to them or they could feel like this aspect of their life is being compromised often (mars = conflict) but you could also find safety/comfort in curiousity or things that are “off-limits”.
if the private/emotional life of the native is exacerbated and transformative for them the career and reputation for the native is where they feel appreciated and most creative. having these signs in this house-axis can be indicative of a strong comeback story (extreme poverty to extreme wealth or even the other way around). the career-field can be very fulfilling (emotionally or monetary wise) and where you are grateful or feel lucky for the events your work presents.
5th (scorpio) - 11th (taurus) 🌹: feelings of creativity, romance, and happiness are taken to extreme lows and highs throughout life. if you’re a cancer rising, i believe this is where the “moody” reputation for us comes from. like leo rising, there could have been significant changes or revelations during childhood that changed your way of deriving happiness and familial support. these people may crave for luxury and overindulgence and can do so by turning their pain into power. scorpio in this house can make someone very grateful as well.
if our sense of happiness and luck undergoes significant change and gives us our “comebacks” throughout life, the 11th house is where we have already found peace and prosperity with our place in society. we encounter valuable experiences when polishing our individualism (5th) within our community (11th). we can find personal contentment and growth in accepting our individual, unique role amongst the people around us. you may like to surround yourself with confident people as well.
6th (scorpio) - 12th (taurus) 👠: these people can feel very unlucky or trapped throughout life, with the 6h ruling bad luck + burdens and scorpio relating to extremes. scorpio is a smart zodiac i’ve noticed as well, so these people usually have a certain way (especially that requires much energy) of doing their work and job that could defy others’ expectations. extreme focus on a certain obstacle or insecurities is also possible and can take awhile to finally figure out what makes you feel secure and satisfied with how you manage your burdens.
if your everyday burdens and responsibilities test your strength to the max in this lifetime, your imagination, creativity and solitude is where you find peace. it could also be that these people do unusual things to satisfy their need for pleasure and wholeness, because the 12th house is where we are easily misled. these people are internally comfortable with their thoughts and ideas, regardless of how odd they may be because it takes them to a place of stability from their scorpio 6h.
7th (scorpio) - 1st (taurus) 🍒: these natives’ partnerships/commitments make the native have to look more deeply into their underlying intentions or feelings with said partnerships/commitment. this can bring a lot of disturbing but also very eye-opening and insightful experiences that affects the native’s identity and ambitions going forth. scorpio can also be a curious sign so there can be a little bit of investigative or persistent approach to your partnerships and this is where your power can derive from.
it may seem like your partnerships “destroy” parts of your identity, because you approach the world from a sense of wholeness and peace. at least, these are circumstances that you are ambitious to achieve in your life. pleasure and steadiness are big life themes and at first it may seem like life is rather dull or boring, but similar to scorpio in its opposite function, taurus asks us to dig a little deeper into the simpler things in life and to find enjoyment.
8th (scorpio) - 2nd (taurus) 🍫: when dealing with other people’s problems (financially, intimate connection, debts, etc…) it brings about experiences that require you to fix what’s wrong or holding you back in life in rather uncomfortable ways. this can indicate someone who is afraid to acknowledge psychological blockages or who lacks the necessary bravery/instincts to attack underlying problems. you could earn valuable assets (tangible or not) from others when you engage with activities that are “gross” but healing/heroic.
this native survives on feeling complete. having a sense of wholeness is very important to these people and makes these people very resourceful because they are able to make the seemingly mundane valuable and able to work in their favor. these people are good at feeling in control of their life, future, and choices because they are committed and secure in their abilities. these people place much importance on authenticity, diversity, and self-sufficiency.
9th (scorpio) - 3rd (taurus) ❤️: when achieving mastery/global knowledge, and self-discovery it may have to do with bringing up topics that you ignored or swept under the rug especially having to do with your identity/precense (in context of the world and society). your global approach and experiences have to do with dealing uncomfortable topics in order to achieve better awareness and understanding of all aspects of the world. how you navigate foreign environments and your sense of flexibility is your strength.
if foreign experiences provide you with strength through perseverance, your intuition and familiar environments provide you with strength through growth (tangible or not). although it may seem like the everyday social rituals and ideas (including intuition), can appear mundane, this setup of houses gives an opportunity to grow a garden that provides roots, beauty, and good taste in the way you perceive and express yourself local environments.
10th (scorpio) - 4th (taurus) 🪭: these people have to have a ton of intiative when working in their career and towards their big goals in life. it may feel as though these people have to start from a bad hand of cards (compared to everybody else) in order to make it to the top or that their working conditions and/or responsibilities throughout life may feel difficult to complete or deals with high stakes/status. but even though there are difficult tasks they have to be done and you have drive/resourcefulness to do it!!
if the workplace is where you see the thorns in your garden (where you have to get rid of them) your home life and condition is where you see the roses. taurus is good at being able to attract good circumstances for themselves because taurus is very representative of wholeness and the feeling of completion. there’s probably more opportunities for you to setup and manage your domestic life the way you like. wisdom may be found through your domestic life too.
11th (scorpio) - 5th (taurus) 🧨: your surrounding communities/people who support you seem to try to pick you apart. you may feel as if the people who you’re around with don’t actually support you or that there’s something incomplete or “wrong” with the circumstances and people that made you successful, imposter syndrome possibly? your supporters/friends could show you things you couldn’t see before, likely for the better although they may reveal this in dramatic or difficult circumstances.
if you feel incomplete about the people/circumstances that support your public achievements, your creativity and lust for life is where you find contentment. these people feel most stable and appreciated for their talents and way of enjoying themselves. for these people, they find stability, growth, and satisfaction when they engage with activities that bring them happiness. they find beauty and appreciation from others for their self-expression/creatvity.
12th (scorpio) - 6th (taurus) ♠️: your drive to feel complete is what can you mislead you in life. this may be because you feel as if there’s always something missing or not being to shown to you but you are persistent in finding what that something is. this same energy can make the native very wise because they have to overcome their demons over and over again throughout life. but at the same time, you could also feel like your sense of resourcefulness and strength fails to manifest in reality.
if there’s conflict/determination in trying to protect yourself from things that induce bad energy, then there’s likely to be tranquility and acceptance in doing activities that can put your life back on track. the 6h is known as the house of bad fortune in astrology so these people are good at being able to find the most reliable way out of a difficult situation. and while these natives could be good at finding solutions, slacking off and overindulgence can lead to oversight with tasks.
once again thank you for 2k!
hope you enjoyed🥰
2K notes
·
View notes
Golden Walkway
Pairing: Jackson Joel Miller x Female Reader (Reader is a teacher in Jackson, has long hair.)
Rating: Explicit. 18+ (Minors DNI)
Summary: It’s your birthday, Joel takes you out to the Tipsy Bison, kisses (and does more to) you in the rain, and takes you home to give you a gift (it's sex, the gift is sex). Also, the thought of Joel spitting whiskey in someone's mouth happened and I had to write it out. 🤷🏼♀️
Warnings: smut, drinking, consent first, degradation second, followed by so much praise, hair pulling, spitting, Joel calls you a slut, fingering against a brick wall, F receiving oral, I watched that doggy style Narcos gif (for research) a lot, unprotected p in v, apocalypse birth control (pulling out), Joel’s canon age, Reader’s in her 30’s.
Words: 4,300
A/N: Hi! Welcome to my first published fic. I'm currently working on a grander scale fic with these two, I hope to have the first chapter out within the next couple of weeks. I just really wanted to get this out there! Thanks for reading and a big thank you to @ohheypedrito for all of her help and also to our phones for not overheating when I send 40 texts at once with ideas for fics. Hope you enjoy, can't even blame the feralness of this on the full moon.
Edit: I posted the Masterlist for Elks, my work these two are included in.
***
“Was turning 21 as fun as they’d show in movies back then?” You’re cuddled in next to Joel on his couch sketching in your notebook while Joel reads a book about Native Americans that you found him. You always do this, a random question or thought to break the comfortable silence.
“Not for me, bought a 12 pack of Bud Light and split it on my porch with Tommy. Sarah was only a toddler then and I had work in the morning. Didn’t have the money or the time to go to a bar. ‘Course I don’t think a lotta people did anything the way they’d show in the movies.”
“I always wanted to have my 21st birthday at a bar, ya’ know? Wait until the clock strikes midnight and order a weird named shot.”
“Well, I reckon we could do that at the Bison tomorrow night. Might not be your 21st but I’ll get you whatever you want to drink, and the best part is you can drink before midnight.” Joel pulls you in closer and kisses your forehead, “What do you say, let me take you out for your birthday sweetheart.”
“Yes, please,” you sigh into his shoulder, “sounds amazing.”
“Wear that little blue dress I know you have hanging in your closet.”
The drinks flowing through you making you downright giddy, alcohol making you bolder, your body and your inhibitions becoming looser, your hands becoming addicted to touching Joel, first his leg, then his thigh, now his lower stomach, right at his waistband. You haven’t been this tipsy in a long time, your face feeling flushed and red more from your desire than any drink you’ve had tonight.
“You better knock that off before I take you outside in the rain and fuck you against the building, darling,” Joel huffs into your ear. His fiery warning massaging your neck causing your heart rate cooled by your inebriation to pick up.
“Sooo, keep going?” You slur back.
“If that’s what you really want,” Joel puts a forceful squeeze on your upper thigh, a layer of your dress laying between his skin and your skin. If you weren’t both sitting at the bar, and maybe in one of the more darker corners of the saloon you’d surely hike your skirt up and let him learn just how bad you want him.
It feels so good to let go with him, to giggle openly at his jokes, stare at his profile as he talks with a friend or two who stop by to say hello, or place your hand on his broad back just because you want to touch his soft blue denim shirt.
You watch as his tongue darts out and licks the leftover whiskey off his top lip, Joel’s movements becoming a little slower thanks to the amber liquid he’s been drinking all night. Some droplets glisten on his mustache, you fight every urge inside yourself to not lean over and lick them up.
“It’s what I want,” you respond as you move your hand back and forth across his waistband.
“Jesus Christ, I’m about ready to throw you over my shoulder and run home,” Joel says as he takes your hand into his and pulls it away.
“Not so fast. You told me you’d fuck me in the rain, that’s what I want for my birthday,” you whisper into his ear with a breathy giggle.
“Can’t fuck you out here in public. Small town ‘n all, but I’ll make you feel good,” Joel takes a last swig of his drink, puts the glass down and knocks his fist on the bar to let the bartender know you two are leaving. He leans forward and drawls into your ear, “Now finish your drink if you want me to show you just how happy of a birthday I can give you.”
You nod and gulp your drink down. You’re so wet, you don’t know if you’ve ever been this turned on before. Joel grabs your arm with the perfect amount of pressure, you’ve never been so happy to get outside into the pouring rain.
——
It’s absolutely storming outside, your footsteps sloshing in the puddles on the ground. The rain pelting your’s and Joel’s bodies as you walk through late night Jackson. It feels like you’re the only two people in the whole town as you make your way farther away from the bar. The bulbs of the string lights reflecting off the water gathering on the sidewalks making your path towards Joel’s house golden. You don’t rush, the two of you not scared away by the downpour, the drops cooling your burning skin. Joel turns down the street before his, pulling you behind one of the storage buildings, it’s darker back here, practically pitch black thanks to the rain clouds blocking the moon and the nearest light source being three buildings down. You’re pushed up against the brick, Joel’s hand gently cradling your head to block it from hitting the wall, he’s such a gentleman.
“Happy birthday baby, I need you to tell me you want this, ‘n you’re okay with this, I have plans for you and I need you to tell me you want it.” Joel instructs you, all you can see is his eyes and the faint lines of his facial hair, the rest of him camouflaged by the darkness surrounding the two of you.
“I want it, more than anything. Please,” your voice straining as you beg.
“Tell me you want me to have my way with you,” Joel speaks into your slack mouth as he rubs his arched nose against yours.
“I want you to have your way with me,” you moan against his wet shirt, “so bad.”
“Good girl, now, m’not gonna fuck you here, because I’m afraid I won’t be able to stop and I need to have you in my bed tonight.” Joel starts to move his hand down your body lifting the hem of your dress. “But, you are going to cum for me right here.” Joel captures your mouth with his. His hand starts to trace the outline of your panties, you mew out a cry as his fingers slip through and begin to pet you right where you ache the most. His hands are so big, his fingers so long and thick, always putting the right amount of pressure, moving the way you need him to move. Joel Miller is a capable man, everyone knows that, but nobody, except for you, knows just how capable he is.
Joel sticks a finger in you, though his finger is thick and feels so good, you need more to fill you.
“Another,” you instruct in between fevered kisses. Your pussy clenches as Joel pushes another finger in you. “Yessss,” you moan out against his lips.
“That’s my good girl, gotta get you stretched out f’me.” Joel begins to kiss his way down your chin and neck stopping at your chest, your hard nipples jutting through your wet dress. Joel takes one into his mouth, sucking the fabric and your tit deeper into his mouth. The sloppy wet sounds of Joel’s suctions making you want him more.
“Another finger,” you shudder out.
“Three? You really want it tonight, don’t you?” Joel mumbles against your chest as he sticks a third finger in. It burns, it burns in the best way. You’re ready for him, it’s what you’ve been waiting for all night. You bite down on your lip as your legs begin to shake, Joel can tell you’re right on the edge and twists his fingers inside of you as he finger fucks you harder.
Your orgasm bursts forward your whole body going stiff as you try not to wail out into the night.
“That’s iiiiiit baby,” Joel pulls his fingers out of you and softly pets your pussy from hole to clit.
He removes his hand from between your legs bringing it up between the two of you resting his finger tips against your lips, you open your mouth and begin to lick. His tongue meeting yours as you both clean his thick digits covered in you. He takes his hand away leaving just your mouths to taste each other. His kiss turns tender, your kiss turns desperate.
Joel pulls away resting his forehead against yours. “My beautiful birthday girl. Let’s get you home, my gift’s not done.”
——
Your body practically chills with the promise of what is left to come. Joel grabs your hand and you take it depending on him to lead you to his home. Every step you take you feel your wet core heavy with lust, you’re soaked from the rain and from Joel, if you could drown like this, you would go down with the sinking ship. His house comes into view, your body tingling in anticipation at the site as the both of you speed your footsteps up in perfect agreement.
He throws open the gate, you’re following so close you almost trip on his heels making your way up the walkway and steps. He fumbles for his keys and unlocks the doors, you take the opportunity to run your hands all over his back and sides, rubbing the wet cloth of his shirt as it molds to his body. The door swings open and you both shuffle into his living room gasps escaping your mouths, both out of breath from your dash home and your mutual want for each other. You step out of your wet shoes and shake your hair out.
“Take your dress off, right now.” Joel huffs out as he tosses his keys on the console table and begins to kick his boots off.
You strip yourself of your baby blue frock as fast as you can. You’ve never had a reason to wear such a revealing piece of clothing. You don’t know why you held onto it, let alone grabbing it from the communal clothing rack, never thinking anything, or anyone, would be worthy enough for you to dress up for. Joel’s worthy, so worthy.
“Feel like I’m a little underdressed here…” your words grab Joel’s attention as he moves his hands up to his chest to begin to unbutton his denim shirt. He gets one button taken care of before he rips it open. Shame, it’s your favorite shirt, you'll have to fix it for him later. You watch as a button rolls underneath a table, before you can note where it lands, your attention turns back to Joel to find him stepping out of his jeans and underwear leaving him completely naked.
What a sight, what a fucking sight. There’s only a lamp on in the room, Joel’s body being cast in amber color and shadow, one side of him on full display glowing in the light, the other more difficult to discern. He moves forward stalking you. “Now I’m the underdressed one here. Take them off for me,” he says as he moves to pick up a bottle of whiskey from his shelf.
You follow his instructions shucking your underwear down your legs and leaving them pooled at your feet.
“Good girl,” Joel says as he begins to walk towards you unscrewing the lid off the bottle. He stands in front of you and takes a drink. “Open your mouth,” he orders as he grabs your hair and tips your head back. He takes another pull from the bottle, this time he raises his mouth over your mouth and begins to dribble drips of whiskey down from his mouth into yours. A moan raises from your throat, causing Joel to tighten his hold on your hair and arch your head back even more. He spits the rest of the whiskey straight into your mouth, you happily swallow his spit and liquor down. He unwinds his hands from your hair, takes another drink and kisses you, the whiskey and his tongue spilling into your mouth. Joel pulls back and takes his last swig before resting the bottle on the table. “Get upstairs.”
You don’t think you’ve ever run so fast in your life, tripping over your feet as you rush your way up, Joel’s naked form hunting you like prey up each step.
The sight of Joel’s bed brings a new wave of goosebumps to your skin.
“Bend over on the bed darlin,” Joel turns on a lamp in the corner and pulls it closer. “Need to lick and fuck you with my tongue.”
You move over to Joel’s side of the bed and bend forward, your ass sitting high in the air and your face in the sheets, you inhale the smell of Joel on his sheets. You swing your hips in giddy anticipation of what’s about to happen.
You feel his body lean over yours, his erection laying over your lumbar. “Okay baby, once again, need you to tell me you’re good with me having my way with your body,” he tempts into your ear.
“Fuck, y—yes, fuck, of course I am good. So good.”
“That’s my girl,” Joel’s heavy body lifting off of yours as he kneels between your legs. You feel his hot breaths on you where you’re aching for him the most, you widen your stance egging him on to touch you. “Look at you,” Joel licks your thigh, “so fuckin’ wet you’ve spilled out into your thighs.”
You scream a pleasured yell as Joel’s teeth bite down into the flesh of your thigh and sucks your skin into his mouth. The pain is perfect. He loosens his bite, kissing and licking the spot, the sensation making your body quiver.
“Okay baby?”
“Y-y-yessss,” you answer.
“Whaddo you need sweetheart?”
“Lick me,” you beg out, “please.”
“‘Course. Where do you want me to lick you?” Joel questions as he nuzzles his head against your ass cheek, giving it a small bite.
“My pussy. Pleeeaaase,” you’d say you sound pathetic but you couldn’t care less, your lust overshadowing any type of pride.
“Mm, you sound so needy baby, you sound like you really need my tongue on you, huh?” His teasing drawl drives you crazy, your body won’t stop moving, absolutely radiating tensity from your want.
“Please,” you implore, sobbing out.
“Alright baby,” his hands grab your cheeks and spreads them, widening his view of you. “Prettiest thing I ever seen, love your pussy.”
This act feels so depraved, everything on display for him, legs and cheeks spread wide, your pussy exhibited for him like it’s an art piece.
You literally scream into the bed, biting down on Joel’s comforter as his tongue finally meets your core. This, thiiiiiiis is what you’ve been wanting all night. Joel moans against you, not being able to hold himself back as he tastes you, his fevered licks exploring your cunt, his large tongue mapping every inch of you. He’s absolutely conquering you, the noises of his lips and tongue smacking against your wetness soundtracking his journey.
He can feel you getting close your hips beginning to cant as your orgasm begins to crest. You knew it wouldn’t take long, between the alcohol buzz and Joel’s tongue lapping up your wetness and cum from earlier, you knew you’d be a goner.
“Mmf, cum for me,” Joel speaks against you, his mouth full of you, too busy to pull away to clearly speak. You don’t think he can get any closer to you, his tongue working your orgasm up in intensity with each swirl and dash against your clit. You feel it, it’s here. Your legs instantly collapse, thankful that the rest of your body is resting on the bed. Your eyes tightly squeeze shut and then begin to rapidly blink as your orgasm shatters through you. Joel flattens his tongue against your clit as it pulses. You’re too turned on to make a noise, Joel stepping in for you and groaning as your juices seep out of you.
“Did so good baby,” Joel says leaving one last kiss on your clit before standing up behind you. You want to flip over to look at him, you haven’t seen his face since you laid down on the bed. You have no energy, you’re just a shell of a woman, the only sensations you can feel is the pool of wetness in between your legs and your light inebriation.
Your attention gets pulled to the sound of Joel spitting in his hand, followed by a hiss coming out of his mouth. When you realize exactly what he’s doing, you summon the strength needed to turn over. You flip over, your back thudding on the mattress your legs still spread wide, feet resting on the floor. And there…. there…. THERE he is, standing in the middle of his room, one large hand wrapped around his hard cock softly stroking as he watches you with hooded eyes. You know you just came, but the sight makes your pussy clench with desire.
Joel jerks himself off as his eyes roam your exhausted form. “Been thinking ‘bout this all day. You all laid out in front of me heaving for air after cummin’ all over my tongue,” slow strokes matching his lazing words. “Just about canceled our night out when you opened your door in that little blue dress, looked like you were wearing the sky, baby.”
You bite your lip as all of your senses are so overtly overwhelmed by lust. The sight of Joel’s handsome face watching you, the hazel flecks in his eyes twinkling in the golden light of the lamp. The smell of the rain on your skin mixed with the heady scent of your arousal and Joel’s sheets. The taste of Joel’s whiskey tongue still in your mouth. The sound of Joel’s fist pumping along his hard cock. The feel of the aftershocks of your orgasm still quaking your body. It’s so fucking much, you need Joel inside you. The thought of feeling him stretch you causes a whimper.
“Yeah baby? Havin’ a hard time over there?” Joel stops stroking his hard length, his hand pauses on his shaft. “You want me to fuck you now?”
“Pleeeease,” you keen out.
“Alright sweetheart.” Joel confidently strides over to you, dick still in hand. He stops right at the edge of your feet. “Turn back around ’n get on all fours in the middle of the bed f’me.”
You follow his instructions eager to please. The sooner you get this done, the sooner you can feel Joel enter you.
“Good girl,” he praises as the mattress dips lower with his weight behind you.
Your heart is pounding so loud, your whole body thrumming, you gulp down a breath of air trying to calm your need. You feel Joel’s cock brush against your ass cheek, he’s so close to fucking you.
“Sweetheart, I’m gonna fuck you real good and hard now. Happy birthday baby.”
And just like that, Joel buries his cock inside of you, you’re absolutely stretched around him. Your clit already worked over by Joel’s tongue, now your hole deliciously stinging while it flutters around his cock. He begins thrusting, tender and slow full strokes. Entering and exiting, swirling the head of his cock right at the entrance before plunging back in because he knows you love the feeling. Joel’s groans and your cries join in song as he begins to pound faster, the sound of your bodies slapping together match the rhythm.
“Feel so fucking good, always so perfect for me. S’a good girl, always take it so good,” Joel grits out.
He grabs your hair and wraps it around his fist as he pounds into you. “No one knows how fucking slutty you get for me behind these walls. They think you’re one of those innocent little teachers.” Joel pulls your hair harder causing a scream of ecstasy from you. “You love this, don’t you?”
You do. It’s so rough, so different from how gentle he always is with you. It feels like a luxury to be treated this way by him.
“Y-y-y-yes, God I love it,” you whimper.
“That’s right. That’s what I like to hear. So pretty so smart. So much smarter than me, now I’m makin’ you stupid with my cock, right baby?”
Everybody knows Joel Miller as the strong, silent type, a man of few words, somebody who doesn’t do chit chat. But with you in his bed naked and wailing as he slams into you, Joel Miller won’t shut up.
“Doin’ so good for me. So pretty, so perfect f’me. So wet for me.”
“You made me so wet earlier, I was afraid I was going to leave a mark on the barstool.” Your words coming out as tortured weeps, so lost in your ecstasy you struggle with every word spoken.
“Fuuuuuck.” That got him good. He pounds you even harder, the bed frame shaking violently against his wall, your body and cunt acting as if it’s the only barrier between Joel knocking a hole in the plaster. “Had I fuckin’ known I would have made you stick your face on that chair and made you lick yourself up as I fuck you against it.”
That’s it, that’s the hottest thing you’ve ever heard. Joel’s deep timbered accent grunting those deviant words as he grabs you and begins to roll his hips into your cunt. Your body is strung so tight and rigid in all places besides your hips and core, pumping and rolling along with Joel’s as he fucks you. You’re close again, your panting breaths letting Joel know.
“Baby, if you gotta cum, cum,” his grip on your hips pressure into you.
“Going … going.. going to,” the only words you can say as your third orgasm radiates out of your body, your pussy is the epicenter, tingles firing through your veins, your hands fisting the blankets at your detonation. Slack jawed and fucked senseless you rally the strength to not disintegrate and fall into Joel’s bed. Your world has been shattered by Joel, but your body survives for him, your legs and arms shaking under gravity and your weight as they deal with the fallout.
“C’mere baby, lemme help you.” Of course he can tell you’re struggling. He reaches his hands around, clutching your stomach and pulling you up against him. Your back up against his chest, his hand seeking out your breast, the other wrapping around your torso and clutching you to him. He holds you as he fucks into you, his nose brushing against your ear as he puffs and grunts against your neck. “Fucking. Love. You. So. Much.” Each word matching a thrust into you. Your hands find his and grip them, you’ve never felt more loved and protected. Joel Miller has got you.
You feel the familiar shudder in Joel’s movements as he edges close to his climax. His labored breaths getting louder and more fevered against your neck. You’re absolutely wrecked, but the angle of Joel’s cock inside of you mixed with the feeling of the shudder in his movements as he edges himself brings forth another orgasm. Words are gone, just sounds, whatever your throat can muster up and out of your mouth.
“That’s it, that’s it, that’s it,” Joel repeats. His hands squeezing yours so tightly, his chest heaving against your back, his strong thighs straddling yours, his nose pressing into your ear. You feel his body tense as he pulls out. His release coating your pussy as his whole body surrounds you. Hot breaths huffing against the side of your face in between featherlight kisses. “Love you,” a whisper in your ear so delicate and sweet as he lets go of your hands. Your body falling forward without his support, your arms catching you before crashing down on the bed. Joel gets up with a groan as you lay yourself down on your stomach, taking the opportunity to stretch your legs out before rolling over on your side to watch Joel. He stands arms akimbo in the middle of the room. He’d look like a Greek statue if his shoulders weren’t rising and falling rapidly as he catches his breath. He’s gorgeous and he looks just as wrecked as you feel.
“Probably shouldn’t have gotten up as quick as I did,” he chuckles. “Damn well feel like I’m standing in the middle of a earthquake.” You love the casual banter he puts forth seconds after being deep inside you, his cum still covering your core. This is love.
You smile at him, your cheek resting on your hand as a makeshift pillow. You’re exhausted… the whole night and your four orgasms catching up with you. Eyes feeling heavy, matching your limbs you begin to drift off.
A wet sensation in between your legs jerks you awake. “Sorry baby, just want to clean you up,” a whisper just as light as Joel’s tender attention as he washes you lulls you back to sleep.
——
“Baby,” Joel’s low voice gently wakes you up along with a soft kiss to your forehead.
You groan as you stretch your sore muscles under the sheet, opening your eyes to find Joel gazing down lovingly at you. He’s backlit by the filtered morning sunlight shining in through his bedroom windows. What a way to wake up. “Happy birthday sweetheart, I’d let you sleep all day but I need to give you my present.” His face is so bright and cheerful, a boost in your confidence provided by just how happy he looks when he’s with you.
“Thought you gave me your present already last night,” you yawn.
“Sweet girl, that was a present for both of us. Now come on, get up.” You grab his offered hand and reluctantly get out of bed. Joel wrapping his arms around you in a tight hug, his hands splayed across your back as you nuzzle your face in his warm chest. “Happy birthday.”
A/N: THANK YOU for reading my first ever fic. My inbox is always open. :)
827 notes
·
View notes
between blurred lines
best friend's dad!/dad's best friend!joel miller x f!reader
(pre-outbreak)
↳ warnings: this is rated for 18+ only! minors, please do not interact. smut, unprotected pinv, fingering f! receiving, cockwarming (!?!?!?) uhh dom!joel, significant age gap, dad's best friend mixed with some best friends dad (?!!?!?!?). i think that's it, let me know if i forgot anything.
↳ a/n: I LOOK PRETTY GOOD FOR A DEAD BITCH (she's alive!). im back from my tumblr break bearing a gift! i missed you all like crazy. gonna spend finals week catching up (procrastinating) on all the reading ive missed out on for the last month. i hope you guys like this one.
AND a very special thanks to @joelsversion for beta reading this in it's very early rough, rough stages. my ride or die fr 🤞
↳ summary: joel miller has always been...there. never different, always sporting a brooding scowl etched into his handsome face. he's your best friend sarah miller's dad, arguably worse, your dad's long time buddy. things are never different. not until this summer. not until now.
↳ follow @livingemkaydenotifs if you would like to be notified about more fics like this. love ya'll big time
↳ if you would like to read more of mine: masterlist
“You shouldn’t be in here.”
“No,” you agree breathlessly. “I shouldn’t.”
He slots himself against you, his other hand grips your hip and pushes you back into him. You gasp softly.
“Let it go.” You realize he’s talking about your dress. You squeeze your eyes shut. His lips skate against your neck in a way that makes you dip your head to the side in a silent surrender.
“Let it go,” he repeats.
You grew up with Sarah Miller.
Soccer teams, high school football pep rallies, prom, homecoming, college acceptance season. Even though it turned into long distance facetime calls, and text chains nine messages long once college hit, Sarah Miller will forever and always be your best friend.
It’s good to be back in Texas. Both you and Sarah moved back into your childhood homes the second after graduation hit. It’s good to be back, good to see her, your parents, and…Joel.
You hadn’t seen him in a while. The last time you remember spending more than five minutes in his passing presence was when you and Sarah decided on that Chinese place for a post-high school graduation ceremony meal. He’s close with your dad. In an old school kind of way. In a lets raise our kids together kind of way and a the wives can go shopping together kind of way — before Sarah’s mom split, that is.
Joel Miller, always brooding, always gruff and quiet. He’s never different. Though, you can’t help but think things might be different now—
No. You almost have to remind yourself out loud. He’s not different. He never is. He’s Joel Miller and you’re — you’re just a kid. You’re as old as his kid.
Sarah, despite your hardened efforts, managed to drag you out of bed and into the shortest dress you own for a night at some club halfway across town.
“Sarah, are the shot glasses still in the top cabinet?”
You reach for the knob, barely getting onto the balls of your feet before slipping on the cold laminate tiles in the kitchen. Your open palm balls into a fist and makes the cabinets shutter. Sarah responds with something from her room equally as unintelligible as your question was to her. You can feel your dress starting to ride up a little in your efforts, but you rifle through the Miller’s cabinets like it’s your own home. In some ways it is.
“Hey, kid.”
You spin around, and quickly shuffle the hem of your dress back down. He nods his head in a lazy greeting.
“Hey.” You’re breathless for some reason. It’s not because of the shot glasses.
“Been a while,” Joel says, shuffling into the kitchen and setting a mug in the sink. He looks the same. Tousled hair and a beard just beginning to tinge gray. He’s always — always the same.
You clear your throat. “Yeah. Been a while.”
“Congratulations.”
“Thanks.”
“Good to have you back,” he mumbles, settling back against the kitchen counter. You can see his arms flex when his palms settle onto the countertop. He’s strong, so much bigger than you. You never really noticed the big broadness of him until now. You’re not used to guys like him. All the boys you ever really experienced were clean shaven, soft in a way that told you they’ve never hauled ass through a day’s work. A lifetime of work.
“Good to be back.” He clocks your outfit. You try to change the subject. “How are things?”
“Same ol’ same ol’.” He grabs a beer from the fridge. “Your dad’s gettin’ into golf. Tryna make me go out with him.”
You laugh. “Not your scene?”
“No, not quite.” He shakes his head, sipping on his beer with a smirk that almost makes your knees weak. “What’d you study again?”
You scoff playfully. “Like you remembered in the first place.”
“Play along.” He smirks.
A knot sticks to your stomach, just below your navel. His voice is sickly sweet. Syrupy and Texan. His voice is like medicine.
“Education. Just applied for jobs in the fall.”
“You teachin’?”
“That’s the plan,” you let out with a breathless kind of laugh.
“Smart girl.”
His head cocks, and tilts it to the side. Your breath catches in your throat, palms sweaty against the black fabric of your dress. “Hardly.”
He pauses, eyes you. It’s fleeting—you might think you dream it. You pick at the skin of your own thumb.
“Your dad know you’re goin’ out?”
You scoff. “I’m an adult. Don’t need my dad’s permission.”
“Don’t be a smart ass.”
You eye him, a smirk plays on his lips.
“I’m not—just…grown up, I guess.”
Something unreadable spreads across his face. “I guess.”
You hitch a tough breath.
“What’d you need?” He swigs at his beer.
“Oh.” You look back towards the cabinets, then. “Shot glasses.”
“Moved ‘em,” he nods and stalks forward, backing you against the counter. He’s got a dark swirl of something warming behind his gaze. You don’t try to scoot away. Even when he reaches up next to your head and you hear the clink of two shot glasses brush up against each other in his fingers.
“Don’t have too much fun,” he whispers while he pushes the glasses into your hands and leaves the kitchen.
__
You desperately, for your life, cannot keep up with Sarah Miller.
She drinks entirely too quickly, efficiently, and practiced for your poor alcohol tolerance to keep up with. She’s a machine, and after three shots in, you’re already wasted. It wasn’t even midnight when your vision started to pull in a sideways direction and everything seemed a little slow. You knew things were taking a turn for the worst when the blonde quaffed frat guy with a Texas A&M polo shirt started sounding a little too funny. He was glued to your hip the entire night, though you aren’t sure you even remember his name correctly. You have your bets set on Colter, but then again, after your second shot, everything started to sound a little fuzzy to your rosied ears.
And when Colter called you and Sarah an Uber at three a.m., you didn’t have the guts to ask him his name, only shooting him a half hearted thanks over your shoulder—your liquid courage having sobered up by the time the Uber rounded the corner to the Miller’s house.
Even though Sarah Miller can throw back shots like it’s her day job, she passed out onto her bed as quickly as you both left her childhood bedroom while running late for your driver to the club.
Before she promptly fell asleep, she mumbled something almost unintelligible into the pink sheets of her twin sized bed. But you could make it out enough to spring back from her words while your heart skipped a beat.
“Get a shirt from my dads room.”
So you knock, quietly, almost too quietly, and when you rap your knuckles against the wood of Joel Miller’s bedroom door a little harder, it pushes open slightly. The crack of it floods black, you can’t see inside, only the dim night sky illuminating the window sill and curtains in its wake.
When you push it open a little further, the door creaks so loud you push your eyebrows together with worry and freeze in your timely steps. But it’s empty. The bed isn’t entirely made, the covers a little rumpled and haphazard. You spot his dresser and make a quick beeline for it, itching to get out of your uncomfortable dress.
The drawer slides open with a shift of wood on wood and you snatch up the first black t-shirt you find sitting neatly on top of the pile. Subconsciously, you bring it to your nose—sunlight, and evergreens, and a little hint of musk that peaks through the laundry detergent. The worn, soft cotton of it makes you sigh deep into the dark bedroom. You close your eyes, ball your fist up around the collar and lean into the dresser with your palm fitting against the edge of wood. Just as you turn around and move to close the drawer in your exit, a voice pulls your eyes up from the darkness.
“What’re you doin’?”
You jump, almost instinctively bringing his shirt to your chest. A sinking, uneasy feeling settles right under your throat. It’s almost like you’ve been caught red handed—you most definitely were.
You don’t say anything. The light pouring in from the hallway surely illuminates you enough. Joel’s eyes trail down to your bare legs, then to his shirt you have clutched in your hands.
“That my shirt?” He points to your chest with a vague gesture of his hands. You look down at the material balled up in between your shaky fingers, then back to his eyes.
“I don’t—” You shake your head even though you know your efforts are fruitless. The least you can do is tell the truth.
“Sarah—she’s—she’s sleeping. Told me to get clothes in here.” You make a slight nod of your head towards his open dresser. He doesn’t say anything, but he takes a step towards you.
“Sorry, I can just—” You point towards the door behind him, and move to leave.
“‘S fine,” he mumbles in that deepened, soaked drawl. All honey, and velvet, wrapping you up into something warm and inviting. It tugs at something just beneath your belly.
When he gets closer, your breath punches out in a staggered rise and fall of your chest. Your fingers don’t move from clutching his shirt. When he nears, he slips a hand past you, brushing your waist, and shuts the drawer closed with a soft thunk.
Your breath catches in your throat, his eyes trail your figure.
“Fun night?”
You clear your throat, nod, slowly, still studying his darkened gaze. “Yeah.”
You clock how close he is when you put your weight on one hip and his jeans brush up against your bare thigh. His breath swirls on your eyelashes. He tugs on his shirt in your hands and lets out a hearty sigh. Shifting from one foot to the other, then again. It seems like you both stay like that for years.
Brown. His eyes are brown—maybe a little darker than they normally are. His eyes try not to roam, but that hint of something is gone before you can blink.
He backs away then, towards the door. Most likely seeing you out. He settles near the entrance and looks back at you. Your bare feet shuffle through the carpet. He nudges the door open with a rough palm on the doorknob, leaning against the frame as you approach.
You’re about to leave, but he catches your elbow, and you spin back to him in a desperate kind of way.
“You look pretty,” he whispers to your surprise. “Forgot t’mention it earlier.”
Pretty.
He thinks you’re pretty. You didn’t even think pretty was in his vocabulary.
You didn’t think he would notice.
You don’t say anything. Your eyebrows furrow with want. You study him, eye his brown stare and the way his chest rises and falls under the navy blue t-shirt he’s wearing. And you slowly—slowly push the door shut. You both watch it close. It clicks, the sound of it deafening to your ears.
He would never, ever make the first move. You’re smart enough to know that for certain, but—pretty. He thinks you’re pretty, and after all this time, it’s still always Joel.
So you turn your back to him, swipe your hair over one shoulder and turn your head to the side. You can hear him silently swear under his breath.
“You mind?” you say, gesturing to the zipper of your dress. His soft steps pads on the floor. You can almost feel his chest against your shoulder blades.
His fingers toy with the zipper, hot and rough but—hesitant. He pulls it down slowly anyways, exposing your back to the crisp air conditioned air, and the heat of his gaze. The straps fall as the zipper does, he curses again, succumbing to your decided fate.
You hold the front of your dress to your body on instinct, even though the only thing you want to do right now involves him ripping it off you.
He doesn’t say anything. He doesn’t do anything else—doesn’t back away or come closer or leave. So you reach your hand backward to find him and gasp softly when his fingers tangle with yours. You pull his hand to your body. He locks onto your waist like a leech.
“What’re you doin’?” He rasps against the shell of your ear, almost like he’s pleading with you. He sounds like he’s in pain. Maybe he’s torn between pleasure and good judgment. You want him to forget about the latter entirely.
Your stomach drops, you glance to the side again.
“I thought—”
“You thought, what?”
Your face goes hot, stare at your feet instead. His hand doesn’t leave you.
“I don’t…”
“You thought this was a good idea?”
You don’t say anything. For some reason you didn’t think it was a bad idea. Not when his hand reaches around to grab your hip.
“What would your daddy think?”
“I don’t really care what he thinks.” An admission more than anything.
He sucks in a breath. A quiet contemplation. The look on his face doesn't read pissed, but it's a far cry from happy. You don't know what is behind his gaze.
“Nothin’ but trouble.” He breathes out in a heavy sigh. “Ain’t ya?”
His voice is so much deeper now. His accent shows through, silken and so southern it makes you grip your dress a little harder on instinct. You’ve lost count of how many times your breath has gotten caught up in the tightness of your throat.
“‘S one word for it.”
He almost growls, his hand skits down to the hem of your dress and pushes his fingers under it, trailing upward, but stopping before he meets lace.
“You shouldn’t be in here.”
“No,” you agree breathlessly. “I shouldn’t.”
He slots himself against you, his other hand grips your hip and pushes you back into him. You gasp softly.
“Let it go.” You realize he’s talking about your dress. You squeeze your eyes shut. His lips skate against your neck in a way that makes you dip your head to the side in a silent surrender.
“Let it go,” he repeats.
You drop the hand on your chest and his t-shirt with it. Your dress falls to the floor in a black blanket of smoke. You gasp when his hands are on you, inching slowly from the hem of your underwear to grasp your breast in a rough, teasing palm.
A small sound escapes past your lips. His other hand, quick to respond, slots over your mouth, silencing you and your whiny moans.
It’s — rough. The way he pushes his palm into your face to quiet your whimpering, forcing your head back to rest against his shoulder. The way he pushes your underwear down your thighs to rest with his forgotten t-shirt, and your all too tight, too short dress. It’s rough, but so, so gentle.
It feels like heaven.
You pitch your back, arching into him in a desperate way. Writhing against him when he finally pushes a calloused finger in between your dripping folds.
“Jesus.” He shakes his head. You can feel the scratch of his beard against your temple. You wonder what that scruff might feel like between your thighs. “Been wantin’ it all night, huh?”
It’s a question, but not one he needs an answer to. The mess between your thighs is evidence enough.
Joel. You try to plead, but he’s relentless in his quieting attempts. The pad of his finger brushes against your clit and you’re keening against him. You can feel him smile.
“Quiet,” he whispers into your ear, then lifts his hand from your mouth, hovering, waiting until the inevitable moan to escape past your lips. But you try your hardest, bite at the skin on the inside of your lip, and he rewards you. He’s a gentleman like that. He sinks his middle finger into your cunt, rubbing tight circles on your swollen clit with his thumb. Everything about him is just so, just right.
Maybe, usually, with other guys, you’d be disappointed if they’re stingy with the foreplay. But you walked throughout the bar all night with slick dripping through soaked lace just at his words in the kitchen. Smart girl. So you push back into him and beg him—
“Joel.” You’re breathless. You plead at him with your body, with everything you have. “Please,” you whisper simply.
Something like desperation and want and a little twinge of anxiety settles in your stomach when he releases you. He walks you back to the edge of the bed. It smells like him when you lay down and the softness of the blankets kiss the edges of your face. You can hear the clink of his belt buckle and you suck in a tiny breath.
“How do you want it, baby?”
You push him back, and his eyes go wide. It’s the first reaction you’ve gotten out of him the whole night. A peak behind his brooding mask. And when you settle each leg on either side of his hips, he groans. It makes you a little more brave.
“Like this,” you whisper, placing your hands on his chest. He grabs at your wrists, and pushes them under his wide palm to his stomach so you lean forward down to him. He pushes his boxers down and you try not to look, but you make a small sound at the sight.
“Look good—” he grunts. You take his tip and notch it at your entrance. “Always look so pretty.”
Your heart pounds in your chest. Everything is different. Everything is new.
Pretty.
“Fuck,” you whisper, glancing down at just the sight of him. The size of him.
“You’re okay, angel.”
Your gaze snaps to his face. He nods. You believe him.
“I—ah—” you whimper. “I can take it.”
“I know you can,” he grunts when you sink down an inch and take the tip of him. Your hips cant at the feeling, taking more of him through groans and pressing whines. He lets you set the pace. Let's you take your time. Even when he’s panting through his gritted teeth and tight lips.
You sink down on him until there’s nothing left to take. It’s almost painful. But he’s right there, playing with the pearl of your clit, massaging your hips. He knows how much you can take and when you can take it. He seems to know alot about you while knowing very little.
“Shit,” you groan. “Oh my — god.”
You can hear him muttering something along the lines of perfect.
It feels that way—perfect. He fits inside you with a tight stretch but nothing compares to the feeling of his throbbing length resting inside you. You would die here with your wanton moans and you would wake to find nothing less.
“Joel,” you whine, clenching around him, the stretch starts to sweeten.
“That’s—fuck—yeah, good girl,” he whispers. He sounds like something sweet and dark and rough. You fist at his t-shirt. Just like the one left forgotten by the door. You don’t remember what you came in here for anymore. Not when you’re dangerously close from his thumb rubbing slow circles on your clit.
“Fuck. Yeah?” He can feel it. From the inside. “Y’gonna come, baby?”
It’s embarrassing. That you could come like this, with him waiting patiently inside you. You don’t have it in you to lie, you don’t have it in you to bounce up and down or move at all. He turned your legs to jello.
“I-I don’t—”
“C’mon,” he grunts and grips your hips to keep him flush to your body. “Know ya want it.”
It only takes one swift rock of your hips. His hands, broad and sprawled out across the plushness of your sides. Your body stalls out on top of him. He sits up to wrap his arms around you and brings you close on instinct. If your brain wasn’t so hazy and you weren’t so lightheaded your heart might swell at the thought. You bite out something sounding somewhat like his name—it’s a garbled whisper and cut of words but you think he gets the gist.
“I—Ngh—fuck,” he whispers into the crown of your hair. You can feel him throbbing inside you. You chuckle something halfway coherent and let him flip you over, settled on your stomach with your face in the sheets. His fingers skip over your backside.
“Joel,” you breathe. “I—”
“Relax,” he says behind you, spreading your folds and staring at the way your cunt clenches around nothing. “Just relax, angel.”
So you do, you sink boneless into the mattress and let him press you down into the sheets. He feels so broad. He feels so good. You tell him quite as much, in not so many words. You feel the weight of him settle behind you, his hand coming up to brace himself by your head.
“God, you feel so fuckin’ good.” He sinks in, inch by inch. It’s not so much of a stretch anymore. Carving a place for himself inside you. It feels like he belongs there. You think to yourself that he probably does. You’re squirming beneath him, wringing your fists in dark blue sheets.
You clamp your eyes shut when he bottoms out. Even more so when he finds a pace he likes and sets it. You don’t have to beg him anymore. Your legs shake beneath his hips, even more so when he hikes your leg up on the bed so he can push deeper.
Something deep rolls through you again. It shocks you. Most of the guys you’ve been with haven’t made you come once, let alone twice.
“I can’t—” you whine. “I—fuck.”
He picks up the pace.
“Y’can,” he grunts. “Know y’can, c’mon, baby.”
You nuzzle your face in cotton. His hips chase his release and you know you’re close when he nudges against your g-spot.
“Don’t stop,” you whine. “Please don’t fucking stop, Joel, please, it—ah."
When you come, he grunts through ragged breaths. White hot pools in your stomach and you whine so loudly you’re worried about the neighbors. His hand comes to brace against the back of your neck. You’re so fucking soaked he slides through you easily.
“Jesus, fuck,” he growls. He bears down on you and your hips and sinks to his elbows when he can’t keep himself up anymore. You feel the cotton of his t-shirt brush against your back. It sends a shiver up your spine. He comes, pulling out and spilling over your back. You try to hide your disappointment.
He lays beside you for a minute, you barely reach your hand up from the bedsheets to brush against his bicep. He studies your face and pants through a slack jaw. He’s scruffy and broad and — perfect.
Your gaze flick to his mouth, then his eyes. You silently realize he never kissed you.
“Gonna get me killed,” he whispers. It’s almost weirdly affectionate in a way only Joel Miller could say. Still stuck in a limbo between pleasure and reality. You smile, softly.
He climbs off you, and slinks to the bathroom. You wait with baited breath until you hear the water run. He emerges with a soft looking towel, damp with water, clinging to his fingers. You watch him and shiver when the towel touches your back.
“Okay?” he whispers when you sit up and turn to look at him.
“Yeah, okay.”
It feels like something is supposed to happen now. You’re not used to this. Everything slowly comes back as the pleasure ebbs and you blink back to reality. You open your mouth, then close it. He does the same.
You can hear Sarah’s door open and you both freeze. His brown eyes search yours through a furrowed brow. Your heart goes back into normal rhythm when you hear the bathroom door shut. Then nothing.
He snags a new shirt from his dresser and tugs it over your body.
The Texans.
“Cute,” you gesture to the shirt. It’s soft underneath your fingers, worn. A gentle kind of faded navy blue. Joel picks up your dress off the floor and folds it into your chest while scoffing.
“Shut up,” He shakes his head, but he can’t hide the smirk on his face. “Get outta here.”
It’s all oddly playful. Like you both can’t believe it and are giddy at that fact.
“Same time next week?”
Something deeper flicks across his gaze at the doorway. “Is that a promise?”
“You can’t answer a question with another question.”
You turn when you leave the doorway and settle into the hallway. He’s got his hand on the doorframe, leaning into it—towering over you and already burning something hot through you. Again.
“I just did,” he grumbles with a smug look, and then shuts the door.
__
2K notes
·
View notes
anon asked: Hi, fellow Kid-Stan, I love your writing, it's so well-written! So I hope my request isn't too weird, but would you mind writing some headcanons with a fem reader afraid of having sex with Kidd, Zoro, Law and Sanji if that's okay. Like because the reader is stressed about getting hurt (maybe because of their size or because it’s been a long time since the last time the reader had sex, no heavy topic involved!) Thank you if you consider writing this scenario and please, can I stay anon if you post this?
Hello, dear anon! Thank you for requesting and your kind words, it was interesting to think about how those dummies would act in this situation. I hope you'll like the result.♡
☆Kid, Zoro, Law & Sanji with a s/o afraid of having sex
CW : n/sfw, MDNI, f!reader, size kink, oral sex (reader receiving), fingering (reader receiving), v. sex, unprotected sex, protected sex, dirty talk, praises, Sanji talking in French because I could die for this, Kid is cursing as always, let me know if I forgot something
WC : around 2,000
You can read the part two here & the part three here
Kid
Let's assume it's your first time in the same bed: Kid being... Kid, his first reaction would be to grin cockily or even laugh proudly. He thinks you're actually praising him for his size. Please keep going, it’s music to his ears. He loves praises and when you acknowledge his size. It fuels his ego tremendously. "I know it's big, that's enough praise. Wait, were you talking seriously?"
Seriously, Kid, ugh.
So, once he realized you're not praising him but rather really stressed, he's still pleased with himself.
Kid is a man of action; talking, trying to understand, or reassuring is not something he's easily able to do. Because honestly, he would just say something like "it's just sex, I'm not gonna hurt ya, look how wet you are"
Whenever there's a problem, he's more inclined to take action to find a solution. So his first reaction is to ask if you want to stop. Although he may be cocky and carefree, he would never cause harm to anyone he truly cares about. And no one will have a good time if you're too stressed. Totally pointless.
So you have to tell him you want to continue, but you're nervous because Kid is not the one to indulge into sweetness and his size doesn't make things more easily.
"Then, come get what you want by yourself" he would say before laying on his back, his cock twitching impatiently. Kid doesn't often let his partner ride him, except when he's feeling tired. His body is truly a beautiful throne to sit on. A toned and beautiful body, covered with scars, like war paint, full of stories and secrets.
Once you finally straddle him, he would hold your hips firmly as you line your wet pussy up to his cockhead. When you slowly impale yourself on his thick member, he would let out a low, animalistic growl of satisfaction. You feel too tight around him, and you feel too full with him buried deep inside you, stretching your walls.
He would guide you down his cock until his balls deep inside you. The expression of pure delight on his face is truly mesmerizing. Riding someone as tough and impressive is quite intimidating, so he would hold your hips, helping you to move up and down, as you slowly adjust to him. "Fuck, look at you, taking me all the way in like the good girl you're"
He feels your walls tightening him as you start to move faster.
"Take it easy" That's the moment you will hear his shaky breath and deep growls. He can't handle how good you feel. So wet, so hot, so tight as you walls spasms around him. His cock is throbbing inside you and he grit his teeth, holding your hips that firmly it will leave bruises on your skin tomorrow.
He's truly trying his best to not just hold your hips and slams inside you as his usual rough and merciless pace. He wants to transform you into a whiny mess.
"Shit, y/n, let me fuck you."
And once you finally get used to him, then prepare yourself for the wildest ride of your life. You better hold onto those sheets tightly. Because he will slap your ass, pull on your hair and fuck you with enough intensity to leave you breathless and exhausted.
Zoro
Zoro has not a lot of experience because he's way too focused on his goal of becoming the greatest swordsman ever. Even when it comes to sex, he's a bit oblivious. So you better have to be precise and explain things correctly, so that it takes over his mind. As Kid, he's not a man of many words, he doesn't really know how to reassure you. Like, okay, it's been a while since the last time you had sex, but the same applies to him. At least you're in the same situation, isn't that nice?
He's trying his best.
Once he's sure you want to keep going, he will consider the whole thing like a training: everyone needs a good warm-up. So prepare yourself to have your pussy eat for a long, long time and to cum at least once against his lips. He may not be the most experienced, but he learns quickly and your body language is like talking to him.
He would then slowly push two fingers inside you, feeling how wet you are for him. "Looks like my girl is ready for me, yeah?"
Try not to be too embarrassed when he hungrily licks his fingers covered in your wetness, like if it were a precious cup of sake. The way your body looks and tastes is truly intoxicating. How could he get enough of your shivering, moaning, sweating, begging, and slow pleads when his head is buried between your thighs?
"Now open your legs for me"
Eyes darkening with lust as he sees your folds exposed, his cock twitching and throbbing. Although he is thick, he never realized it. So you better prepare yourself.
He would look into your eyes just to be sure you're still willing, before placing his hands on your shoulders to pinning you down the mattress, shifting his weight so he can position himself at your entrance.
Thrust forward, filling you up in one swift motion. He's completely focused, as if it's an important battle. And actually, he's really struggling to stay nice and slow for you. He's quiet. Breathe deeply and make low grunts close to your ear. When you begin to scratch his back, he becomes confused. Why are you doing this? Does it hurt or feel good? "You doing okay?"
If you tell him you need more now, he will give it to you as hard as you want.
"Such a brave girl"
Law
As a good doctor, his first reaction is to understand the cause of the problem. Is it a physical or psychological problem? Sex can be painful if you're experiencing too much stress or vaginismus. If he wants to help you feel better, he needs to understand what's going on. He’s a logical man, he can't act without a good understanding of what's happening.
He would probably cover your body too, in order to preserve your intimacy while you explain him you're just a bit stressed because it's been a long time and you often face pain when it comes to sex.
"Sex isn't supposed to hurt or to be stressful. Do you want to continue?"
As you slowly nodded, he would kiss your forehead and then slowly remove the bedsheets, revealing your bare body to himself.
He wants to reassure you even if he struggles with intimacy, including in the bedroom. He's not that kind of guy having sex with random people. If you end up in the same bed, it's because he genuinely cares about you. And damn, he definitely knows how to take care of your body too. He has divine hands. Good to heal, but also to help you reach new heights. The way he runs his hands along your body, your inner thighs, your pussy, and then your clit causes shivers down your spine.
And when he slides two fingers inside your core, damn, the only thing you can do is arches your back and beg for more. He’s the king of fingering. You can't help but cum as his thumb circles your clit while he pushes his long fingers in and out of you. When he removes them, his tattoos are soaked with your wetness, you are flustered, and he's content with himself. He can't help but grins, licking his fingers while watching your reaction closely. Even in bed, Law likes to tease you.
"Need me so bad, y/n-a?" with a slight pinch on your nipple
He's a doctor, so he will wear a condom. Even if you're wet, he'll reach for the bottle of lubricant and then sloshing some onto his palm before smearing it over his length. The emo boy myth is true because his cock is long.
Usually, Law struggles with eye contact, it's too intimate for his sake. But for once, he will let you lie on your back, spreading your thighs enough to fit in between. His tattooed chest slowly rises up with each breath, making him look beautiful over you.
"You're ready?"
He's a smart and careful person, so he'll go slowly and check your expression to ensure you're alright. He feels the tightness around his cock. So wet, so hot. His hands are shaking on your hips while he gently steady you. "Everything's fine?"
Slow and deep strokes as you trace the tattoos on his arms and chest. With his lips sealed to yours, he swallows all of your moans. And his low, deep breaths are leaving you in shambles.
Sanji
Oh, sweet Sanji. Similar to Zoro, he's not the most experienced, but he has a kind and compassionate soul. He would let you explain yourself, running his hands all over your shoulders, hair and stomach, trying to soothe you as you confess you're scared because it's been a while since the last time you had sex.
Sanji would never judge you. He would offer you sweet kisses to cover your body, promising to take things at your own pace. And if you need to stop, please just tell him. He would try his best to hide that he's a bit nervous too; nervous about hurting you or not being good enough for you.
Gentle kisses on your neck, breasts, lower stomach, inner thighs, and hands running all over your skin, fondling your breasts softly with a heavenly touch. He wants to take good care of every inch of your skin because your body is so precious, perfect and beautiful. All your shivering, moaning, and the way you look at him with pure love on your face... it melts his heart. He desperately wants to be inside you, but he'll never rush the whole thing. Like a good meal, sex deserves to be appreciated.
Probably the king of oral sex, he could keep his head burring between your thighs for the entire day and still can't get enough of how good you pussy feel and taste. He is fond of eating you out, hearing you moan, feeling you shivering and beg for more. The way your body is arching, how you grab his hair, pressing his lips more firmly against your wet folds. Not only do his hands know how to cook, but they also know how to please your body. Slowly circling your clit, fondling your breasts, and caring for every inch of your skin, making you melt and beg for more. You forgot you were tensed and stressed with all his attention.
Sanji being Sanji, he would love to bind your wrists with his tie, but he knows it's not the time for this. "I need to be inside you, mon amour" (my love) His cock is painfully hard and twitching, leaking in pre-cum.
As you spread your legs, letting him know that you're ready for more, Sanji would try his best to hide how stressed he really is. He doesn't want to hurt you. Fingers entwined with yours, a lot of eye contact as he slowly pushes his cock inside you. "Shh, it's okay. You're so tight. Laisse-moi te faire l'amour" (let me make love to you)
You softly moan as he penetrates you completely. You were stressed about getting hurt after such a long time without having sex, but Sanji is so soft that it didn't hurt even a bit. Even if you're relaxed, he would ask, "Am I hurting you?" And when you confirm that everything is more than fine, he can't help but sigh in relief. His fingers are still entwined with yours as you use your other hand to softly pull on his hair.
Slow and deep strokes. "C'est si bon d'être en toi" (it feels so good to be inside you) He is not ashamed of moaning. Moans that are really pretty. The feeling of your skin against his, how wet and welcoming you are inside. This is too much for him to handle.
Naturally, when it came to aftercare, he would rush to the kitchen to make you a good meal.
Sanji is so sweet please, help.
2K notes
·
View notes
big reputation part two | charles leclerc social media au
pairing: charles leclerc x fem reader
a new season dawns but that doesn't mean we don't have a map to our buried hatchets
MASTERLIST | BUY ME A KO-FI? | PART ONE
charles_leclerc
liked by maxverstappen1, yourusername and 3,221,783 others
charles_leclerc: ferrari has been home for as long as i can remember, even before i joined the academy, the dream of driving for ferrari gave me a purpose. i am heartbroken it hasn't worked out, but formula one is, at the end of the day, a selfish sport and i have to think about my real goal here: to win a championship. ferrari has an amazing history, but that is what it is history. in the four years i have been here i haven't seen the drive and ambition to be as ruthless and as complete as they were with michael and with kimi. therefore i have to leave. it hurts me to leave the tifosi, but know you're always in my heart and i will always hold dear your support. grazie regazzi essere ferrari ❤️
view all comments
user3: i knew it was coming but HOLY FUCK CHARLIE COME HOME
user4: tifosi lecfosi YES SIR
user5: for real i'm down for him not that clown team
yourusername: i'm proud of you charlie, i knew how much this took. but you have to put yourself first at some point. i love you
charles_leclerc: i love you too. i'm sorry i can't stop crying
yourusername: no i love that you are so passionate. it's been a long season and you're finally allowed to let it all out
charles_leclerc: can we go to a rage room?
yourusername: FUCK YEA
maxverstappen1: pretty please may i join. i have a lot of rage. call it teammate bonding?
charles_leclerc: give me a tow in bahrain quali?
maxverstappen1: fine (NO ONE SCREENSHOT THIS OR HOLD ME TO IT)
yourusername: at least this one i don't mind having to third wheel us
user6: the SHADE that's mother right there
user7: trying to stay insanely normal over the fact that max, charles and y/n are besties
pierregasly: congrats calmar, HOWEVER, i though i was your favourite third wheel 🥰
yourusername: but you bring kika ??? how can you third wheel if kika is there? DO YOU NOT KNOW HOW TO COUNT?
charles_leclerc: thank you pear i love you brother
user8: i love how this is some super sentimental post and y/n is asking pierre if he can count i hope they never change
landonorris: max as fave third wheel ??? @alexalbon @georgerussll63 twitch quartet erasure
yourusername: womp womp
alexalbon: WOMP WOMP?
charles_leclerc: guys i'm sad about leaving my dream team where is the compassion?
georgerussell63: yeah boo hoo there are bigger things at play here I DID NOT SIT THROUGH YOUR TEN HOUR MELTDOWN ON AN APPROPRIATE TWO YEAR ANNIVERSARY GIFT NOT TO BE TOP THIRD WHEEL
yourusername: you fools really will argue about anything huh
landonorris: this is the sanctity of our friendship on the line here
user9: the grid was really like YOU might be sad about leave ferrari but we ain't
yourusername
liked by maxverstappen1, charles_leclerc and 1,421,455 others
tagged: charles_leclerc
yourusername: holibobs with sharlie
view all comments
user10: i love as soon as the season finishes charles becomes THEE instagram boyf
user11: j.peg account? no. just taking photos of y/n? YES.
charles_leclerc: i have an eye for beauty
yourusername: heheheheheheehehehehehee
alexalbon: so he can use a camera? why does he only take 0.5s of me?
yourusername: the best angle for your big ol dome
alexalbon: EXCUSE ME ?
yourusername: yeah sorry that was a bit far
alexalbon: it's like you got off the ferrari leash and now we all have to suffer
yourusername: WELP
charles_leclerc: ma belle, the only one i'll actually listen to and put sun cream on
yourusername: yes you will because we...
charles_leclerc: put spf on everyday !!
yourusername: yes! because...
charles_leclerc: we're scared of aging?
yourusername: no?
charles_leclerc: we want to be safe 👍
maxverstappen1: you guys done with the kindergarten reading lessons?
yourusername: have you seen lobster leclerc? this kind of work needed to be done
user12: lobster leclerc? goodbye, goodbye, goodbye you were bigger than the whole sky
user13: see now i'm confused cause why are some papers saying that they're breaking up? or that charles is embarrassed by the way y/n acts?
user14: bestie we've been through this DON'T TRUST THOSE HOES - TRUST THESE HOES
liked by yourusername
user15: unless i see it from the horse's mouth I WILL NEVER BELIEVE THEY'VE BROKEN UP
redbullracing
liked by yourusername, christianhorner and 882,339 others
tagged: charles_leclerc, maxverstappen1
redbullracing: charles the qualifying king takes his first pole position for red bull in his first race and is joined by max for a front row lockout
view all comments
user18: UNWELL
user19: suck on that ferrari xoxo
user20: *rubs eyes* is that... max being happy to be challenged by a teammate ???
user21: winning three championships really takes the heat off huh
yourusername: THAT'S MY MAN YALL
charles_leclerc: love you baby
yourusername: love you too darling
maxverstappen1: love you three 🫶
yourusername: this is not the problem i thought we'd have when coming to red bull
maxverstappen1: my gf can't make most of the races so you WILL deal with me
user22: max being clingy to charles and y/n is so fucking funny to me
user23: sainz not making it out of q1? shwartzman only making it to q2 but still out qualifying carlos? charles looking sexy in blue? EVERY TONGUE THAT RISES AGAINST CHARLES LECLERC SHALL FALL
christianhorner: mega job boys, let's keep our eyes on tomorrow
maxverstappen1: tell them they have to let me come to dinner with them
christianhorner: isn't this the exact reason we rehired daniel
charles_leclerc: PLEASE MAKE DANIEL COME TO THE NEXT RACE
maxverstappen1: erm rude
charles_leclerc: i'm sorry i'm not used to a teammate that actually wants to be friends for real
yourusername: EXCEPT SEB WE LOVE SEB
yourusername: but for real max emilian i am monitoring the dutch papers... be very careful
user24: healthy teammate relationships (for now) ??? is this what heaven is like
user25: are you telling me that if max doesn't get the lead in the first lap he might actually HELP charles .... a certain spanish individual could never
charles_leclerc
liked by maxverstappen1, yourusername and 2,778,451 others
tagged: yourusername, maxverstappen1
charles_leclerc: wow !! a 1 - 2 in our first race i couldn't be happier. this car is a dream to drive and i'm so grateful to red bull for being so welcoming. teamwork makes the dream work
view all comments
user26: tears in my eyes
user27: okay i understand both of them are like with their forever partners but lestappen is also real TWO THINGS CAN EXIST AT ONCE
yourusername: SHARLIE OMG YOU TALENTED, TALENTED KING
charles_leclerc: I LOVE YOU SO MUCH
yourusername: crying sesh. sharlie's drivers room @ 8. bring your own alcohol and tissues
charles_leclerc: just to make sure everyone knows THESE ARE HAPPY TEARS
landonorris: SAP ALERT GET IT TOGETHER MAN
yourusername: i know lando no-wins ain't talking rn 🤨
charles_leclerc: you walked into that one buddy
landonorris: just because i'm friends with carlos doesn't mean you have to come after me like him ...
this comment has been deleted
yourusername: bold... real bold. you're lucky i'm doing meditation and yoga (and that i want to make a good impression on christian)
alexalbon: lando do NOT look at the text she just sent your your ego CANNOT take it
user28: no no no do spill... i need the ammo if he ever takes out my fave
user29: true i need it for the next time either of the ugly twins at ferrari open their gobs
oscarpiastri: it was brutal. they need to get y/n to host the reading challenge on drag race
yourusername: oscar knows drag race?
oscarpiastri: i might be an athlete but i'm not completely uncultured
maxverstappen1: if we're talking being cultured... GET READY FOR YOUR FIRST RED BULL PARTY
yourusername: born ready my university years singlehandedly financed your 'catering budget'
charles_leclerc: no really i think she's actually addicted to the tropical one
maxverstappen1: are you FUCKING KIDDING ME? IT WAS YOU WHO DRANK ALL OF THEM
yourusername: and what?
maxverstappen1: idk i'm still kinda scared of you
user30: the way charles deflected the questions about fred and sainz ? WE'RE FREEEEEEEEE
yourusername
liked by taylorswift, charles_leclerc and 1,311,723 others
tagged: charles_leclerc
yourusername: i wanna be your end game <3
view all comments
user32: you guys better be end game or like you're paying for my therapy
user33: i respect her dedication to go to every race, make ferrari staff tremble in fear and pull LOOKS
charles_leclerc: i want to be your first string
yourusername: what if we just called taylor up?
charles_leclerc: you know here you call her i'm nervous
yourusername: @taylorswift paris night one, lover and this is me trying ft. charles on the piano?
taylorswift: sure thing
charles_leclerc: why was that so easy?
yourusername: better get practising baby
charles_leclerc: OH GOD
user34: how did we get red bull charles and a taylor collab in one year?
user35: i guess we used up charles' good luck from the last four years SORRY CHARLES
charles_leclerc: i guess you're forgiven...
maxverstappen1: so could you like tell me what you'd call me if i hypothetically fucked charles over... i'm not gonna but like i need to mentally prepare myself to hear it
yourusername: i have faith in you so i haven't thought that far ahead
maxverstappen1: can you please not be too mean i can't take it
charles_leclerc: you wanna come to therapy with me buddy?
maxverstappen1: i think i might
yourusername: when we entered the reputation era i did not think it would lead to taking max verstappen to therapy
maxverstappen1: and taylor swift?
yourusername: ... and taylor swift
user36: this is all very cute and all but can we have mean y/n back
user37: when will yall learn that reputation is a love album and y/n and charles are just loving each other freely
user38: but mean y/n did teach someone a lesson in not spreading false rumours cause them tabloids have been QUIET
f1tea
liked by user43, user44 and 7,233 others
f1tea: carlos sainz was caught liking these tweets about charles leclerc and y/n y/ln, what do you think?
view all comments
user45: put me in the ring with carlos i am being so serious
user46: okay for a while i was on the fence about y/n and how intense she was being but like seeing this shit and realising it was probably what was being said in the garage she needed to do more
user47: for real if someone said that about my boyfriend i'd be in prison
user48: so charles and y/n were under contract to not say a word out of line about ferrari or anything to do with ferrari and this guy is out here liking this
user49: call me a conspiracy theorist but this was his public account... he meant for people to find it and wants people to know this stuff
user50: this is why he DNFed in the first race KARMA
user51: maybe this is why he's always the one with relationship issues bro clearly has no loyalty
user52: charles has never said anything about him even now and y/n only said something in retaliation
user53: fuck peace and love y/n needs to give this man hell
user54: read him for filth
user55: bro needs to keep his twitter fingers to himself and focus on not being in the wall ❤️
charles_leclerc
liked by maxverstappen1, yourusername and 2,311,885 others
tagged: yourusername
charles_leclerc: this is why we can't have nice things, darling
view all comments
user56: this is the most response we'll ever get from charles i fear
user57: allow me to elaborate: this is why we can't have nice things by taylor swift is about 'forgiving' the people who wronged you but she literally says "and here's to you because forgiveness is a nice thing to do... i can't even say it with a straight face" so basically charles doesn't forgive carlos or fred. and it specifically shouts out her family and friends and lover for sticking with her which is what charles' family, friends and y/n have done
liked by charles_leclerc
user58: thank you for service
yourusername: i'm reading what they call you lately (it says you're a race winner and a title contender)
charles_leclerc: got a taste of the celebrations and can't get enough
maxverstappen1: KEEP IT PG THERE ARE CHILDREN HERE
charles_leclerc: you're older than me
yourusername: all we said were celebrations, if anything you have the dirty mind 🤨
maxverstappen1: i am usually in the room next to you, i hope this helps
charles_leclerc: our bad <3
maxverstappen1: you don't care do you?
yourusername: not really no. when we get to the same amount of wins as you maybe it'll wear off
maxverstappen1: not on my watch
user58: is this an entertaining title fight but without the bad blood?
user59: and nowhere near ferrari? bless
alexalbon: i hate that i understand all these references
yourusername: lily trained you well
lilymunhe: like a drill sergeant
yourusername: as you should
sebastianvettel: proud of you charlie, i'm glad you're not wasting your talent
charles_leclerc: i love you seb, i'm sorry it took so long
sebastianvettel: make sure you win here, we can be ferrari failures together
yourusername: *ferrari failed you
sebastianvettel: i knew there was a reason i liked you
fin.
note: SOZ. so like i am still working on requests but that radio message FUCKED ME UP. so this had to happen. glad my queen girls (max and charles) did well today, hope you enjoyed !!!
2K notes
·
View notes
maroon
this is part 2 of maroon
✮⋆˙ when carlos breaks reader’s heart, lando is ready to mend it
✮⋆˙ ex carlos sainz x singer!reader | bestfriend lando norris x singer!reader
✮⋆˙ warnings: cheating, carlos is an asshole, slut shaming
✮⋆˙ tofi talks: thanks for the love on part 1! one last part coming soon x please ignore dates
───── ⋆⋅☆⋅⋆ ─────
yourusername
liked by landonorris, charles_leclerc, carlossainz55 and others
yourusername: my new album GOOD RIDDANCE out march 27! presave in my bio 💜
this project means a lot to me and i hope you love it as much as i do. i can’t believe this is my first full album!!
i also wanted to thank you from the bottom of my heart for all the love you are giving to MAROON 🍒 i wrote this song at 3a.m. in my best friend’s room, crying my little pisces heart out and accepting that sometimes letting go is for the better. i never expected it to get big, it was just an outlet for me, so again, thank you a million times!
this one is for you, you know who you are.
view 839 comments
landonorris: woop woop
landonorris: i’m so incredibly proud of you
landonorris: please let me listen to the whole album :(
yourusername: not yet 🤍
lilyzneimer: babe CAN I? i just know a few of these are love songs.
oscarpiastri: me too please x
yourusername: sending u the link for tmr!!!
user1: WHICH ONE ARE LOVE SONGS!????yourusername: i don’t kiss and tell x
user2: BITCH ALDNWNS
maxverstappen: P is so excited to hear it!
yourusername: i will send you the link to the early listening party 💜
user3: carlos liking this 😥 the audacity this mas has
user4: why is no one talking about the last part guys, is it for lando? carlos???
user5: its not always about them u know?
───── ⋆⋅☆⋅⋆ ─────
───── ⋆⋅☆⋅⋆ ─────
yourusername just posted a story
replies
landonorris: can’t wait to see you tonight
landonorris: you look beautiful
yourusername: lan 🥺 thank u love, got pretty for u!!!
landonorris: i’m giggling and kicking my feet
landonorris: think about what i told you
yourusername: i already said yes lan 🤭
oscarpiastri: why is lando blushing? what did you do?
yourusername: lol
yourusername: he asked me out on a date and i said yes? 👉🏻👈🏻
oscarpiastri: KALSW SUAVW YN!!!!
oscarpiastri: sorry lily took over
oscarpiastri: that’s amazing tho, told you he likes you!
yourusername: don’t you think it’s too soon? after everything that happened? :/ be honest
oscarpiastri: nah, after what carlos did you are allowed to move on. plus if you listen carefully to your songs lando and you are long overdue
yourusername: thank u osc 🤍 please take carlos out on the next race
yourusername: kidding!!! (not)
oscarpiastri: at your service (kidding) (not)
───── ⋆⋅☆⋅⋆ ─────
───── ⋆⋅☆⋅⋆ ─────
lando.jpg
liked by yourusername, danielricciardo, kellypiquet and others
lando.jpg: yourusername just finished the first leg of her tour looking beautiful as ever. in honour of new year’s day being played today you can have that picure we took drunk at said party
view 920 comments
user1: i thought this was a yn post lol
user2: the second picture i’m screaming!!! the fact that she was dating carlos at the time yet she always looked at him like that 🥺
user3: slut behaviour
oscarpiastri: i’m so normal about this
yourusername: my favorite photographer ever 🤍
yourusername: glad you could make it tonight!! let’s get a podium tomorrow so we can go home and rest
lando.jpg: yes ma’am
maxverstappen1: Did you do it?
landonorris: yes
maxverstappen1: What did she say?
landonorris: yes
maxverstappen1: 🤝🏻👍🏻
user3: what is this
user4: they have such a weird relationship i swear
───── ⋆⋅☆⋅⋆ ─────
yourusername
liked by landonorris, oscarpiastri, lilymhe and ohters
yourusername: highnobiety thank you so much for having me! martietomanova shooting with you is a real rare joy.
link in bio if you wanna read my interview taking about silly things and my new album!
view 923 comments
user1: my jaw is on the floor
user2: lando must be loosing it rn lol about to risk it all
oscarpiastri: you are correct
user2: nooo dont expose him lol
landonorris: asdjqenxf
landonorris: WHAT IS THIS
landonorris: YN???????
landonorris: please pick up the phone im so in love with you *deleted*
landonorris: GORGEOUS GORGEOUS WOMAN
landonorris: stop looking at her PLEASE im going insane
landonorris: you are the most beautiful human being on this whole world
yourusername: 🤭🤭 im blushing
yourusername: see u soon?
landonorris: YES
landonorris: im picking u up RIGHT NOW
landonorris: i would risk everything for you *deleted*
user3: anyone else saw lando’s deleted comments? boys down bad haha
user4: i love how as soon as she broke up with him he started showing he likes her lol long overdue
last part coming soon
taglist: @evie-119 @landossainz @noneofyallsbusiness @ladyblablabla @likedbygaslyy @softiecaro @1655clean @willowpains @lightdragonrayne if your name is crossed out i couldnt tag you
1K notes
·
View notes
Hi I hope you’re well!! I just read the new chapter of the cat sitter and ugh I love that series so fucking much!! I was listening to a song and just knew you could create this.
So it a Max x reader smau where the reader is a mega pop star. Like Taylor Swift big and all eyes are on her. She gets invited to an F1 race by Redbull and joins their after party and gets to meet Max. Unfortunately Max is still dating K*lly. Reader is completely enamored by Max and writes break up with your girlfriend, I’m bored literally released it the next week. Everyone is losing their fucking mind trying to figure out who it is. Max knows it’s about him and he’s playing it cool and breaks it off with K*lly and starts secretly dating reader. Reader drops an album full of love/spicy songs like Gorgeous, Lover, Dress, 34+35, Positions etc etc and fucking hard launches them. Thanks!! If this is way too long and convoluted feel free to ignore.
Can’t wait to read more of your work because you absolutely body smau, it’s so good and the meme reaction pictures you use *chefs kiss*
break up with your girlfriend, i’m bored ✧ max verstappen
max verstappen x fem! singer! reader
masterlist
I LOVE THIS IDEA!! thank you @todaynotseen for your request🤍
[instagram]
ynupdates
liked by username and 492.289 others
ynupdates guess who is spotted at the paddock! y/n is at the austin gp as red bull’s special guest 🥰
view all 1.527 comments
username SLAY 🧎♀️
username can’t wait to see her interactions with the drivers!
username i’m surprised that she even had the time to go to a race? i thought she was super busy with the tour😭
↳ username i hope she’s taking care of herself🥲
username THAT OUTFIT?!??! 😍😍
username im not saying that y/n is the most beautiful girl that has ever walked the earth but that is exactly what im saying 🤷🏻♂️
username Hey @/redbullracing, how about inviting someone who actually gets F1 for a change? I’m so sick of seeing a random celebrity who probably don’t know a thing about racing
↳ username uHM excuse me?!?? y/n’s brother has always been a big fan of f1 and she often goes with him to watch the races😭
username ma’am please get back to the studio, i need more music😩
[messages]
[instagram]
[twitter]
[messages]
[twitter]
[spotify]
[instagram]
yourusername
liked by maxverstappen1 and 7.037.222 others
yourusername my muse <3
tagged maxverstappen1
comments on this post have been limited
maxverstappen1 Lover💙
taylorswift 😍
landonorris Max can’t stop singing your songs 😒
↳ danielricciardo Yeah, it’s getting annoying
↳ maxverstappen1 Ok, no signed CD for you guys
↳ landonorris WHAT NO IM SORRY PLEASE DONT MY SISTER WILL KILL ME 😭
brotherusername 😩😩😩
↳ yourusername couldn’t do this without you big bro😘
-
pictures (c) to pinterest and instagram
2K notes
·
View notes